Abstract
Background:
The multidrug resistance of bovine-derived Klebsiella pneumoniae is a significant concern, with biofilm formation serving as a major factor in the escalation of antibiotic resistance. The function of cAMP receptor protein (CRP), which is encoded by the crp gene and acts as a central regulator of environmental sensing and virulence, remains unclear in pathogenic strains derived from livestock.
Purpose:
This study aims to investigate the influence of CRP overexpression on biofilm formation and antibiotic resistancein bovine-derived Klebsiella pneumoniae, with a particular focus on its effect against cotrimoxazole.
Methods:
Recombinant strains with constitutive (Pkan) and inducible (Ptac) promoter-driven CRP overexpression were constructed using molecular cloning. Gene and protein expression were validated using RT-qPCR and immunoblotting analyses. Biofilm formation was quantified by crystal violet staining, antibiotic susceptibility to 23 agents was assessed using the Kirby-Bauer disk diffusion method, and metabolic burden was evaluated through growth curve analysis.
Result:
The CRP-overexpressing strain (KAN group) showed a 2.9-fold increase in CRP protein expression (p < 0.01) and a significant enhancement in biofilm formation (p < 0.0001), without significant impact on bacterial growth. Notably, a reversal in antibiotic susceptibility was observed: while the wild-type strain was sensitive to cotrimoxazole (inhibition zone: 22 mm), the CRP-overexpressing strain displayed complete resistance (inhibition zone: 7 mm).
Conclusion:
Overexpression of CRP protein promotes biofilm formation and confers resistance to cotrimoxazole in bovine-derived Klebsiella pneumonia, indicating that CRP-mediated biofilm formation might be a key mechanism driving the observed cotrimoxazole resistance in this strain.
Introduction
Klebsiella pneumoniae (KP) is a significant zoonotic pathogen that poses a serious threat to the beef cattle industry. It is associated with respiratory infections, sepsis, and other diseases, leading to clinical symptoms such as coughing, high fever, and increased mortality, which ultimately lead to substantial economic losses (). Recent epidemiological studies have demonstrated the widespread prevalence of KP among beef cattle in China. For instance, KP accounted for 19.7% of respiratory isolates in Chongqing () and was detected in 15.6% of diseased cattle in Shenyang (). Notably, multidrug resistance (MDR) in bovine-derived KB has received growing attention. These KP isolates frequently carry multiple resistance genes, including shv, ctx-M, and sul2, and commonly exhibit high resistance rates to antibiotics such as β-lactams and aminoglycosides, often exceeding 80% (; ; ). The rise in antibiotic resistance undermines treatment efficacy, complicates recovery, and exacerbates the impact of KP infections in beef cattle. However, the mechanisms underlying MDR in KP remain poorly understood.
A biofilm is a structured ecosystem formed by bacteria that adhere to biotic or abiotic surfaces and secrete extracellular polysaccharides (EPS), proteins, and lipids to encase the microbial community (). In recent decades, biofilm formation has been closely linked to the pathogenicity and antibiotic resistances of KP. Clinical studies have also shown that biofilm formation in carbapenem-resistant Klebsiella pneumoniae significantly increases patient mortality risk by 3.2-fold (). Biofilms enhance antibiotic resistance through three primary mechanisms: extracellular matrix act as a physical barrier, significantly reducing antibiotic penetration (); the high bacterial density within biofilms (>108 colony-forming units per cubic centimeter, CFU/cm3) shortens plasmid transfer distances () and promotes horizontal gene transfer due to increased spatial proximity (; ); and the biofilm microenvironment induces the overexpression of efflux pump genes (such as acrA and emrB), establishing an active efflux defense network (). Although recent studies have demonstrated that biofilm formation is a complex, multistage process rigorously regulated by molecular mechanisms such as type III pili, capsular polysaccharides, quorum sensing, and efflux pumps (; ; ; ; ), the specific regulatory mechanisms responsible for biofilm-associated drug resistance remain largely unclear.
As a global transcriptional regulator, the cyclic AMP receptor protein (CRP) is widely conserved in bacteria and functions as a homodimer. Each subunit comprises two domains: an N-terminal domain responsible for cAMP binding and dimerization, and a C-terminal domain that mediates specific DNA recognition via a helix-turn-helix motif. Upon binding cAMP, CRP undergoes an allosteric conformational change, enabling high-affinity interaction with target DNA sequences and subsequent activation of gene transcription (). Traditionally studied in Escherichia coli as a canonical transcription factor regulating catabolite-sensitive genes, recent evidence suggests CRP can also participate in post-translational regulatory networks, such as biofilm maintenance, through direct protein–protein interactions with other signaling effectors (). Given its multifaceted regulatory potential, a critical question arises: how is CRP’s function specifically deployed in Klebsiella pneumoniae to influence pathogenesis? In KP, CRP also acts as a master regulator of virulence and adaptation. For instance, CRP positively regulates biofilm formationas, as crp gene knockout can reduce biofilm biomass by more than 10-fold reduction, likely through modulating fimbriae production. Additionally, Yang et al. demonstrated that CRP directly binds to the promoter region of the kfuABC operon and represses its transcription, suggesting that CRP may also negatively regulate capsule-related genes, such as those involved in iron acquisition (kfuABC) and capsular polysaccharide synthesis (; ). Furthermore, it was reported to positively regulates the siderophore gene entC, thereby dynamically balancing bacterial colonization and resource competition (; ). Despite these pivotal roles, the precise mechanisms by which CRP coordinates biofilm formation and biofilm-associated antibiotic resistance in KP remain poorly understood.
