Abstract
Background:
Osteoporosis (OP) is a chronic, systemic skeletal disorder characterized by progressive bone loss and microarchitectural deterioration, which increases fracture susceptibility and presents a challenging set of global healthcare problems. Current pharmacological interventions are limited by adverse effects, high costs, and insufficient long-term efficacy. Here, we identify snow crab shell-derived polypeptides (SCSP) as a potent osteoprotective agent.
Methods:
SCSP were extracted and characterized. Using an ovariectomized (OVX) mouse osteoporosis model, mice received daily oral SCSP (50, 100 mg/kg) or saline for 8 weeks. Bone microstructure (micro-CT), histomorphometry (H&E, Masson, TRAP), immunohistochemistry, and serum bone turnover markers were analyzed. In vitro, SCSP (100, 200 μg/ml) effects on osteogenic/adipogenic differentiation in MSCs/preosteoblasts were assessed via staining (ARS, ALP, Oil Red O) and molecular analyses (Western blot, qPCR, RNA-Seq).
Results:
SCSP, enriched in glutamic acid, aspartic acid, and lysine, significantly enhances bone mineral density, restores trabecular architecture, and preserves bone tissue integrity in an ovariectomy-induced OP mouse model without detectable systemic toxicity. At the molecular level, SCSP treatment induces the expression cell cycle regulators and motor protein pathways in osteoblasts while suppressing pro-inflammatory signaling networks, thereby re-establishing osteoblast-osteoclast balance and restoring calcium and phosphorus homeostasis. This combined mechanism promotes osteogenesis while simultaneously suppressing adipogenesis.
Conclusion:
Our findings position SCSP as a promising natural therapeutic for OP and provide key mechanistic insights that may guide future bone-targeted interventions.
Introduction
Osteoporosis (OP) is a systemic skeletal disorder characterized by decreased bone mass, deterioration of bone microarchitecture, and an increased risk of fragility fractures (; ). The global number of OP cases between 2030 and 2034 is estimated to increase to 263.2 million, exacerbating the global healthcare burden (). The prevalence of OP is significantly higher in females than in males, particularly among postmenopausal women, due to estrogen deficiency-induced bone resorption (). The pathophysiology of OP is primarily driven by an imbalance between bone resorption and bone formation, resulting from reduced osteoblast (OB) proliferation and differentiation (), excessive osteoclasts (OC) activation (), and dysregulated calcium metabolism (). Current pharmacological interventions for OP include anti-resorptive agents, such as bisphosphonates (), and denosumab, anabolic agents, such as parathyroid hormone analogs (), and supportive treatments like active vitamin D and calcium supplements (). Notwithstanding their clinical benefits, these therapies fail to address the underlying disease mechanisms and are often associated with significant adverse side effects, high costs, and limited long-term efficacy.
Crustacean shells are rich in polysaccharides, proteins, lipids, and minerals such as calcium, phosphorus, and magnesium, as well as compounds including astaxanthin and β-carotene. These components exhibit unique bioactive properties, biocompatibility, and low toxicity (; ; ; ). For example, chitin, a key polysaccharide, exhibits potent anti-inflammatory, antioxidant, antimicrobial, wound-healing (; ), and anti-tumor capabilities (). Similarly, lipids derived from crustacean shells have demonstrated anti-inflammatory and neuroprotetive properties (; ; ). Astaxanthin is recognized for its antioxidant, anti-inflammatory, and skin-protective and anti-skin carcinogenesis properties (; ), while β-Carotene contributes to antioxidant defense, vision support, and immune modulation (; ; ). Nevertheless, the bioactivity and therapeutic potential of crustacean shell-derived proteins remain largely unexplored. The process of calcium deposition in crustaceans is a highly regulated biomineralization process, and matrix proteins within the shell play critical roles in nucleation, stabilization, and orchestrated calcium deposition, thereby contributing to the mechanical strength of the exoskeleton (; ; ; ). To this end, we hypothesize that proteins derived from crustacean shells may play a pivotal role in regulating calcium homeostasis in bone tissue.
Here, we extract and characterize the enzymatically hydrolyzed peptides from snow crab shells, and demonstrate that these snow crab shell derived polypeptides (SCSP) exhibit potent anti-osteoporotic activity in a bilateral ovariectomy-induced osteoporosis mouse model. Mechanistically, SCSP enhances calcium deposition, promotes OB activity, and inhibits OC function. Based on chemical, biochemical, bioinformatics, and functional data detailed below, we propose SCSP as a promising natural candidate for improving bone health and provide new insights and therapeutic strategies for OP treatment.
Materials and methods
Reagents and antibodies
Antibody against RUNX-2 and COL-1 were purchased from Cell Signaling Technology. Antibodies against OSX, NFATc1, RANKL, and CTSK were purchased from Santa Cruz Biotechnology. Antibodies against BMP-2 was purchased from Servicebio (Table 1). Hematoxylin and Eosin (H&E) Staining Kit (C0105S) and BCIP/NBT Alkaline Phosphatase (ALP) Color Development Kit (C3206) were purchased from Beyotime. Masson’s trichrome staining solution (G1006) and tartrate-resistant acid phosphatase (TRAP) staining reagents (G1050) were purchased from Servicebio. Alizarin Red S (ARS) solution (G1452) was purchased from Solarbio, and Oil Red O staining solution (320-06-5) was purchased from Sigma-Aldrich.
TABLE 1
| Antibody | Catalog number | Dilution (WB) | Dilution (IHC) | Vendor |
|---|---|---|---|---|
| RUNX-2 | #12556 | 1:1000 | 1:100 | Cell Signaling Technology |
| OSX | sc-393325 | 1:1000 | — | Santa Cruz Biotechnology |
| NFATc1 | sc-7294 | 1:1000 | — | Santa Cruz Biotechnology |
| RANKL | sc-377079 | 1:1000 | — | Santa Cruz Biotechnology |
| CTSK | sc-48353 | 1:1000 | — | Santa Cruz Biotechnology |
| GAPDH | E-AB-48016 | 1:1000 | — | Santa Cruz Biotechnology |
| BMP-2 | GB11252 | — | 1:100 | Servicebio |
| COL-1 | #72026 | — | 1:100 | Cell Signaling Technology |
Antibodies used for Western blot (WB) and Immunohistochemistry (IHC).
