Abstract
Aims:
Depression is a leading cause of disability worldwide, with current treatments often limited by efficacy and side effects. Artemisinin (ART), a natural compound with known anti-inflammatory and neuroprotective properties, has not been extensively studied for its potential antidepressant effects. This study aimed to elucidate the neuroprotective mechanisms of artemisinin against corticosterone (CORT)-induced toxicity in PC12 cells model, and to assess its antidepressant-like behavioral effects in a chronic unpredictable mild stress (CUMS) mouse model.
Methods:
In vitro, PC12 cells and primary hippocampal neurons were treated with CORT and artemisinin to assess cell viability, oxidative stress, mitochondrial function, and apoptosis. Pharmacological inhibition and CRISPR/Cas9 gene editing were used to explore the roles of AKT and ERK signaling pathways. In vivo, CUMS-induced depression-like behaviors in mice were evaluated using sucrose preference, tail suspension, and forced swim tests. Western blotting and immunohistochemistry studies were performed to analyze molecular mechanisms.
Results:
Artemisinin attenuated CORT-induced cytotoxicity, oxidative stress, mitochondrial dysfunction, and apoptosis in PC12 cells and hippocampal neurons. These effects were mediated through the activation of AKT and ERK pathways. In CUMS mice, artemisinin improved depression-like behaviors, upregulated the AKT/GSK/NRF2/HO1 and BDNF/TrkB/ERK/CREB pathways, modulated astrocyte activity, and promoted neurogenesis in the hippocampus.
Conclusion:
Artemisinin exerts significant neuroprotective and antidepressant-like effects through multiple molecular and cellular mechanisms, highlighting its potential as a novel therapeutic agent for depression.
1 Introduction
Depression is a major mental disorder, often associated with significant symptom severity such as cognitive deficits, persistent negative mood, and physiological impairments (; ; ; ). These symptoms can severely limit patients’ ability to carry out major life activities. Moreover, according to the World Health Organization (WHO), major depression can lead to more than 700,000 suicides per year globally. As of 2017, over 300 million people around the world suffered from depression (), and it is predicted that by 2030, major depressive disorder will become the leading cause of disability worldwide (). Previous research has evidenced an increasing trend in the incidence of depression (; ). Currently, antidepressant medication is a primary treatment modality for depression. Various types of antidepressants, including monoamine oxidase inhibitors (MAOIs), tricyclic antidepressants (TCAs), and selective serotonin reuptake inhibitors (SSRIs), are available for clinical treatment. While newer agents such as SSRIs demonstrate improved safety profiles compared to older TCAs, it is crucial to acknowledge that all pharmacological agents carry inherent risks of adverse effects, common side effects associated with antidepressants include gastrointestinal disturbances, sexual dysfunction, and withdrawal symptoms (; ; ; ). Furthermore, approximately 30% of major depressive disorder patients fail to respond adequately to existing antidepressant therapies (). These limitations, suboptimal efficacy and the unavoidable potential for adverse reactions, collectively underscore the pressing need to develop novel, effective, and safer antidepressants.
Artemisinin (ART), extracted from the plant Artemisia annua, has been used as a remedy by traditional herbal medicine practitioners in China for over 2000 years (). Since the late 1990s, artemisinin compounds have served as frontline antimalarial drugs (). Due to its ability to pass the blood-brain barrier (BBB) and its low side effect profile in clinical use, artemisinin presents favorable advantages for treating other diseases. Beyond its antimalarial effects, artemisinin exhibits a wide range of pharmacological properties, including antiviral, anti-inflammatory, antioxidant, and antitumor activities (; ; ; ; Zhou et al., 2025). Importantly, accumulating evidence indicates that artemisinin could also be a drug candidate for treating neurodegenerative diseases such as Alzheimer’s disease (AD) and Parkinson’s disease (PD). For instance, in vivo and in vitro experiments have shown that artemisinin has protective effects on Alzheimer’s disease pathology by activating the ERK pathway (; Zhao X. et al., 2020) or suppressing inflammasome activation (). Artemisinin also shows protective effects in 1-methyl-4-phenylpyridinium (MPP+)-induced cellular models of Parkinson’s disease (). Additionally, it can protect various neuronal cells from oxidative stress damage (; ; Zhao et al., 2019a; Zheng et al., 2016). Critically, recent studies specifically support its antidepressant potential: Artesunate (an artemisinin derivative) prevented H2O2-induced oxidative damage in PC12 cells and attenuated LPS-triggered depression-like behaviors in mice via suppressing neuroinflammation and oxidative stress (). Specifically, a novel dihydroartemisinin (an artemisinin derivative)-GABA conjugate (5b) demonstrated potent protective effects against corticosterone-induced impairments in PC12 cells (a model relevant to depression) (). Given these facts, artemisinin and its derivatives are potential candidates for antidepressant drugs. However, there is little report on the protective effects of artemisinin itself on animal and cell models of depression.