Therefore, to directly assess the phenotypic consequence of elevated CRP, this study constructed CRP-overexpressing strains of a bovine-derived Klebsiella pneumoniae isolate. We systematically compared the wild-type and overexpression strains for their growth kinetics, biofilm-forming capacity, and susceptibility profiles to 23 clinically relevant antibiotics. A key finding was the specific reversal of susceptibility to cotrimoxazole upon CRP overexpression. This work establishes a causal link between CRP levels, enhanced biofilm formation, and specific antibiotic resistance, providing a foundation and critical phenotypic context for future investigations into the underlying molecular mechanisms.
Materials and methods
Strains and reagents
The KP-L strain used in this study was isolated in 2018 from the lung of a beef cattle that died of severe pneumonia on a farm in Sichuan Province, China. It was identified as Klebsiella pneumoniae and stored as part of our laboratory’s clinical isolate collection. This strain exhibits a multidrug-resistant profile (as detailed in Results) and was selected for its clinical relevance in studying bovine respiratory disease. Escherichia coli DH5α competent cells (DH5α) and the kanamycin-resistant plasmid pET28a(+) were purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). Since the T7 promoter of pET28a(+) is essentially silent in KP and unsuitable for gene expression in KP (), constitutive promoters Pkan and Ptac, both reported to be effective and successfully used for heterologous expression in KP (), were selected to replace the T7 promoter in this study. Taq DNA polymerase was obtained from Nanjing Vazyme Biotech Co., Ltd. (Nanjing, China), and restriction enzymes and DNA ligase were acquired from Takara Biomedical Technology Co., Ltd. (Beijing, China). Plasmids miniprep kits, PCR product purification kits, bacterial genomic DNA extraction kits, and RNA extraction kits were sourced from TIANGEN Biotech Co., Ltd. (Beijing, China). DL50 and DL2000 plus DNA markers were purchased from Tsingke Biotechnology Co., Ltd. (Beijing, China). Fluorescent dyes were sourced from TransGen Biotechnology Co., Ltd. (Beijing, China), and kanamycin and crystal violet were obtained from Beyotime Biotechnology Co., Ltd. (Shanghai, China). Detailed information about the sequences of genes and primers used in this study are listed in Table 1. Gene-specific primers were designed based on the conserved sequences of the crp gene and promoter regions from Klebsiella pneumoniae genomes available in the NCBI GenBank database. Primer design was performed using oligo 7 software to ensure specificity and to incorporate the required restriction enzyme sites.
Table 1
| Genes | Sequences (5′-3′) |
|---|---|
| Ptac | GGATCCttgacaattaatcatcggctcgtataatgGAATTCa |
| crp-F/R | F: cgcGGATCCatgGTGCTTGGCAAACCGCAAA |
| R: gggAAGCTTTTACTTGTCGTCATCGTCTTTGTA | |
| Pkan-F/R | F: gaAGATCTGAAGATCCTTTGATCTTTTC |
| R: gcgGGATCCAACACCCCTTGTATTACT | |
| Ptac-F/R | F: cgcGGATCCttgacaattaat |
| R: ggcGAATTCcattatacgagccg | |
| 16s-F/R | F: CATCATGGCCCTTACGACCAG |
| R: ACGATTACTAGCGATTCCGACT | |
| crp | 1: CCGCAAACAGACCCTACCCT |
| 2: AGCCACGGAGCCTTTAACGA |
Detailed information about the sequences of genes and primers used in this study.
The underlined regions indicate restriction enzyme sites.