Extraction and characterization of SCSP
Alaskan snow crab (Genus: Chionoecetes, Species: Opilio) caught wild in the United States. Fresh snow crab shells were cut into ∼1 cm pieces, crushed into fragments, washed, pH-adjusted to 10 with 0.2 mol/L KOH, and hydrolyzed at 70°C under constant stirring for 3 h. The hydrolysate was filtered, neutralized with acetic acid, hydrolyzed using papain for 4 h at 37°C, vacuum-concentrated, precipitated using ethanol, and vacuum-dried at 40°C. The molecular weights of SCSP were determined based on viscosity and retention time using a PL aquagel-OH Mixed-H Column (8 μm, 7.5 × 300 mm, Agilent) coupled with a Refractive Index Detector (Agilent) and Multi-Angle Laser Light Scattering Detector (Agilent) at 45°C. Amino acid composition was analyzed by hydrolyzing samples in 6M hydrochloric acid at 110°C for 22 h, followed by chromatography with Sulfonic Acid Cation Exchange Resin Columns (Agilent). Detections were performed at wavelengths of 570 nm and 440 nm.
Experimental animals
Five-week-old female C57BL/6 mice (20 ± 5 g) were purchased from Home-SPF Biotechnology Co., Ltd. (Beijing, China). Mice were housed in an SPF-grade facility at Qingdao University under controlled conditions (25°C ± 3°C, 60%–70% humidity, 12-h light/dark cycle). All animal procedures followed ethical guidelines approved by the Shandong Provincial Laboratory Animal Management Committee and the Experimental Animal Center of Qingdao University (QDU-AEC-2024418).
Ovariectomy (OVX) mice model
Mice were anesthetized, and the surgical area was shaved and sterilized with iodine. The skin, mucosa, and muscle layers were incised sequentially, and a dorsal incision was made approximately 2 cm lateral to the spine at the level of the last rib. Both ovaries were ligated at the oviduct and excised. A total of 24 female C57BL/6 mice were randomly assigned into 4 groups: Sham-operated (Sham), osteoporotic model (OVX), OVX+50 mg/kg SCSP treatment (Low-SCSP), and OVX+100 mg/kg SCSP treatment (High-SCSP). The SCSP treatment groups received SCSP via oral gavage daily, while the Sham and OVX groups received equivalent volumes of saline. All treatments were continued for 8 weeks before femur collection.
Micro-CT scanning
Femurs were fixed in 4% paraformaldehyde (PFA) and scanned using a Micro-CT System (Quantum GX2, PerkinElmer, Japan) at 90 kV and 200 μA. 100 layers at the proximal end of the tibial platform were selected for statistical analysis of cortical layer thickness, trabecular structure, and bone marrow cavity volume using Analyzer 12.0 Software (PerkinElmer). The volume of interest (VOI) was positioned at the proximal tibial metaphysis, starting precisely 0.5 mm distal to the growth plate to exclude the primary spongiosa and epiphyseal tissue. 100 layers = 1 mm: 100 layers × 10 μm = 1000 μm (1 mm).
Histological staining
Femurs were decalcified, embedded in paraffin, and sectioned for histological analysis. For H&E staining, sections were deparaffinized, stained with hematoxylin for 2 min and eosin for 10 s, washed with water, and imaged. For masson trichrome staining, sections were stained with Weigert’s iron hematoxylin for 10 min, sequential stained with acid ethanol, masson blue, aniline blue, and imaged. For TRAP staining, sections were incubated with TRAP solution at 37°C for 30 min in the dark, counterstained with hematoxylin, and imaged. All the histological staining were imaged with a light microscope (Ni-U, Nikon, USA).
Immunohistochemistry (IHC)
Decalcified bone sections were dewaxed, rehydrated, quenched, antigen-retrievaled, blocked with 5% BSA, incubated overnight at 4°C with primary antibodies, washed, incubated with secondary antibodies, counterstained with hematoxylin, and imaged with a light microscope (Nikon, USA).
Serum biochemical analysis
Urine was collected and centrifuged at 13,000 rpm for 5 min to obtain the supernatant. Blood was collected via orbital puncture and centrifuged at 3,000 rpm for 10 min. The concentrations of calcium (Ca2+) and inorganic phosphate (Pi) in serum and urine were measured using Calcium (Ca2+) colorimetric Assay Kit (E-BC-K103-M, Elabscience) and Phosphorus (Pi) Colorimetric Assay Kit (E-BC-K245-M, Elabscience) according to the manufacturer’s instructions. Absorbance were recorded at 610 nm (Ca2+) and 660 nm (Pi) using a microplate reader (SpectraMax iD3, Molecular Devices, USA).
Cell culture and differentiation
Bone marrow mesenchymal stem cells (MSCs) (CP-M131) was purchased from Pricella. MSCs were cultured in BC-T4 medium (04304P05, Baso) supplemented with 10% FBS (A5670701, Gibco). Murine MC3T3-E1 preosteoblasts were cultured in α-MEM media supplemented with 10% FBS. Cultures were passaged every 3-4 days by adding 0.25% trypsin (25300054, Gibco) for 5-10 min and re-plating at a 1:4 ratio. Osteogenic differentiation was induced with DMEM medium containing 10 mM β-glycerophosphate (HY-126304, MCE), 100 nM dexamethasone (HY-14648, MCE), and 50 μM L-ascorbic acid (HY-B0166 MCE) for 21 days (). Adipogenic differentiation was induced with DMEM containing 100 μg/mL 3-isobutyl-1-methylxanthine, 1 μM dexamethasone (HY-14648, MCE), and 50 μg/mL ascorbic acid for 12 days (). All cultures were maintained at 37 °C and 5% CO2. Cell experiments were divided into 4 groups: untreated group (Normal), differentiated group (Control), 100 μg/mL SCSP group (Low-SCSP) and 200 μg/mL SCSP group (High-SCSP).
Cell viability assay
5 × 103 cells per well were seeded in a 96-well plate and cultured in complete medium for 24 h. After SCSP treatment for 48 h, 10 μL of CCK-8 (Yeasen) solution was added to each well, and incubated for 2 h at 37°C in the dark. Absorbance was measured at 450 nm using a full-wavelength microplate reader (SpectraMax iD3, Molecular Devices, USA).