Despite the high prevalence of depression, its underlying mechanisms remain unclear. There is no single cause of the pathogenesis of depression; environmental stress, brain biochemical alterations, and genetic vulnerability all contribute (). Studies have suggested that excessive stress plays an important role in the development of major depressive episodes (; ). Stressful events activate the hypothalamic-pituitary-adrenal (HPA) axis, leading to hyperactivity and the generation of excessive concentrations of circulating glucocorticoids. Increasing evidence indicates that the hippocampus is sensitive to glucocorticoids, exhibiting both structural and functional changes (; ; ). Clinical studies also show that the hippocampal volume of patients with depression is smaller than that of healthy individuals (; ; ).
Although glucocorticoids help the body deal with stress, the abundance of glucocorticoid receptors in hippocampal tissue means that high levels of corticosterone (a type of glucocorticoid) can cause damage to nerve cells and hippocampal dysfunction, eventually inducing depression-like behaviors in mice. PC12 cells, derived from a pheochromocytoma of the rat adrenal medulla, possess typical features of brain neurons and contain abundant glucocorticoid receptors. Thus, corticosterone (CORT)-induced damage to PC12 cells has been widely used as a tool for in vitro anti-depression pharmacological research (; ).
Given that socio-environmental chronic stressors are involved in the development of depression, the chronic unpredictable mild stress (CUMS) model is extensively used in vivo to elucidate the biological mechanisms of depression and screen antidepressant drugs. This model can elicit depression-like symptoms such as anhedonia, as evidenced by decreased sucrose preference, and these abnormalities can be reversed by antidepressant administration. Accordingly, the PC12 cellular model combined with the CUMS animal model was applied to assess the potential antidepressant effects of artemisinin in this study.
The aim of the present study was to examine antidepressant-like activity of artemisinin, by means of corticosterone-induced PC12 cell model and CUMS mice model, as well as its underlying mechanism. These findings could suggest that artemisinin holds promise as a potential drug for the prevention and treatment of depression.
2 Materials and methods
2.1 Materials
Analytical-grade artemisinin, CORT, and Fluoxetine were obtained from Meilunbio (Dalian, China). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), and 0.25% trypsin were from GIBCO (USA). DMSO and penicillin/streptomycin were sourced from Sigma-Aldrich (USA). Poly-D-lysine, MTT, Lipofectamine 3000, and BCA Protein Assay Kit were from Thermo Fisher Scientific (USA). Annexin V: FITC Apoptosis Detection Kit was from BD Biosciences (USA). SDS-PAGE gels (4%–20%) were purchased from Genscript Biology (China). Primary antibodies for GAPDH, phospho-AKT1, phospho-ERK1/2, phospho-CREB, phospho-TrkB, phospho-GSK3β, NeuN, and HRP-conjugated secondary antibodies were from CST (USA). BDNF antibody was from Abcam (UK), while GFAP, NRF2, and HO1 antibodies were from Signalway Antibody (USA). MEK inhibitor PD98059 and PI3K inhibitor LY294002 were from Calbiochem (USA). Lactate dehydrogenase (LDH) cytotoxicity, mitochondrial membrane potential (MMP, △ψm; JC-1) and reactive oxygen species (ROS) detection kits were from Beyotime Biotechnology (China).
2.2 Cell culture and treatment
PC12 cells were provided by Dr. Gordon Guroff (NIH, USA) and cultured in DMEM with 10% FBS and penicillin/streptomycin at 37 °C in 5% CO2. Cells were sub-cultured 2–3 times per week at a 1:5 split. Primary neurons were obtained from one-day-old C57BL/6 mice as per Zhao and colleagues (Zhao et al., 2019b). Artemisinin and CORT were dissolved in DMSO (≤0.1% final concentration). Experimental groups included: (1) Control: serum-free medium, (2) CORT group: 200 μM CORT, and (3) CORT + Artemisinin: 200 μM CORT with 3.125–100 μM artemisinin for 48 h.