Construction of the crp gene overexpression KP strain
Acquisition of the promoter and construction of the overexpression vector
The kanamycin resistance gene promoter (Pkan) was amplified from pET-28a (+) plasmid using primers (Table 1) engineered with BglII/BamHI restriction sites. Polymerase chain reaction (PCR) was performed in a 25 μL reaction system containing 7.5 μL ddH₂O, 12.5 μL 2 × Rapid Taq Master Mix, 1 μL each primer, and 3 μL template. The cycling conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 30 cycles of 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 15 s per kb, ended with a final extension at 72 °C for 5 min. The amplified products were purified using a gel recovery kit and subjected to double digestion with BglII/BamHI, along with the pET-28a (+) plasmid, at 37 °C for 10 min in a 50 μL reaction system containing 5 μL 10 × QuickCut Green Buffer, 1 μL of each enzyme, 40.5 μL ddH₂O, and 2.5 μL DNA. After purification, the digested fragments were ligated at a 1:1 volume ratio in a 9.5 μL reaction system containing 4 μL each of fragment and vector, 1 μL 10 × T4 Ligase Buffer, and 0.5 μL T4 Ligase at 65 °C for 1 h. The ligation mixture was then transformed into DH5α via heat shock at 42 °C for 90 s. Positive clones (pEkan) were screened by colony PCR using primers Pkan-F/R (Table 1) and verified by BglII/BamHI restriction digestion. The expected PCR product size was 130 base pairs (bp).
For construction of the pEtac vector, a synthetic Ptac promoter fragment which was designed based on the sequence reported by and engineered with BamHI and EcoRI restriction sites at the 5′ and 3′ ends, respectively, was synthesized and sequence-verified by Sangon Biotech (Shanghai, China). Both the pET-28a vector and the Ptac fragment were double-digested with BamHI and EcoRI under previously described conditions. The digested products were purified and ligated, and the resulting ligation mixture was transformed DH5α to generate the pEtac plasmid.
Cloning of the crp gene and construction of the recombinant plasmids pEkan-CRP and pEtac-CRP
Genomic DNA was extracted from the KP-L strain, and the crp gene was amplified using its primers crp (Table 1) engineered with EcoRI and HindIII restriction sites. The expected size of the PCR product was 643 bp. After gel purification, the amplified fragment and the pEkan plasmid were double-digested with EcoRI and HindIII under previously described conditions. The digested products were ligated at a 1:1 ratio to construct the recombinant plasmid pEkan-CRP. The ligation mixture was transformed into DH5α, and positive clones were identified by colony PCR with its primers crp-F/R (Table 1) and verified by double restriction enzyme digestion, with the expected PCR product size being 773 bp. The recombinant plasmid pEtac-CRP, places the crp gene under the control of the tac promoter, was commercially synthesized by Sangon Biotech according to the design of this study and delivered as a clonal stock in DH5α. The sequence of the entire expression cassette was fully verified. Figure 1 illustrates the plasmid maps of the pEkan-CRP and pEtac-CRP.
Figure 1
Electrotransformation of KP
Preparation of KP-L competent cells began by harvesting the cells during the logarithmic growth phase, followed by three washes with pre-chilled sterile water. The final cell pellet was resuspended in 200 μL of 10% glycerol. For transformation, 5 μL of each recombinant plasmid was added to the competent cells and incubated on ice for 5 min. Electroporation was performed using the following parameters: 2.5 kV, 200 Ω, 25 μF. Immediately after electroporation, 800 μL of antibiotic-free LB medium was added to the cells for recovery at 37 °C and 200 rpm for 5 h. The recovered culture was then plated on LB agar containing 50 μg/mL kanamycin and incubated at 37 °C for 16 h. Positive transformants were identified by PCR using the Pkan-F and crp-R primers (Table 1).
Screening and identification of recombinant strains
Single, smooth, well-rounded colonies were selected and suspended in ultrapure water to provide templates for PCR amplification. Colony PCR was performed using the primers Pkan-F and crp-R for pEkan-CRP, and PEtac-F and crp-R for pEtac-CRP, under the same reaction conditions and cycling program as previously described. The expected PCR product sizes were approximately 773 bp for pEkan-CRP and 669 bp for pEtac-CRP.
Validation of crp-overexpression strain
Reverse transcription quantitative PCR analysis
Total RNA was extracted from the recombinant Klebsiella pneumoniae strain KP-L using the RNAprep Pure Cell/Bacteria Kit. RNA integrity and concentration were verified spectrophotometrically, followed by DNase I treatment to eliminate genomic DNA contamination. First-strand cDNA was synthesized from 1 μg of total RNA using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix, according to the manufacturer’s protocol.
Quantitative real-time PCR (qPCR) was performed using SYBR Green I chemistry on a Real-Time PCR system. The 20 μL reaction mixture contained SYBR Green mix, gene-specific primers for crp(crp-1/2), and diluted cDNA template. The 16S rRNA gene served as an endogenous control. The thermal cycling conditions were: initial denaturation at 94 °C for 30 s, followed by 40 cycles of 94 °C for 5 s and 60 °C for 30 s. A melting curve analysis was included to confirm amplification specificity. All reactions were performed in triplicate.