Cell staining analysis
Cells were fixed with 4% PFA for 20 min and washed, stained with 1% ARS solution, BCIP/NBT staining solution, or Oil Red O solution, incubated at room temperature in the dark for 30 min, washed, and imaged with a light microscope (Ni-U, Nikon, USA).
Western blot analysis
Cells or tissues were lysed with RIPA buffer containing protease and phosphatase inhibitors (E-BC-R327, Elabscience), homogenized, and incubated on ice for 10 min. The supernatant protein concentration was determined using a BCA assay. Protein lysate was resolved on SDS-PAGE gel and transferred onto a PVDF membrane (1620177, BIO-RED). Blots were blocked in 5% non-fat dry milk, incubated with primary antibody overnight at 4°C, washed, incubated with secondary antibody for 1 h at room temperature, washed, and developed with Super Excellent Chemiluminescent Substrate Detection Kit (E-IR-R308, Elabscience).
RNA isolation and qPCR
Total RNA was isolated using FreeZol Reagent (R711-01, Vazyme), precipitated, washed with 70% ethanol and dissolved in H2O. 1 μg of total RNA was reverse transcribed using random hexamers and Hiscript III Reverse Transcriptase (R302-01, Vazyme). 20 ng cDNA was used in each RT-qPCR reaction on a CFX96 instrument using Taq Pro Universal SYBR qPCR Master Mix (Q712-02, Vazyme). The primers used for qPCR were listed in Table 2.
TABLE 2
| Gene name | Forward primer (5'→3′) | Reverse primer (5'→3′) |
|---|---|---|
| Runx-2 | ATGCTTCATTCGCCTCACAAA | GCACTCACTGACTCGGTTGG |
| Bmp2 | GGGACCCGCTGTCTTCTAGT | TCAACTCAAATTCGCTGAGGAC |
| Opg | ACCCAGAAACTGGTCATCAGC | CTGCAATACACACACTCATCACT |
| Rankl | CAGCATCGCTCTGTTCCTGTA | CTGCGTTTTCATGGAGTCTCA |
| Gapdh | TCCCACTCTTCCACCTTCGATGC | GGGTCTGGGATGGAAATTGTGAGG |
Primer sequences used for qPCR analysis.
RNA sequencing (RNA-Seq) analysis
RNA libraries were prepared using the VAHTS® Universal V8 RNA-Seq Library Prep Kit (NRM605, Vazyme). Sequencing was performed on the MGI-SEQ 2000 platform. Reads were aligned to the mouse genome (GRCm38) using HISAT2, and differential expression analysis was conducted using DESeq2. GO and KEGG pathway enrichment analyses were performed using WebGestalt.
Statistical analysis
All the data conform to a normal distribution. Data were represented as means ± SEM. Statistical comparisons were performed using GraphPad Prism 9.5, employing one-way ANOVA, two-way ANOVA, or Student’s t-test. Significance was defined as P < 0.05.
Results
Characterization of SCSP
To characterize SCSP, we first quantified its yield following enzymatic hydrolysis. After 4 h of hydrolysis, SCSP yield reached 12.2% of the input snow crab shells, significantly higher than the chitin content (6.42%). Molecular weight distribution analysis revealed that the 5,000-10,000 Da fraction constituted the highest proportion (47.58%), followed by the 10,000-20,000 Da fraction (27.56%) (Table 3). These findings indicate that SCSP predominantly consists of low-to medium-molecular-weight peptides, a property potentially linked to its functional stability and biological activity. Amino acid composition analysis (Table 4) showed that glutamic acid (Glu) was the most abundant (5.91 g/100 g), followed by aspartic acid (Asp, 4.59 g/100 g) and lysine (Lys, 3.36 g/100 g). Essential amino acids (EAA) constituted 39.21% of the total, while non-essential amino acids (NEAA) accounted for 60.78%. The presence of both EAA and NEAA, particularly the enrichment in Glu, Asp, and Lys, suggests that SCSP may possess substantial bioactive benefits, such as promoting bone health.
TABLE 3
| Low Limit MW | High Limit MW | Percent MW |
|---|---|---|
| 5,000,000 | 2,73,380,792 | 0% |
| 200,000 | 300,000 | 0% |
| 100,000 | 200,000 | 0.94% |
| 50,000 | 100,000 | 3.58% |
| 30,000 | 50,000 | 6.7% |
| 20,000 | 30,000 | 9.42% |
| 10,000 | 20,000 | 27.56% |
| 5,000 | 10,000 | 47.58% |
| 4,795 | 5,000 | 4.21% |
The molecular weight distribution of SCSP.
TABLE 4
| Amino Acid | Content (g/100 g) |
|---|---|
| Glu | 5.91 |
| Asp | 4.59 |
| Lys | 3.36 |
| Leu | 3.19 |
| Val | 2.93 |
| Arg | 2.93 |
| Gly | 2.41 |
| Ala | 2.39 |
| IIe | 2.15 |
| Phe | 2.09 |
| Ser | 1.97 |
| Thr | 1.91 |
| Pro | 1.70 |
| Met | 1.51 |
| Tyr | 1.43 |
| His | 0.98 |
Amino acid composition of SCSP.
SCSP improves bone morphology and bone density in OVX mice
To investigate the therapeutic effects of SCSP on osteoporosis (OP), we utilized an ovariectomy (OVX)-induced osteoporosis mouse model (Figure 1A) and assessed bone morphology, bone mineral density (BMD), and trabecular parameters. Micro-CT scanning revealed significant trabecular degradation and reduced BMD in OVX mice compared to Sham controls, confirming osteoporotic bone loss. Treatment with SCSP at 50 mg/kg and 150 mg/kg markedly improved BMD and trabecular architecture, with the 150 mg/kg group showing bone parameters similar to those observed in the Sham group (Figure 1B). Quantitative analyses confirmed these findings, demonstrating that BMD, trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular separation (Tb.Sp) were significantly reduced in the OVX group compared to the Sham group, while SCSP group showed notably higher as for these parameters, highlighting the protective effects of SCSP on bone quality and morphology (Figure 1C).
FIGURE 1
Histological analysis using H&E and Masson’s staining further validated these structural improvements. Bone tissue integrity and collagen fiber distribution were severely disrupted in OVX mice, whereas SCSP administration preserved these features, particularly in the 150 mg/kg group (Figure 1D). Importantly, SCSP treatment did not induce histological abnormalities in major organs, including the heart, liver, spleen, lungs, and kidneys, across all experimental groups, as evidenced by H&E staining (Figure 1E).