2.3 MTT assay
Cell viability was assessed using the MTT assay. Cells (6–8 × 103/well) were treated with artemisinin and CORT for 48 h, followed by incubation with 0.5 mg/mL MTT for 3–4 h. Formazan crystals were dissolved in 150 μL DMSO, and absorbance was measured at 490 nm using an Infinite M200 PRO microplate reader (Tecan, Switzerland). Cell viability was expressed as a percentage of control.
2.4 LDH cytotoxicity assay
LDH release was measured using a commercial kit (Beyotime). Cells (6–8 × 103/well) were treated as described, and fluorescence intensity was measured at 560/590 nm using an Infinite M200 PRO microplate reader. LDH release was normalized to the control group.
2.5 ROS detection
ROS levels were detected using DCFH-DA (Beyotime). Cells were incubated with 10 μM DCFH-DA in DMEM at 37 °C for 30 min, washed, and fluorescence was observed using an EVOS FL Imaging System. ROS levels were semi-quantified using ImageJ.
2.6 Mitochondrial membrane potential (MMP) assay
MMP (∆ψm) was assessed using the JC-1 kit (Beyotime). Cells (1 × 104 cells/cm2) were treated for 48 h, stained with JC-1 (10 μg/mL) at 37 °C for 20 min, washed, and fluorescence was analyzed using a fluorescence microscope. The red/green fluorescence ratio was normalized to the control group.
2.7 Apoptosis assay
Apoptosis was measured using an Annexin V-FITC/PI apoptosis detection kit (BD Biosciences, San Diego, CA, USA) according to the manufacturer’s instructions. Cells were treated for 48 h, then 1 × 105 cells were collected and stained with Annexin V-FITC and PI. Based on the assay principle, intact cells were double-negative for Annexin V and PI; early apoptotic cells were identified as Annexin V-positive/PI-negative, while late apoptotic or necrotic cells were positive for both Annexin V and PI. To quantify the apoptotic cells, CellQuest™ Pro Software (BD Biosciences, San Diego, CA) was utilized, and the apoptosis rate was determined as the percentage of cells positive for Annexin V.
2.8 CRISPR/Cas9 gene editing
The gene editing was carried out as previously described (). Rat AKT1 was targeted using sgRNA sequences rAKT1-gRNA-F1: CACCGAGGTGCCATCATTCTTGAGG and rAKT1-gRNA-R1: AAACCCTCAAGAATGATGGCACCTC. The sgRNA was cloned into PX459 V2.0 and transfected into PC12 cells using lipofectamine 3000. Cells were screened with puromycin, and AKT1 expression was verified by Western blot.
2.9 Western blot analysis
Protein lysates were prepared from the mouse hippocampus or PC12 cells using RIPA buffer with protease and phosphatase inhibitors. Protein concentrations were determined using the BCA assay. Samples (20 μg) were separated via 4%–20% SDS-PAGE, transferred to PVDF membranes, blocked with 5% BSA, and incubated overnight with primary antibodies (1:500–2000) at 4 °C. Membranes were incubated with HRP-conjugated secondary antibodies (1:4000) for 2 h, and bands were detected using ECL. Protein expression was normalized to GAPDH. The intensity of the bands was semi-quantified by using ImageJ software.
2.10 Animal studies and drug administration
Male C57BL/6 mice (n = 48, 6–8 weeks, 18–21 g) were housed under standard conditions (25 °C, 12 h light/dark cycle) with food and water ad libitum. All procedures followed the University of Macau Animal Ethics Committee guidelines. Mice were divided into six groups: Control, CUMS, artemisinin (0.3, 1 and 3 mg/kg), and fluoxetine (10 mg/kg) which is a selective serotonin reuptake inhibitor (SSRI) and well-established antidepressant used as a positive control in this study (; ). Drugs were administered via intraperitoneal injection 30 min after stress daily for 4 weeks. Mice were sacrificed post-behavioral tests.
2.11 Chronic unpredictable mild stress (CUMS) protocol
The CUMS procedures were performed according to previous reports (; Zhao Y.-N. et al., 2020; Zhu et al., 2020), with some modifications. CUMS was applied for 5 weeks with random exposure to stressors, with each stressors applied 3–4 times per week: (1) overnight flash illumination, (2) 8-h ultrasonic noise, (3) 12-h wet bedding, (4) 12-h water deprivation, (5) 24-h food deprivation, (6) 4-h cage tilt, (7) 1-min tail nip, (8) 5-min cold swim (4 °C), (9) 2-h physical restraint, (10) 8-h exposure to a pungent odor, (11) overnight light exposure. After 5 weeks of CUMS exposure, mice were subjected to different behavioral tests such as sucrose preference test (SPT), Tail suspension test (TST) and forced swim test (FST).