Immunoblotting analysis
Five hundred microliters of bacterial culture were centrifuged, and the pellet was washed with PBS. Bacterial cells were lysed with B-PER™ Complete Bacterial Protein Extraction Reagent (Thermo Fisher, Cat# 89821) at a ratio of 5 mL per gram of cell wet weight at room temperature for 15 min. The supernatant was collected, mixed with 5 × loading buffer, and boiled for subsequent analysis. For each sample, 60 μg of protein was separated by SDS-PAGE using an 8–12% separating gel and a 5% stacking gel, with electrophoresis performed at 80 V for the separating gel and 60 V for the stacking gel. Proteins were transferred to a PVDF membrane using a wet transfer system at 100 V for 2 h. The membrane was blocked with 5% BSA in TBST for 1 h, then incubated overnight at 4 °C with primary antibodies (Anti-CRP, BioLegend Cat# 664304, diluted 1:500; Anti-rpoβ, Abcam Cat# ab191598, diluted 1:2000). After washing with TBST, the membrane was incubated with HRP-conjugated secondary antibodies (Goat anti-Mouse IgG, Thermo Pierce Cat# 31160, and/or Goat anti-Rabbit IgG, Thermo Pierce Cat# 31210, diluted 1:5000) for 1 h at room temperature. Detection was performed by treating the membrane with ECL substrate (SuperSignal® West Dura Extended Duration Substrate, Thermo Pierce Cat# 34075) for 1 min and exposing it to X-ray film for 5–10 min.
Phenotypic differences between crp-overexpression and wild-type KP-L strains
Growth curve analysis
To assess the metabolic burden in the overexpression strain, pure cultures of wild-type (WT) and crp-overexpressing (OE) strains were inoculated into LB broth and incubated at 37 °C with shaking at 500 rpm. A 10 μL aliquot from each culture was transferred to fresh LB broth and incubated under the same conditions. At 1-h intervals, bacterial suspensions were homogenized and transferred to a 48-well plate for OD₆₀₀ measurement.
Analysis of drug resistance phenotype
The antimicrobial susceptibility of the WT and OE strains was determined using the Kirby-Bauer disk diffusion method following CLSI guidelines. Bacterial suspensions were adjusted to the optimal concentration and uniformly spread onto Mueller-Hinton (MH) agar plates. Twenty-three antibiotic disks representing seven major classes commonly used in clinical practice were placed on the agar surface. Plates were incubated upside down at 37 °C overnight.
Quantitative analysis of biofilm formation ability
Biofilm formation was assessed using a semi-quantitative crystal violet staining method in 96-well plates (). Specifically, bacterial suspensions were adjusted to 1.5 × 108 CFU/mL, and 10 μL of each suspension was added to wells containing 190 μL of LB broth. Each strain was tested in three technical replicates, with blank controls included. After 48 h of static incubation, biofilms were stained with crystal violet, washed with sterile phosphate buffered saline, and the dye was solubilized for OD570 measurement. The absorbance values from replicate wells within each experiment were averaged. The entire assay was performed in three independent experiments.
Statistical analysis
All quantitative data, including OD₆₀₀ values from growth curves, OD₅₉₀ values from biofilm assays, inhibition zone diameters, and relative gene/protein expression levels, are presented as mean ± standard error (SE) of at least three independent experiments. For biofilm assays, each biological replicate consisted of three technical replicates. For growth curves, measurements were taken from duplicate cultures in each independent experiment. For Reverse Transcription Quantitative PCR (RT-qPCR) analysis, the relative expression level of crp mRNA was calculated using the 2−ΔΔCt method, with data presented as fold changes normalized to the WT group. The 16S rRNA gene served as an endogenous control. For Western blot analysis, band intensity was quantified using ImageJ software. The relative expression of CRP protein was calculated as the ratio of CRP band intensity to that of the internal control rpoβ. Statistical comparisons between WT OE groups were performed using Student’s t-test. A p-value of less than 0.05 was considered statistically significant. All statistical analyses were conducted using GraphPad Prism software (version 10.1.2).
Results
Successful cloning of the constitutive promoter and crp gene
PCR amplification of the Pkan promoter from pET28a plasmid yielded a product of approximately 130 bp (Figure 2A). Amplification of the crp gene from KP-L genomic DNA produced a fragment of approximately 642 bp (Figure 2B).
Figure 2
Construction and verification of the expression vector and recombinant KP-L strain
Colony PCR of transformed DH5α clones showed bands of expected sizes for pEkan-CRP (773 bp) and pEtac-CRP (669 bp) (Figures 2C,D). Electroporation of pEkan-CRP and pEtac-CRP into KP-L yielded transformants confirmed by colony PCR with expected band sizes (Figures 2E,F).
CRP expression levels in WT and OE KP-L strains
RT-qPCR analysis showed significantly higher crp transcript levels in KAN (4.318 ± 0.124) and TAC (6.797 ± 0.378) groups compared to WT (1.00 ± 0.083) (p < 0.01) (Figure 3A), Western blot analysis confirmed elevated CRP protein levels in KAN (1.337 ± 0.036) and TAC (0.794 ± 0.142) groups versus WT (0.435 ± 0.019) (p < 0.05) (Figures 3B,C).