These findings demonstrate that SCSP alleviates OVX-induced bone loss by improving BMD, restoring trabecular architecture, and preserving bone tissue integrity, without inducing systemic toxicity.
SCSP re-establishes the osteoblast/osteoclast balance in OVX mice
OP is characterized by an imbalance between osteoblast-mediated bone formation and osteoclast-driven bone resorption. To assess whether SCSP modulates this balance, we analyzed markers of osteoblast and osteoclast activity. IHC staining showed significantly reduced expression of osteoblast markers (BMP-2, RUNX-2, and COL-1) in OVX mice, reflecting impaired osteoblast function (Figure 2A). SCSP administration restored these markers in a dose-dependent manner, with the 150 mg/kg group achieving levels comparable to Sham controls. Western blot analysis further confirmed increased expression of RUNX-2 and OSX in SCSP-treated groups (Figure 2B). In contrast, TRAP staining demonstrated a significant increase in osteoclast numbers in OVX mice, indicative of enhanced bone resorption (Figure 2C). SCSP treatment significantly reduced osteoclast numbers, particularly at the 150 mg/kg dose, where levels were comparable to Sham controls. Western blot analysis revealed elevated expression of osteoclast-related proteins (NFATc1, RANKL, and CTSK) in OVX mice, which was markedly reduced by SCSP treatment (Figure 2D).
FIGURE 2
With these data in hand, we examined the effects of SCSP on calcium homeostasis, which is often disrupted in OP. As expected, OVX mice exhibited reduced urinary calcium excretion (0.18 ± 0.52 mmol/L) and elevated serum phosphorus levels (2.46 ± 0.26 mmol/L). SCSP treatment increased urinary calcium and phosphorus levels above both Sham and OVX groups (Table 5). Suggesting that SCSP modulates calcium and phosphorus metabolism, potentially counteracting the metabolic disruptions induced by ovariectomy.
TABLE 5
| Group | Blood Ca2+ (mmol/L) | Urine Ca2+ (mmol/L) | Blood Pi (mmol/L) | Urine Pi (mmol/L) |
|---|---|---|---|---|
| Sham | 2.20 0.16 | 1.22 0.18 | 1.60 .08 | 46.74 1.41 |
| OVX | 2.68 0.05 | 0.18 0.52 | 2.46 0.26 | 11.65 0.93 |
| Low-SCSP | 2.36 0.03 | 1.05 0.22 | 3.92 0.075 | 23.53 2.27 |
| High-SCSP | 2.60 0.13 | 2.75 0.31 | 4.76 0.57 | 49.53 1.03 |
Levels of serum calcium, urinary calcium, serum phosphorus and urinary phosphorus in mice ( ± S).
These results demonstrate that SCSP re-establishes the osteoblast/osteoclast balance by enhancing osteoblast activity, inhibiting osteoclast-driven bone resorption, and normalizing calcium and phosphorus metabolism.
SCSP promotes osteogenesis and inhibit adipogenesis
To further elucidate the effects of SCSP on bone regeneration, we examined its influence on osteoblast proliferation, differentiation, and mineralization using MC3T3-E1 preosteoblasts cells. CCK-8 assays revealed a dose-dependent increase in osteoblast viability with SCSP treatment (Figure 3A). ARS staining indicated enhanced mineralized nodule formation and calcium deposition in SCSP-treated groups, particularly at the high dose. ALP staining confirmed enhanced early osteogenic differentiation (Figure 3B). qPCR analysis demonstrated upregulation of osteogenic genes, including Runx-2, Bmp-2, and Opg, and downregulation of Rankl expression (Figure 3C). Western blot analysis corroborated these findings, showing increased protein levels of RUNX-2 and OSX and decreased expression of NFATc1, RANKL, and CTSK (Figure 3D), suggest the role of SCSP in maintaining osteoblast/osteoclast balance.
FIGURE 3
Similarly, MSCs, which can undergo both osteogenesis and adipogenesis exhibit enhanced osteogenic differentiation capacity in the presence of SCSP. ARS staining showed increased mineralized nodule formation in the SCSP-treated groups, indicating enhanced osteogenesis (Figure 4A). Western blot analysis confirmed these findings, with increased RUNX-2 and OSX expression and decreased NFATc1, RANKL, and CTSK levels in SCSP-treated groups (Figure 4B). In the contrast, SCSP treatment reduced lipid accumulation, suggesting an inhibitory effect on adipogenic differentiation (Figure 4C).
FIGURE 4
These findings highlight SCSP’s capacity to bias MSCs differentiation toward osteogenesis, promoting bone formation while inhibiting adipogenesis, and osteoclastgenesis.
SCSP modulate cell cycle prograssion, inflammatory response, and motor protein activity in osteoblasts
To obtain molecular insights into the observed above mentioned bias toward to osteogenesis, we performed RNA-Seq analysis on MC3T3-E1 differentiated osteoblast cells treated with and without 200 μg/mL of SCSP. A total of 2,410 genes were upregulated and 1,837 genes were downregulated in SCSP-treated cells compared to controls (Figure 5A). KEGG pathway enrichment analysis identified significant involvement of the Cell Cycle, inflammation, and Motor Proteins pathways (Figure 5B). Key genes involved in the Cell Cycle pathway included Ccnb1, Ttk, Ndc80, Ccnb2, Cdc20, Espl1, Plk1, and Cdc25. Among these, Plk1, Ccnb2, and Ccnb1 are closely associated with the FoxO signaling pathway, a key regulator of osteoblast survival, oxidative stress, and bone remodeling. SCSP treatment also modulated inflammatory responses, altering expression of IL-17 signaling, Toll-like receptor signaling, and rheumatoid arthritis-related genes, including Ccl2, Il17re, Fosl1, Mmp13, Ccl5, Tlr1, Il12b, and Atp6v1b1. Notably, SCSP significantly upregulated genes associated with Motor Protein activity, including Myo5c, Kif20a, Kif18b, Kif4, Kif23, Kif2c, Cenpe, Kif20b, Kif14, and Myh7b.
FIGURE 5
These findings suggest that SCSP enhances osteoblast activity via cell cycle regulation and immunomodulation, and simultaneously modulating cytoskeletal function through Motor Proteins.