2.12 Behavioral tests
SPT: The test was carried out based on previously established methods, with a few alterations (). Briefly, mice were trained to consume 1% sucrose solution, followed by 12 h water deprivation. Sucrose preference was calculated as (sucrose intake/total liquid intake) × 100%. TST: This test was performed based on the previous description (), with slight modification. Briefly, mice were suspended by the tail (60 cm above ground) for 5 min. Immobility duration was recorded. FST: The test was conducted according to the method of Porsolt, with some modifications (). Briefly, mice were placed in water-filled cylinders (25 °C ± 2 °C) for 5 min. Immobility was recorded during the last 4 min.
2.13 Immunohistochemistry and immunofluorescence
Mice were perfused with PBS, and brains were fixed in paraformaldehyde. Sections (5 μm) were dewaxed, rehydrated, blocked, and incubated with primary antibodies (1:200) overnight at 4 °C. For DAB staining, sections were treated with secondary antibodies, followed by color development. For immunofluorescence, sections were incubated with Alexa Fluor 488-conjugated secondary antibodies (1:500) and counterstained with DAPI. Images were acquired using an EVOS FL Imaging System or Carl Zeiss Axio Observer.
2.14 Statistical analysis
In vitro experiments were performed in at least three independent replicates. In vivo data are based on a sample size of 8 animals per group. The data analysis was conducted by GraphPad Prism 8.0 statistical software (GraphPad software, Inc., SanDiego, CA, USA) and presented as mean ± SD. Statistical significance was determined using unpaired t-test for comparisons between two groups, and one-way ANOVA followed by post hoc Tukey’s test for multiple group comparisons. Statistical significance was defined as p < 0.05, P < 0.01 or P < 0.001.
3 Results
3.1 Artemisinin (ART) attenuated the decrease in cell viability caused by CORT in PC12 cells
We first examined whether artemisinin could protect PC12 cells from CORT-induced cell toxicity. Figure 1A displays the chemical structure of artemisinin. The results of MTT assay showed that the viability of PC12 cells exposed to 200 μM of CORT for 48 h was significant decreased by 30% (Figure 1B), thus this concentration was chosen for further study. We further co-treated PC12 cells with 200 μM of CORT and different concentrations of artemisinin. The MTT results showed that artemisinin dose-dependently attenuated the loss of cell viability caused by CORT. Specifically, 25 μM of artemisinin restored cell viability to over 95% of that in the control group (Figure 1C). Furthermore, the effect of artemisinin on LDH release in CORT-treated PC12 cells was examined. The results indicated that treating PC12 cells with 200 μM corticosterone for 48 h induced a significant increase in LDH leakage compared to the control group (P < 0.01). Conversely, the addition of artemisinin significantly reduced corticosterone-induced LDH release, as shown in Figure 1D.
FIGURE 1
3.2 Artemisinin decreased intracellular ROS levels and attenuated CORT-induced MMP reduction in PC12 cells
As shown in Figure 2A, exposure of PC12 cells to 200 μM CORT for 48 h resulted in a significant increase in green fluorescent signals, indicating that CORT induced oxidative stress. In contrast, co-treatment with artemisinin (25 μM) for 48 h resulted in a reduction of green fluorescent signals. As shown in Figure 2C, quantitative analysis demonstrates that the intracellular ROS level in CORT-treated PC12 cells significantly increased to 179.5% compared to the control value (100%, P < 0.001). However, co-treatment with 25 μM artemisinin significantly reduced that value to 137% (P < 0.01).
FIGURE 2
Mitochondria generate membrane potential through the activity of enzymes in the electron transport chain. During apoptosis, the collapse of MMP coincides with the opening of mitochondrial permeability transition pores, leading to the release of cytochrome C into the cytoplasm and triggering downstream events in the apoptotic cascade. To study whether CORT-induced apoptosis is associated with the loss of MMP, we performed JC-1 assay and found that MMP was indeed significantly decreased in PC12 cells after 48 h of treatment with 200 μM CORT, whereas artemisinin reversed this effect (Figures 2B,D). These findings suggest that artemisinin may have a positive impact on mitochondrial function.