Figure 3
Growth curves of the WT and OE KP-L strains
Kinetic monitoring of OD600 values for WT and OE KP-L strains over 24 h of shaking incubation at 37 °C demonstrated that both strains exhibited typical growth curve characteristics, with a brief lag phase (0–1.5 h) and no significant difference in initial biomass (WT initial OD600: 0.034–0.056; OE: 0.032–0.059). During the exponential phase (1.5–7 h), OD600 values increased rapidly in both strains, and biomass remained highly consistent at time points (e.g., at 5 h: WT 2.016–2.133, OE 2.035–2.098; at 7 h: WT 3.031–3.141, OE: 3.111–3.157). In the stationary phase (>7 h), both strains reached similar plateau biomass (approximate 4.0–4.2) by 16 h, which was maintained through the 24-h period (WT: 4.248 ± 0.002; OE: 4.248 ± 0.002) (Figure 4A).
Figure 4
Biofilm formation capacity of the WT and OE KP-L strains
Crystal violet staining revealed significantly higher OD590 values in the OE group (0.347 ± 0.129) compared to WT (0.136 ± 0.120) (p < 0.05) (Figure 4B).
Drug resistance of the WT and OE KP-L strains
Disk diffusion assays showed similar resistance profiles for most antibiotics in WT and OE strains. A notable difference was observed for co-trimoxazole (SXT): WT was susceptible (inhibition zone: 21.67 ± 1.53 mm), while OE was resistant (inhibition zone: 7 ± 0 mm) (Table 2; Figure 4C).
Table 2
| Antibiotic | Content | Resistance phenotype | IZDb OEc (mm) | RPd OE | IZDe WT (mm) | RP WT | ||
|---|---|---|---|---|---|---|---|---|
| Ra | Ia | Sa | ||||||
| AMP | 10 | ≤11 | 12–14 | ≥15 | 7 | R | 7 | R |
| KZ | 30 | ≤14 | 15–17 | ≥18 | 26 | S | 19 | S |
| CRO | 30 | ≤13 | 14–20 | ≥21 | 33 | S | 24 | S |
| CAZ | 30 | ≤14 | 15–17 | ≥18 | 29 | S | 19 | S |
| LEX/CL | 30 | ≤14 | 15–17 | ≥18 | 22 | S | 18 | S |
| GEN/CN | 10 | ≤10 | 11–14 | ≥15 | 20 | S | 22 | S |
| STR | 10 | ≤10 | 11–14 | ≥15 | 16 | S | 20 | S |
| KAN | 30 | ≤13 | 14–17 | ≥18 | 7 | R | 21 | S |
| TIL | 15 | ≤10 | 11–14 | ≥15 | 7 | R | 7 | R |
| AZM | 15 | ≤13 | 14–17 | ≥18 | 13 | R | 12 | R |
| E | 15 | ≤13 | 14–17 | ≥18 | 9 | R | 10 | R |
| BA | 10 | ≤13 | – | ≥14 | 7 | R | 7 | R |
| PB | 300 | ≤11 | 12–14 | ≥15 | 15 | S | 15 | S |
| CIP | 5 | ≤15 | 16–20 | ≥21 | 28 | S | 29 | S |
| ENR | 5 | ≤15 | 16–20 | ≥21 | 33 | S | 26 | S |
| LEV | 5 | ≤26 | – | ≥27 | 23 | R | 26 | R |
| OFX | 5 | ≤12 | 13–15 | ≥16 | 36 | S | 25 | S |
| DA | 2 | ≤14 | 15–20 | ≥21 | 7 | R | 7 | R |
| MY | 2 | ≤14 | 15–20 | ≥21 | 7 | R | 7 | R |
| CHL | 30 | ≤12 | 13–17 | ≥18 | 22 | S | 21 | S |
| OT | 30 | ≤18 | 19–21 | ≥22 | 26 | S | 22 | S |
| TE | 30 | ≤14 | 15–18 | ≥19 | 23 | S | 25 | S |
| DXT | 30 | ≤10 | 11–13 | ≥14 | 26 | S | 23 | S |
| SXT | 25 | ≤10 | 11–15 | ≥16 | 7 | R | 22 | S |
Detailed information about the results of the zone of inhibition assay.
R, resistant; I, intermediate; S, susceptible.
IZD, inhibition zone diameter.
OE, crp-overexpression KP-L strain.
RP, resistance phenotype.
IZD, inhibition zone diameter.