Discussion
OP has emerged as a significant global public health issue, affecting millions worldwide (). Current therapeutic strategies offer only short-term symptom relief without addressing the underlying disease mechanisms (). In this study, we identify SCSP as a promising candidate for OP treatment, demonstrating its potential to effectively modulate the bone remodeling process by targeting key molecular pathways involved in osteoclastogenesis, as well as osteoblast differentiation and functions.
Our data reveal that SCSP has a molecular weight primarily within the range of 5,000-10,000 Da. Notably, smaller peptides, such as dipeptides, tripeptides, and oligopeptides, are more readily absorbed across the intestinal epithelium compared to larger proteins (), suggesting that SCSP may undergo enzymatic degradation within the gastrointestinal tract, facilitating its absorption. The ideal molecular weight range for optimal oral bioavailability in the context of OP treatment requires further investigation to enhance SCSP absorption. Strategies such as optimizing enzymatic hydrolysis conditions or utilizing alternative enzymes to reduce peptide size could improve bioavailability, thereby enhancing its therapeutic potential (; ; ). The amino acid composition of SCSP is also noteworthy. Amino acids are pivotal in mitigating age-related bone loss, enhancing bone mass, and promoting osteoblast proliferation and differentiation while concurrently suppressing osteoclast activity. Glu has been shown to be essential for osteoclast differentiation and function, as it supports the high energy demands of osteoclasts through its metabolic conversion to α-ketoglutarate, which feeds into the tricarboxylic acid cycle (). This metabolic pathway is vital for osteoclast activity. Moreover, studies have demonstrated that depriving culture media of Glu inhibits osteoclast differentiation, indicating its critical role in osteoclastogenesis and bone resorption (). Asp, as part of amino acid metabolism, may influence overall metabolic balance, indirectly impacting OP progression. Intriguingly, Lys, as a NEAA, promotes osteoblastogenesis by facilitating collagen crosslinking, an essential component of bone matrix formation (; ). Our chemical analysis data revealed that SCSP is abundant in Glu, Asp, and Lys, which may collectively contribute to significant bone preservation in OVX-OP models. Of interest, protein sequence and activity may vary among crustacean species. Therefore, further characterization of these crustacean shell peptides, including factors such as structure, charge, hydrophobicity, stability, binding affinity, and delivery mechanisms, is essential to achieve optimal therapeutic efficacy (; ; ).
We show that SCSP mitigates OP progression by restoring the osteoblast/osteoclast balance, which is disrupted due to estrogen deficiency in OVX mouse model, a central trigger for RANKL/OPG dysregulation. This imbalance results in: (i) increased osteoclast activity, as estrogen normally inhibits osteoclast formation and promotes osteoclast apoptosis; (ii) reduced osteoblast activity, as estrogen stimulates osteoblast differentiation and function; and (iii) a net bone loss due to a greater rate of bone resorption than bone formation. While current treatments predominantly focus on inhibiting bone resorption to reduce bone loss, anti-resorptive agents alone cannot restore lost bone structure. In contrast, SCSP treatment addresses both osteoclast inhibition and osteoblast stimulation, making it a promising strategy for promoting bone regeneration. SCSP treatment significantly reduces the RANKL/OPG ratio, suppresses osteoclastogenesis, and enhances osteoblastic differentiation and function, as evidenced by the upregulation of osteogenic markers (RUNX2, OSX) and downregulation of osteoclast markers (NFATc1, RANKL, CTSK) in MSC and osteoblast models.
Our transcriptome analyses show that SCSP modulates pathways associated with the cell cycle, inflammatory responses, and motor protein dynamics. Cell cycle dysregulation is a hallmark of impaired bone metabolism, with senescent MSCs exhibiting reduced osteogenic potential and increased adipogenesis (). Senescent osteocytes and osteoclasts also secrete senescence-associated secretory phenotype factors, including pro-inflammatory cytokines, chemokines, oxidative stress mediators, and proteases, which collectively disrupt bone homeostasis (; ; ). We find that SCSP treatment inhibits Plk1 expression, supporting the differentiation and function of bone-forming cells while preventing premature senescence (; ). In addition, SCSP modulates inflammatory cascades by attenuating IL-17 signaling (; ), Toll-like receptor pathways (; ), and key genes implicated in inflammatory bone diseases (), such as Ccl2, Il17re, Fosl1, Mmp13, Ccl5, Tlr1, Il12b, and Atp6v1b1. These anti-inflammatory effect likely contributes to the preservation of bone integrity in inflammatory OP contexts. Intriguingly, motor proteins, including myosin, dynein, and kinesin, are integral to intracellular transport (), mitosis (), and cytoskeletal dynamics in osteoblasts and osteoclasts (; ; ). SCSP’s influence on motor protein expression may enhance cellular trafficking and division, thereby supporting bone formation and remodeling processes.
Apart from the potent anti-osteoporotic effects, SCSP presents a favorable safety profile and cost-effective nature, which further strengthens its potential as a novel peptide-based therapeutic for OP. Thus, SCSP holds promise not only for the treatment of OP but also for broader applications in other skeletal diseases, providing a versatile therapeutic option for bone health management.
Statements
Data availability statement
The data generated in the present study can be found in the NCBI Sequence Read Archive database under accession number PRJNA1291493, or at the following URL: https://www.ncbi.nlm.nih.gov/sra/PRJNA1291493.
Ethics statement
Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used. The animal study was approved by Ethics Committee of Qingdao University Medical Science Center. The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
XD: Writing – original draft, Conceptualization, Funding acquisition, Data curation, Formal analysis. GZ: Data curation, Writing – original draft. CS: Writing – original draft, Formal analysis. HZ: Writing – original draft, Investigation. JZ: Writing – original draft, Investigation. XL: Investigation, Writing – original draft. XX: Writing – original draft, Methodology. JL: Writing – original draft, Data curation. XZ: Writing – original draft, Methodology. YZ: Writing – original draft, Resources. LL: Writing – original draft, Software. ST: Software, Writing – original draft. DW: Writing – original draft, Supervision. ZW: Supervision, Validation, Writing – review and editing, Funding acquisition, Visualization. BL: Writing – review and editing, Supervision, Visualization, Project administration, Validation.