3.3 Effect of artemisinin on corticosterone-induced apoptosis
Annexin V-FITC is a fluorescent probe that binds to phosphatidylserine in the presence of calcium. As shown in Figure 3, treatment with 200 μM CORT for 48 h significantly increased the percentage of Annexin V+/PI + cells, indicating a substantial increase in the apoptosis rate of PC12 cells following CORT-induced damage. However, treatment with 25 μM artemisinin significantly reversed this effect, suggesting that artemisinin can mitigate corticosterone-induced apoptosis in PC12 cells.
FIGURE 3
3.4 Artemisinin confers neuroprotective effect through AKT and ERK signaling pathways
The AKT and ERK signaling pathways have been shown to play crucial roles in promoting cell survival and combating apoptosis. To determine whether artemisinin exerts its anti-apoptotic effects by modulating the AKT and ERK pathways, we treated PC12 cells with varying concentrations of artemisinin for different durations and then extracted proteins to analyze the expression levels of related proteins. We found that artemisinin upregulated the expression of phosphorylated AKT and ERK proteins in a time-dependent manner (Figure 4). Additionally, artemisinin also increased the expression of BDNF and phosphorylated GSK in a time-dependent manner. To further confirm whether the PI3K/AKT and ERK signaling pathways mediate the neuroprotective effect of artemisinin, PC12 cells were pre-treated with the specific PI3K inhibitor LY294002 (25 μM) and the MEK inhibitor PD98059 (25 μM) for 30 min. Subsequently, the cells were exposed to 200 μM CORT in the presence or absence of artemisinin, and cell viability was assessed using the MTT assay. The results (Figure 4B) showed that both inhibitors significantly blocked the cytoprotective effect of artemisinin. Moreover, knocking down AKT1 (Figure 4C) in PC12 cells also declined the protective effect of artemisinin against CORT (Figure 4D). These results further confirm the involvement of the AKT and ERK pathways in the neuroprotective action of artemisinin.
FIGURE 4
3.5 Neuroprotective effects of artemisinin against CORT-induced injury in primary hippocampal neurons
To investigate if the neuroprotective effect of artemisinin against CORT-induced toxicity is not only limit to PC12 cells line, the neuroprotective effect of artemisinin on primary hippocampal neurons was also examined. The viability of primary cultured neurons was significantly reduced in a dose-dependent manner following treatment with CORT concentrations of 50, 100, and 200 μM (Figure 5A). As shown in Figure 5B, artemisinin (25 μM) was also able to protect hippocampal neurons from the deleterious effects of CORT.
FIGURE 5
3.6 Artemisinin improved depression-like behaviors in CUMS mice
In this study, we evaluated the antidepressant-like activity of artemisinin in the CUMS mice model and used fluoxetine as a reference positive drug. As shown in Figures 6A,B, the immobility duration significantly increased in the CUMS-induced depressive mice in the tail suspension and the forced swimming test. While treatment with artemisinin or fluoxetine can all significantly decreased the immobility duration in both tail suspension and forced swimming tests compared to the CUMS group, and there was no significant difference in the immobility duration between the artemisinin group and the fluoxetine group in the two tests. Similarly, we also assessed depression-like behavior by sucrose preference test in CUMS mice. As shown in Figure. 6C, 5-week CUMS exposure significantly decreased the percentage of sucrose consumption in the CUMS mice as compared to control group; 1 mg/kg dose artemisinin administration significantly and dose-dependently reversed the decrease in sucrose preference in the stressed mice. However, the doses of 0.3 mg/kg and 3 mg/kg artemisinin did not show significant difference in sucrose consumption after 4 weeks of treatment.
FIGURE 6
3.7 Artemisinin stimulated the activation of AKT/GSK/NRF2/HO1 and BDNF/TrkB/ERK/CREB the signaling pathway in mice brain
To examine whether Artemisinin confers anti-depression effect via AKT/GSK/NRF2/HO1 and BDNF/TrkB/ERK/CREB pathway, we performed Western blot analysis to check the levels of phosphorylation of those proteins (Figure 7A). The results indicated that artemisinin treatment increased the level of AKT, GSK, ERK and CREB phosphorylation, as well as stimulated the expression of NRF2, HO1 and BDNF in brain extracts of CUMS mice (Figure 7B). Quantification results of the protein bands from the western blots are presented in Figures 7C–J.