Discussion
Our findings demonstrated that CRP overexpression in bovine-derived KP not only significantly enhances biofilm formation but also confers complete resistance to co-trimoxazole (Figure 4C). To our knowledge, this study is the first to successfully construct a crp-overexpression model in a bovine isolate using both a constitutive promoter (Pkan) and an inducible promoter (Ptac). Molecular and phenotypic analyses systematically revealed the central role of crp gene in regulating biofilm architecture and antibiotic resistance. Quantitative assays clearly showed a highly significant increase in biofilm biomass in the OE strain compared to the WT strain (Figure 4C), directly confirming CRP’s crucial regulator role in the biofilm development of KP. Similarly, crp deletion mutants (ΔCRP) in E. coli was found to exhibit substantial biofilm formation defects, confirming CRP’s positive regulatory function in this process (). This aligns with its known function in K. pneumoniae, where the cAMP-CRP complex positively regulates the mrk operon, essential for type III fimbriae synthesis which facilitates surface attachment and biofilm maturation (Panjaitan et al., 2019). It must be note that the regulatory strength of CRP on biofilm formation in bovine-derived strains may differ from that in human clinical isolates (e.g., NTUH-K2044) due to host adaptive evolution, and further comparative genomics and transcriptomics are warranted to clarify this potential host specificity.
A key finding of this study is the significant transcriptional-translational decoupling in crp gene regulation warrants discussion. Although the inducible promoter Ptac drove higher transcriptional levels of the crp gene compared to the constitutive promoter Pkan (Figure 3A), immunoblotting analysis revealed that the CRP protein expression level was significantly higher in the Pkan group than in the Ptac group (Figure 3B). This discrepancy may stem from post-transcriptional bottlenecks under strong induction, such as translational inhibition, protein misfolding leading to degradation, or activation of stress-responsive proteases. This observation underscores the importance of validating phenotypic studies at the protein level and justified our functional analysis using the KAN (Pkan-driven) strain: it maintains high transcriptional levels while achieving stable and detectable protein expression, effectively avoiding non-specific stress interference associated from extreme induction. Additionally, CRP overexpression was not found to impose any observable metabolic burden on bacterial proliferative capacity. Growth kinetic analysis indicated no significant differences in the duration of the lag phase, specific growth rate, or maximum biomass yield between the OE and WT strains (Figure 4A), demonstrating that CRP-mediated resistance enhancement is not a side effect of growth inhibition but a direct result of activating its specific regulatory network. This feature supports the feasibility of intervention strategies targeting the crp gene.
Notably, we also observed that crp-overexpression resulted in a marked reversal of the resistance phenotype to cotrimoxazole (Figure 4C). We hypothesize that this resistance reversal likely results from CRP’s multifaceted regulatory mechanisms: it may directly or indirectly activate multidrug efflux pump genes such as acrAB-tolC (), enhancing the active efflux of sulfamethoxazole; concurrently, CRP-driven metabolic reprogramming may upregulate endogenous folate synthesis and uptake-related pathways (e.g., folA, folP) (), compensating for the competitive inhibition of dihydrofolate reductase by cotrimoxazole and ultimately remodeling the resistance phenotype. However, it is crucial to note that these mechanistic insights remain speculative within the scope of the present work. Our study primarily establishes the phenotypic link but does not include direct molecular validation. To conclusively elucidate the mechanism, future investigations are warranted. These should include: (i) constructing isogenic crp knockout mutants to confirm the necessity of CRP for both biofilm formation and cotrimoxazole resistance; (ii) quantifying the minimum inhibitory concentration (MIC) of cotrimoxazole to precisely define the resistance level; (iii) profiling the expression of efflux pump genes (e.g., acrAB) and folate pathway genes; and (iv) measuring intracellular sulfamethoxazole accumulation to directly assess efflux pump activity. Addressing these points will bridge the gap between phenotypic observation and molecular mechanism.
Conclusion
In conclusion, this study systematically investigated the role of the global regulator CRP in a bovine-derived K. pneumoniae isolate through a gain of function approach. We successfully constructed and validated CRP-overexpressing strains using both constitutive and inducible promoters, and comprehensively evaluated their phenotypes compared to the wild-type strain. Our principal findings are threefold: First, CRP functions as a key positive regulator of biofilm formation; Second, CRP overexpression remodels the antibiotic susceptibility to resistance specifically to cotrimoxazole and kanamycin, with the shift for cotrimoxazole being the most profound. Third, this CRP mediated phenotypic shift occurs without imposing a significant metabolic burden on bacterial growth, and we observed a notable decoupling between crp transcript levels and CRP protein abundance under strong induction. These results establish a direct link between CRP expression levels, biofilm architecture, and specific antibiotic resistance in a bovine pathogen. They suggest that targeting the CRP regulatory network could be a novel strategy to counteract biofilm-associated resistance. Future research should focus on elucidating the precise molecular mechanisms (such as identifying CRP’s direct transcriptional targets related to cotrimoxazole resistance) and comparing CRP’s regulon across hosts to understand its adaptive evolution.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary material, further inquiries can be directed to the corresponding author.