Funding
The author(s) declare that financial support was received for the research and/or publication of this article. This work was funded by grants from National Natural Science Foundation of China (81871231 to BL; 32070859 to ZW; 32200653 to XX), Natural Science Foundation of Shandong Province (ZR2020MC083 to ZW; ZR202209280042 to BL; ZR2021MH350 to JL), Shandong Taishan Scholars Program of Shandong Province (TS20190931 to ZW; TSQN202103056 to BL), Qingdao Natural Science Foundation Key Project (24-8-4-zrjj-8-jch to BL), the Science, and Education and Industry Integration Innovation Pilot Project from Qilu University of Technology (Shandong Academy of Sciences) (2024ZDZX14 to DW), Science and Technology Program Development project of Qingdao city south district (2023-2-020-YY to JL) and The Youth Fund of Qingdao University Affiliated Hospital (QDFY + X2023126 to JL).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
AbehseraS.ZaccaiS.MittelmanB.GlazerL.WeilS.KhalailaI.et al (2018). CPAP3 proteins in the mineralized cuticle of a decapod crustacean. Sci. Rep.8, 2430. 10.1038/s41598-018-20835-x
2
AbraúlM.AlvesA.HilárioS.MeloT.CondeT.DominguesM. R.et al (2023). Evaluation of lipid extracts from the marine fungi Emericellopsis cladophorae and Zalerion maritima as a source of anti-inflammatory, antioxidant and antibacterial compounds. Mar. drugs21, 199. 10.3390/md21040199
3
AlswatK. A. (2017). Gender disparities in osteoporosis. J. Clin. Med. Res.9, 382–387. 10.14740/jocmr2970w
4
BeaulieuL.ThibodeauJ.BrylP.CarbonneauM. E. (2009). Characterization of enzymatic hydrolyzed snow crab (chionoecetes opilio) by-product fractions: a source of high-valued biomolecules. Bioresour. Technol.100, 3332–3342. 10.1016/j.biortech.2009.01.073
5
ByravanS.SamarasingheH.YuanJ. S. J.TahirS. H.MoorthyA.TahirH. (2024). From bench to bedside - is there a role of IL-17 drugs in rheumatoid arthritis?Expert Opin. investigational drugs33, 591–600. 10.1080/13543784.2024.2351505
6
CapozziA.ScambiaG.LelloS. (2020). Calcium, vitamin D, vitamin K2, and magnesium supplementation and skeletal health. Maturitas140, 55–63. 10.1016/j.maturitas.2020.05.020
7
CarrollK. A.SawdenM.SharmaS. (2025). DAMPs, PAMPs, NLRs, RIGs, CLRs and TLRs - understanding the alphabet soup in the context of bone biology. Curr. Osteoporos. Rep.23, 6. 10.1007/s11914-024-00900-3
8
CelestinoR.GamaJ. B.Castro-RodriguesA. F.BarbosaD. J.RochaH.d'AmicoE. A.et al (2022). JIP3 interacts with dynein and kinesin-1 to regulate bidirectional organelle transport. J. cell Biol.221, e202110057. 10.1083/jcb.202110057
9
ChenL.XiongL.GuoH.FengX.ZhuX.XiongW. C. (2024). Osteoclastic ATP6AP2 maintains β-catenin levels to prevent hyper-osteoclastic activation and trabecular bone-loss. J. bone mineral Res. official J. Am. Soc. Bone Mineral Res.39, 1821–1834. 10.1093/jbmr/zjae164
10
ChintongS.PhatvejW.Rerk-AmU.WaipribY.KlaypraditW. (2019). In vitro antioxidant, antityrosinase, and cytotoxic activities of astaxanthin from shrimp waste. Antioxidants Basel, Switz.8, 128. 10.3390/antiox8050128
11
ChoiE. M.KimG. H.LeeY. S. (2009). Atractylodes japonica root extract protects osteoblastic MC3T3-E1 cells against hydrogen peroxide-induced inhibition of osteoblastic differentiation. Phytotherapy Res. PTR23, 1537–1542. 10.1002/ptr.2813
12
CholidisP.KranasD.ChiraA.GalouniE. A.AdamantidiT.AnastasiadouC.et al (2024). Shrimp lipid bioactives with anti-inflammatory, antithrombotic, and antioxidant health-promoting properties for cardio-protection. Mar. drugs22, 554. 10.3390/md22120554
13
ChotphruethipongL.ChanvorachoteP.ReudhabibadhR.SinghA.BenjakulS.RoytrakulS.et al (2023). Chitooligosaccharide from Pacific white shrimp shell chitosan ameliorates inflammation and oxidative stress via NF-κB, Erk1/2, akt and Nrf2/HO-1 pathways in LPS-induced RAW264.7 macrophage cells. Foods Basel, Switz.12, 2740. 10.3390/foods12142740
14
CollisonJ. (2017). Bone: targeting old cells to protect old bones. Nat. Rev. Rheumatol.13, 632. 10.1038/nrrheum.2017.152
15
CrespoM. O.MartínezM. V.HernándezJ. L.Lage YustyM. A. (2006). High-performance liquid chromatographic determination of chitin in the snow crab, chionoecetes opilio. J. Chromatogr. A1116, 189–192. 10.1016/j.chroma.2006.03.068
16
FarrJ. N.XuM.WeivodaM. M.MonroeD. G.FraserD. G.OnkenJ. L.et al (2017). Targeting cellular senescence prevents age-related bone loss in mice. Nat. Med.23, 1072–1079. 10.1038/nm.4385
17
GoldbergaI.LiR.DuerM. J. (2018). Collagen structure-function relationships from solid-state NMR spectroscopy. Accounts Chem. Res.51, 1621–1629. 10.1021/acs.accounts.8b00092
18
HeX.WangH.JinT.XuY.MeiL.YangJ. (2016). TLR4 activation promotes bone marrow MSC proliferation and osteogenic differentiation via Wnt3a and Wnt5a signaling. PloS one11, e0149876. 10.1371/journal.pone.0149876
19
HuangT.FuX.WangN.YangM.ZhangM.WangB.et al (2021). Andrographolide prevents bone loss via targeting estrogen-related receptor-α-regulated metabolic adaption of osteoclastogenesis. Br. J. Pharmacol.178, 4352–4367. 10.1111/bph.15614