FIGURE 7
3.8 Artemisinin mitigates depression-associated glial dysregulation and neurogenesis impairment in CUMS model
CUMS induces pathological alterations in hippocampal astrocytes and neurogenesis, both hallmarks of depression. To evaluate artemisinin’s cellular effects in this context, we analyzed astrocyte activity and neuronal maturation in the CA1 region, with fluoxetine serving as a positive control. Immunohistochemical staining for GFAP, a marker of astrocyte activation, revealed a significant increase in GFAP + cells in CUMS mice compared to controls, reflecting stress-induced astrocytic hyperactivity. Artemisinin treatment markedly reduced GFAP levels, similar to the effect of fluoxetine, suggesting its potential to normalize astrocyte activity in the depressed hippocampus (Figure 8A). Concurrently, we assessed neurogenesis by quantifying NeuN + mature neurons, which are critical for functional hippocampal circuitry. CUMS exposure caused a severe loss of NeuN + neurons, consistent with impaired neurogenesis in depression. Artemisinin administration significantly restored NeuN+ cell numbers, indicating its capacity to counteract stress-induced neuronal deficits (Figure 8B). These results collectively highlight artemisinin’s dual role in ameliorating depression-associated glial dysregulation and neurogenesis impairment.
FIGURE 8
4 Discussion
Although significant efforts have been made to improve the diagnosis and treatment of depression, a large percentage of patients still do not respond well to current interventions that modulate the monoaminergic system. Additionally, these drugs may be accompanied by undesirable side effects. Therefore, there is a critical need for new therapeutic drugs with high efficacy and low toxicity. In this study, we demonstrated that artemisinin significantly increased the viability of PC12 cells and neurons treated with CORT in vitro. It markedly inhibited CORT-induced leakage of LDH, production of ROS, and dysfunction of MMP in PC12 cells. In vivo, chronic administration of artemisinin improved CUMS-induced depression-like behaviors in both the FST and the TST, which are two commonly used screening tests for antidepressant-like activity (). Our study presents novel findings on the neuroprotective and antidepressant-like effects of artemisinin in both in vitro and in vivo models, indicating its potential as a drug treating depression.
Our findings that artemisinin reverses CORT-induced apoptosis and mitochondrial dysfunction extend prior evidence of its neuroprotective capacity. This discovery is supported by earlier studies which, for example, demonstrated that artemisinin can stimulate neuronal cell viability and protect against certain types of cellular stress in neuronal-like cells (; Zhao et al., 2019a; Zhao X. et al., 2020; Zheng et al., 2016). While these effects are not directly linked to antidepressant outcomes, they support the possibility that artemisinin may enhance brain health and resilience.
Our data demonstrate that artemisinin effectively attenuated corticosterone-induced ROS overproduction in neuronal-like cell models, which appears to contrast with its well-established role as a pro-oxidant antimalarial agent. This apparent paradox may be explained by the context-dependent redox activity of artemisinin. Its antimalarial action is mediated by iron-dependent cleavage of the endoperoxide bridge—primarily by heme iron derived from hemoglobin digestion within the parasite—leading to localized radical formation and cytotoxic effects specifically targeting Plasmodium. In non-malarial systems, artemisinin and its derivatives have been reported to exhibit antioxidant properties, possibly through free radical scavenging or modulation of cellular antioxidant pathways. Thus, the compound’s redox behavior may shift from pro-oxidant in parasite-infected erythrocytes to antioxidant in neuronal cells, reflecting differences in local chemical microenvironments and metal availability (; Zheng et al., 2024).
Notably, the result show that after 4 weeks of treatment, only the 1 mg/kg ART group produced a significant reversal of the CUMS-induced decrease in sucrose preference; the 0.3 mg/kg and 3 mg/kg groups did not reach significance, reflecting an inverted-U dose–response, which has been frequently reported in neuropharmacological studies (; ).