Author contributions
YZ: Writing – original draft. JQ: Writing – review & editing. LGu: Software, Writing – original draft, Investigation. SY: Data curation, Validation, Writing – original draft. YL: Validation, Data curation, Writing – original draft. KZ: Data curation, Validation, Writing – original draft. LGuo: Validation, Data curation, Writing – original draft. ZZ: Funding acquisition, Project administration, Writing – review & editing, Supervision.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This investigation was funded by the China Agriculture Research System, a joint venture of the Ministry of Finance and the Ministry of Agriculture and Rural Affairs (Beef Cattle/Yak, CARS-37), and the National Key Research and Development Program of China (2022YFD1601600).
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that Generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2026.1766955/full#supplementary-material
References
1
BalestrinoD.GhigoJ.-M.CharbonnelN.HaagensenJ. A.ForestierC. (2008). The characterization of functions involved in the establishment and maturation of klebsiella pneumoniae in vitro biofilm reveals dual roles for surface exopolysaccharides. Environ. Microbiol.10, 685–701. doi: 10.1111/j.1462-2920.2007.01491.x,
2
BiJ. D.DuY. (2020). Regulation of cAMP receptor protein on siderophores-related virulence genes [in Chinese]. West China Med. J.35, 995–998. doi: 10.7507/1002-0179.202006351
3
ChenL.WilkschJ. J.LiuH.ZhangX.TorresV. V. L.BiW.et al. (2020). Investigation of LuxS-mediated quorum sensing in klebsiella pneumoniae. J. Med. Microbiol.69, 402–413. doi: 10.1099/jmm.0.001148,
4
DengS. J.LuoY. Q. (1997). A diagnosis and treatment report of klebsiella pneumoniae disease in piglets[in Chinese]. J. South. Agric.6, 42–43.
5
Devanga RagupathiN. K.Muthuirulandi SethuvelD. P.Triplicane DwarakanathanH.MuruganD.UmashankarY.MonkP. N.et al. (2020). The influence of biofilms on carbapenem susceptibility and patient outcome in device associated K. pneumoniae infections: insights into phenotype vs genome-wide analysis and correlation. Front. Microbiol.11:591679. doi: 10.3389/fmicb.2020.591679,
6
Di DomenicoE. G.CavalloI.SivoriF.MarchesiF.PrignanoG.PimpinelliF.et al. (2020). Biofilm production by carbapenem-resistant Klebsiella pneumoniae significantly increases the risk of death in oncological patients. Front. Cell. Infect. Microbiol.10:561741. doi: 10.3389/fcimb.2020.561741,
7
FicE.BonarekP.GoreckiA.Kedracka-KrokS.MikolajczakJ.PolitA.et al. (2009). cAMP receptor protein from Escherichia coli as a model of signal transduction in proteins--a review. J. Mol. Microbiol. Biotechnol.17, 1–11. doi: 10.1159/000178014
8
HufnagelD. A.EvansM. L.GreeneS. E.PinknerJ. S.HultgrenS. J.ChapmanM. R. (2016). The catabolite repressor protein-cyclic AMP complex regulates csgD and biofilm formation in uropathogenic escherichia coli. J. Bacteriol.198, 3329–3334. doi: 10.1128/jb.00652-16,
9
LazărV.ChifiriucM. C. (2010). Medical significance and new therapeutical strategies for biofilm associated infections. Roum. Arch. Microbiol. Immunol.69, 125–138. doi: 10.1016/j.micres.2025.128386
10
LeiX.TanH. B. (2014). Construction the cAMP receptor protein gene deletion mutant and its role in the biofilm formation of Klebsiella pneumoniae [in Chinese]. Chin. J. Exp. Clin. Infect. Dis. (Electr. Ed.)8, 1–4.