20
IndoY.TakeshitaS.IshiiK. A.HoshiiT.AburataniH.HiraoA.et al (2013). Metabolic regulation of osteoclast differentiation and function. J. bone mineral Res. official J. Am. Soc. Bone Mineral Res.28, 2392–2399. 10.1002/jbmr.1976
21
JenningsA.MacGregorA.SpectorT.CassidyA. (2016). Amino acid intakes are associated with bone mineral density and prevalence of low bone mass in women: evidence from discordant monozygotic twins. J. bone mineral Res. official J. Am. Soc. Bone Mineral Res.31, 326–335. 10.1002/jbmr.2703
22
JiangY.YeJ.HuY.ZhangJ.LiW.ZhouX.et al (2024). Extraction and synthesis of typical carotenoids: Lycopene, β-Carotene, and astaxanthin. Mol. Basel, Switz.29, 4549. 10.3390/molecules29194549
23
KannanA.HettiarachchyN. S.MarshallM.RaghavanS.KristinssonH. (2011). Shrimp shell peptide hydrolysates inhibit human cancer cell proliferation. J. Sci. food Agric.91, 1920–1924. 10.1002/jsfa.4464
24
KhoslaS.FarrJ. N.KirklandJ. L. (2018). Inhibiting cellular senescence: a new therapeutic paradigm for age-related osteoporosis. J. Clin. Endocrinol. metabolism103, 1282–1290. 10.1210/jc.2017-02694
25
KuźnikA.Październiok-HolewaA.JewulaP.KuźnikN. (2020). Bisphosphonates-much more than only drugs for bone diseases. Eur. J. Pharmacol.866, 172773. 10.1016/j.ejphar.2019.172773
26
LederB. Z. (2017). Parathyroid hormone and parathyroid hormone-related protein analogs in osteoporosis therapy. Curr. Osteoporos. Rep.15, 110–119. 10.1007/s11914-017-0353-4
27
literature review of pathologymechanismHalderS. K.DasA.PaulT.Das MohapatraP. K.PatiB. R. (2014). Appraisal of antioxidant, anti-hemolytic and DNA shielding potentialities of chitosaccharides produced innovatively from shrimp shell by sequential treatment with immobilized enzymes. Food Chem.158, 325–334. 10.1016/j.foodchem.2014.02.115
28
LiuG.LiX.YangF.QiJ.ShangL.ZhangH.et al (2023). C-Phycocyanin ameliorates the senescence of mesenchymal stem cells through ZDHHC5-Mediated autophagy via PI3K/AKT/mTOR pathway. Aging Dis.14, 1425–1440. 10.14336/ad.2023.0121
29
LoH. J.TsaiC. H.HuangT. W. (2024). Apoptosis-associated genetic mechanisms in the transition from rheumatoid arthritis to osteoporosis: a bioinformatics and functional analysis approach. Apl. Bioeng.8, 046107. 10.1063/5.0233961
30
MaC.YuR.LiJ.ChaoJ.LiuP. (2023a). Targeting proteostasis network in osteoporosis: pathological mechanisms and therapeutic implications. Ageing Res. Rev.90, 102024. 10.1016/j.arr.2023.102024
31
MaM.ZengH.YangP.XuJ.ZhangX.HeW. (2023b). Drug delivery and therapy strategies for osteoporosis intervention. Mol. Basel, Switz.28, 6652. 10.3390/molecules28186652
32
MikhajlovO.AdarR. M.Tătulea-CodreanM.MacéA. S.ManziJ.TabarinF.et al (2025). Cell adhesion and spreading on fluid membranes through microtubules-dependent mechanotransduction. Nat. Commun.16, 1201. 10.1038/s41467-025-56343-6
33
NagasawaH. (2011). Structure and function of matrix proteins and peptides in the biomineral formation in crustaceans. Prog. Mol. Subcell. Biol.52, 315–329. 10.1007/978-3-642-21230-7_11
34
NagasawaH. (2012). The crustacean cuticle: structure, composition and mineralization. Front. Biosci. Elite Ed.4, 711–720. 10.2741/412
35
NairA.AhirwarA.SinghS.LodhiR.LodhiA.RaiA.et al (2023). Astaxanthin as a king of ketocarotenoids: structure, synthesis, accumulation, bioavailability and antioxidant properties. Mar. drugs21, 176. 10.3390/md21030176
36
NikooM.BenjakulS.Ahmadi GavlighiH. (2022). Protein hydrolysates derived from aquaculture and marine byproducts through autolytic hydrolysis. Compr. Rev. food Sci. food Saf.21, 4872–4899. 10.1111/1541-4337.13060
37
NikooM.RegensteinJ. M.YasemiM. (2023). Protein hydrolysates from fishery processing by-products: production, characteristics, food applications, and challenges. Foods Basel, Switz.12, 4470. 10.3390/foods12244470
38
PaccouJ.PenelG.ChauveauC.CortetB.HardouinP. (2019). Marrow adiposity and bone: review of clinical implications. Bone118, 8–15. 10.1016/j.bone.2018.02.008
39
PanJ. X.XiongL.ZhaoK.ZengP.WangB.TangF. L.et al (2018). YAP promotes osteogenesis and suppresses adipogenic differentiation by regulating β-catenin signaling. Bone Res.6, 18. 10.1038/s41413-018-0018-7
40
PengR.DongY.ZhengM.KangH.WangP.ZhuM.et al (2024). IL-17 promotes osteoclast-induced bone loss by regulating glutamine-dependent energy metabolism. Cell death and Dis.15, 111. 10.1038/s41419-024-06475-2
41
PengY.LiuY.ZhengR.YeY.FuY.YinL.et al (2023). PLK1 maintains DNA methylation and cell viability by regulating phosphorylation-dependent UHRF1 protein stability. Cell death Discov.9, 367. 10.1038/s41420-023-01667-9
42
QiuN.XiaoZ.CaoL.BuechelM. M.DavidV.RoanE.et al (2012). Disruption of Kif3a in osteoblasts results in defective bone formation and osteopenia. J. cell Sci.125, 1945–1957. 10.1242/jcs.095893
43
RammuniM. N.AriyadasaT. U.NimarshanaP. H. V.AttalageR. A. (2019). Comparative assessment on the extraction of carotenoids from microalgal sources: astaxanthin from H. pluvialis and β-carotene from D. salina. Food Chem.277, 128–134. 10.1016/j.foodchem.2018.10.066