11
LewisK. (2008). Multidrug tolerance of biofilms and persister cells. Curr. Top. Microbiol. Immunol.322, 107–131. doi: 10.1007/978-3-540-75418-3_6,
12
LinY.HanG.-SGuoJ.-H.HuangP.DaoL.-M.ShanW.-J.et al. (2015). Isolation, identification and drug resistance analysis of Klebsiella pneumonia from cattle upper respiratory tract [in Chinese]. Chinese J Veterinary Sci. 35, 1777–1781. doi: 10.16303/j.cnki.1005-4545.2015.11.10
13
LiuC.SunD.LiuJ.ChenY.ZhouX.RuY.et al. (2022). cAMP and c-di-GMP synergistically support biofilm maintenance through the direct interaction of their effectors. Nat. Commun.13:1493. doi: 10.1038/s41467-022-29240-5,
14
MaZ.RaoZ.ZhugeB.FangH.LiaoX.ZhugeJ. (2010). Construction of a novel expression system in klebsiella pneumoniae and its application for 1,3-propanediol production. Appl. Biochem. Biotechnol.162, 399–407. doi: 10.1007/s12010-009-8743-4,
15
MaZ.ShentuX.BianY.YuX. (2013). Effects of NADH availability on the klebsiella pneumoniae strain with 1,3-propanediol operon over-expression. J. Basic Microbiol.53, 348–354. doi: 10.1002/jobm.201100580,
16
NiemirowiczK.PiktelE.WilczewskaA. Z.MarkiewiczK. H.DurnaśB.WątekM.et al. (2016). Core-shell magnetic nanoparticles display synergistic antibacterial effects against pseudomonas aeruginosa and staphylococcus aureus when combined with cathelicidin LL-37 or selected ceragenins. Int. J. Nanomedicine11, 5443–5455. doi: 10.2147/IJN.S113706,
17
PanjaitanN. S. D.HorngY. T.ChengS. W.ChungW. T.SooP. C. (2019). EtcABC, a putative EII complex, regulates type 3 fimbriae via CRP-cAMP signaling in Klebsiella pneumoniae. Front. Microbiol.10. doi: 10.3389/fmicb.2019.01558
18
PengD.LiX.LiuP.ZhouX.LuoM.SuK.et al. (2018). Transcriptional regulation of galF by RcsAB affects capsular polysaccharide formation in klebsiella pneumoniae NTUH-K2044. Microbiol. Res.216, 70–78. doi: 10.1016/j.micres.2018.08.010,
19
RahdarH. A.MalekabadE. S.DadashiA.-R.TakeiE.KeikhaM.KazemianH.et al. (2019). Correlation between biofilm formation and carbapenem resistance among clinical isolates of klebsiella pneumoniae. Ethiop. J. Health Sci.29, 745–750. doi: 10.4314/ejhs.v29i6.11,
20
RuizC.LevyS. B. (2010). Many chromosomal genes modulate MarA-mediated multidrug resistance in Escherichia coli. Antimicrob. Agents Chemother.54, 2125–2134. doi: 10.1128/aac.01420-09,
21
SköldO. (2000). Sulfonamide resistance: mechanisms and trends. Drug Resist. Updat.3, 155–160. doi: 10.1054/drup.2000.0146,
22
TanJ. W. H.WilkschJ. J.HockingD. M.WangN.SrikhantaY. N.TauschekM.et al. (2015). Positive autoregulation of mrkHI by the cyclic di-GMP-dependent MrkH protein in the biofilm regulatory circuit of Klebsiella pneumoniae. J. Bacteriol.197, 1659–1667. doi: 10.1128/JB.02615-14,
23
TangH. (2023) Isolation and identification of Klebsiella pneumoniae of bovine origin and the effect of licorice Chalcone a on its virulence and drug resistance gene expression [in Chinese]. [master’s thesis]. Liaoning, China: Shenyang Agricultural University.
24
TangM.WeiX.WanX.DingZ.DingY.LiuJ. (2020). The role and relationship with efflux pump of biofilm formation in klebsiella pneumoniae. Microb. Pathog.147:104244. doi: 10.1016/j.micpath.2020.104244,
25
VuottoC.LongoF.PascoliniC.DonelliG.BaliceM. P.LiboriM. F.et al. (2017). Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J. Appl. Microbiol.123, 1003–1018. doi: 10.1111/jam.13533,
26
WangG.ZhaoG.ChaoX.XieL.WangH. (2020). The characteristic of virulence, biofilm and antibiotic resistance of Klebsiella pneumoniae. Int. J. Environ. Res. Public Health17:6278. doi: 10.3390/ijerph17176278,
27
YangS.Y.2014Study on regulation mechanism of kfuabc operon by crp in klebsiella pneumoniae [in Chinese]. [master’s thesis]. Chongqing, China: Chongqing Medical University.
Summary
Keywords
antibiotic resistance, biofilm formation, cAMP receptor protein, co-trimoxazole, Klebsiella pneumoniae
Citation
Zhang Y, Qi J, Gu L, Yi S, Liu Y, Zhang K, Guo L and Zuo Z (2026) Overexpression of the crp gene promotes biofilm formation and increases antibiotic resistance in bovine-derived Klebsiella pneumoniae. Front. Microbiol. 17:1766955. doi: 10.3389/fmicb.2026.1766955
Received
15 December 2025
Revised
10 January 2026
Accepted
12 January 2026
Published
26 January 2026
Volume
17 - 2026
Edited by
Robert Paul Hunter, One Medicine Consulting, United States
Reviewed by
Asmaa M. Salih Almohaidi, University of Baghdad, Iraq
Senthil Renganathan, Vels Institute of Science, Technology and Advanced Studies (VISTAS), India
Updates
Copyright
© 2026 Zhang, Qi, Gu, Yi, Liu, Zhang, Guo and Zuo.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Zhicai Zuo, czyhzzc@126.com
†These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.