44
RaoA. R.SindhujaH. N.DharmeshS. M.SankarK. U.SaradaR.RavishankarG. A. (2013). Effective inhibition of skin cancer, tyrosinase, and antioxidative properties by astaxanthin and astaxanthin esters from the green alga Haematococcus pluvialis. J. Agric. food Chem.61, 3842–3851. 10.1021/jf304609j
45
SaiwongS.AutsavaprompornN.SiriwoharnT.TechapunC.WangtueaiS. (2023). Enzymatic hydrolysis optimization for preparation of sea cucumber (Holothuria scabra) hydrolysate with an antiproliferative effect on the HepG2 liver cancer cell line and antioxidant properties. Int. J. Mol. Sci.24, 9491. 10.3390/ijms24119491
46
SantosS.TorcatoI.CastanhoM. A. (2012). Biomedical applications of dipeptides and tripeptides. Biopolymers98, 288–293. 10.1002/bip.22067
47
Santos-LedoA.Garcia-MaciaM.CampbellP. D.GronskaM.MarlowF. L. (2017). Kinesin-1 promotes chondrocyte maintenance during skeletal morphogenesis. PLoS Genet.13, e1006918. 10.1371/journal.pgen.1006918
48
ShakedS. A.AbehseraS.ZieglerA.BentovS.ManorR.WeilS.et al (2024). A transporter that allows phosphate ions to control the polymorph of exoskeletal calcium carbonate biomineralization. Acta biomater.178, 221–232. 10.1016/j.actbio.2024.02.035
49
SharayeiP.AzarpazhoohE.ZomorodiS.EinafsharS.RamaswamyH. S. (2021). Optimization of ultrasonic-assisted extraction of astaxanthin from green tiger (Penaeus semisulcatus) shrimp shell. Ultrason. sonochemistry76, 105666. 10.1016/j.ultsonch.2021.105666
50
SütterlinC.FengY.FerrisD. K.EriksonR. L.MalhotraV. (2001). Polo-like kinase is required for the fragmentation of pericentriolar golgi stacks during mitosis. Proc. Natl. Acad. Sci. U. S. A.98, 9128–9132. 10.1073/pnas.161283998
51
TaksimaT.ChonpathompikunlertP.SroyrayaM.HutamekalinP.LimpawattanaM.KlaypraditW. (2019). Effects of astaxanthin from shrimp shell on oxidative stress and behavior in animal model of alzheimer's disease. Mar. drugs17, 628. 10.3390/md17110628
52
TangN.GaoL.SongJ.LiY.SongM.QiuC.et al (2024). Risk analysis for subsequent fracture of osteoporotic fractures in Chinese women over age 60: a nationwide cross-sectional study. Sci. Rep.14, 13319. 10.1038/s41598-024-64170-w
53
TsouprasA.CholidisP.KranasD.GalouniE. A.OfrydopoulouA.EfthymiopoulosP.et al (2024). Anti-inflammatory, antithrombotic, and antioxidant properties of amphiphilic lipid bioactives from shrimp. Pharm. Basel, Switz.18, 25. 10.3390/ph18010025
54
ValeR. D. (2003). The molecular motor toolbox for intracellular transport. Cell112, 467–480. 10.1016/s0092-8674(03)00111-9
55
Vilasoa-MartínezM.Calaza-RamosC.López-HernándezJ.Lage-YustyM. A.LosadaP. P.Rodríguez-Bernaldo de QuirósA. (2008). Determination of vitamin E and carotenoid pigments by high performance liquid chromatography in shell of chionoecetes opilio. Anal. Chim. acta617, 225–229. 10.1016/j.aca.2008.03.001
56
WangR.ZhangJ.RenH.QiS.XieL.XieH.et al (2024). Dysregulated palmitic acid metabolism promotes the formation of renal calcium-oxalate stones through ferroptosis induced by polyunsaturated fatty acids/phosphatidic acid. Cell. Mol. life Sci. CMLS81, 85. 10.1007/s00018-024-05145-y
57
YounesI.HajjiS.FrachetV.RinaudoM.JellouliK.NasriM. (2014). Chitin extraction from shrimp shell using enzymatic treatment. Antitumor, antioxidant and antimicrobial activities of chitosan. Int. J. Biol. Macromol.69, 489–498. 10.1016/j.ijbiomac.2014.06.013
58
ZengQ.XuY.JeppesenE.GuX.MaoZ.ChenH. (2021). Farming practices affect the amino acid profiles of the aquaculture Chinese mitten crab. PeerJ9, e11605. 10.7717/peerj.11605
59
ZhangL.ZhengY. L.WangR.WangX. Q.ZhangH. (2022). Exercise for osteoporosis: a literature review of pathology and mechanism. Front. Immunol.13, 1005665. 10.3389/fimmu.2022.1005665
60
ZhuZ.YuP.WuY.WuY.TanZ.LingJ.et al (2023). Sex specific global burden of osteoporosis in 204 countries and territories, from 1990 to 2030: an age-period-cohort modeling study. J. Nutr. health and aging27, 767–774. 10.1007/s12603-023-1971-4
Summary
Keywords
crab shell polypeptides, osteoporosis, calcium dynamics, osteogenic activity, OP treatment
Citation
Dong X, Zhang G, Sun C, Zhang H, Zhen J, Li X, Xu X, Liu J, Zhao X, Zhang Y, Liu L, Tian S, Wang D, Wang Z and Li B (2025) Crab shell polypeptides enhance calcium dynamics and osteogenic activity in osteoporosis. Front. Pharmacol. 16:1605422. doi: 10.3389/fphar.2025.1605422
Received
03 April 2025
Accepted
09 July 2025
Published
25 August 2025
Volume
16 - 2025
Edited by
Yufeng Zhang, Tianjin Medical University, China
Reviewed by
Gaetano De Siena, University of Florence Viale Pieraccini, Italy
Shyamsundar Pal China, University of California, San Diego, United States
Updates
Copyright
© 2025 Dong, Zhang, Sun, Zhang, Zhen, Li, Xu, Liu, Zhao, Zhang, Liu, Tian, Wang, Wang and Li.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Zheng Wang, zheng.wang@qdu.edu.cn; Bing Li, libing_516@qdu.edu.cn
ORCID: Zheng Wang, orcid.org/0000-0003-4471-5983
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.