Previous studies have primarily focused on artemisinin’s anti-inflammatory and anti-cancer properties. Although depression is associated with neuroinflammation, limited investigation has been conducted into artemisinin’s potential antidepressant effects. A study found that dihydroartemisinin, a derivate of artemisinin, improved performance of mice in open-field test and closed-field test, implies that dihydroartemisinin can improve depression-like behavior (). A recent study also reported that dihydroartemisinin protected mice from CUMS-induced depression-like behaviors, evidenced by sugar water preference, forced swimming and tail suspension experiments, and the effect is associated with gut microbes (). However, whether artemisinin has antidepressant effect was unclear. Our study fills this gap by demonstrating that artemisinin can mitigate CORT-induced neuronal damage and improve depressive symptoms in CUMS mice model, highlighting its potential as a novel therapeutic agent for depression. Furthermore, emerging evidence suggests that the antidepressant-like effects of artemisinin derivatives may be enhanced by interaction with γ-aminobutyric acid (GABA). Hybrid compounds of dihydroartemisinin and GABA have demonstrated significant antidepressant-like effects in cell models, further supporting the therapeutic potential of this pathway (). Whether artemisinin confers its antidepressant effect by mediating gut microbes as dihydroartemisinin does or through GABAergic mechanisms suggested by these hybrid studies, are compelling questions requiring further investigation.
Our study also provides mechanistic insights into the neuroprotective and antidepressant effects of artemisinin. We found that artemisinin activates AKT and ERK pathways in PC12 cells, and results of both pharmacological inhibition and genetic knocking down reveal that its neuroprotective effects are dependent on these pathways. Our findings are consistent with existing literature on the role of AKT and ERK signaling in neuroprotection and neurological functions. Studies have shown that activation of the AKT pathway promotes neuronal survival and growth (), while ERK signaling is essential for synaptic plasticity and cognitive functions (). However, our study links these pathways to the neuroprotective effects of artemisinin, thereby expanding the potential applications of this compound beyond its traditional uses.
A recent work studied pathogenesis of depression in four stress-induced models (). By combining proteomic and metabolomic approaches, they found that molecular alterations in depression converge on a common AKT and ERK molecular pathways. Indeed, the antidepressant effects of many interventions are associated with these two pathways. For example, creatine and taurine mixtures showed antidepressant effects by mediating Akt and ERK/BDNF pathways (). The anti-depressant effect of vanillic acid was Akt-dependent, although was ERK-independent (). The AKT pathway was upregulated by dihydroartemisinin, although this was not further validated by using AKT inhibitors or knockdown experiments. Our mechanistic study also in agreement with abovementioned studies, highlighting the essential role of AKT and ERK pathways in the pathogenesis of depression. Further studies of these pathways could contribute to developing pharmacological interventions of depression.
Glia cells play a key role in brain inflammation and depression (; ; Zhou et al., 2021). Previous study has revealed that artemisinin could alleviate sepsis-associated neuroinflammation and cognitive impairment by modulating the activity of microglia (). In the present study, we found that artemisinin inhibited the activity of astrocyte in CUMS mice, presenting a more comprehensive role of artemisinin in modulating glia cells and neurological disorders. Depression is also characterized by impaired neurogenesis in the brain (). We also found that artemisinin promoted neurogenesis in the hippocampal CA1 of CUMS mice. These findings highlight the cellular mechanisms underlying its antidepressant effects.
5 Conclusion
In conclusion, our study highlights the potential of artemisinin as a novel therapeutic agent for depression, providing robust evidence of its neuroprotective and antidepressant-like effects in both cellular and animal models. By modulating key signaling pathways, artemisinin offers a promising alternative to traditional antidepressants with the potential for lower toxicity. Future research should aim to translate these findings into clinical settings, paving the way for new treatments for depression.
Statements
Data availability statement
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.
Ethics statement
The animal study was approved by The animal Ethics Committee of University of Macau. The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
RL: Data curation, Visualization, Investigation, Validation, Writing – review and editing, Formal Analysis, Methodology, Writing – original draft. ZZ: Writing – review and editing, Validation, Formal Analysis, Visualization, Methodology. YJ: Writing – review and editing, Formal Analysis, Validation. SL: Visualization, Writing – review and editing. JX: Writing – review and editing, Visualization. HW: Methodology, Conceptualization, Writing – review and editing, Resources. HU: Writing – review and editing, Writing – original draft. WZ: Methodology, Conceptualization, Supervision, Funding acquisition, Writing – review and editing, Resources.
Funding
The author(s) declare that financial support was received for the research and/or publication of this article. This research was supported by following research grants. This research was supported by the national Natural Science Foundation of China (32070969), The Science and Technology Development Fund, Macau SAR (File No. 0104/2022/A2 and 0038/2020/AMJ), Guangdong, Hong Kong and Macao Joint Key Laboratory for New drug screening (EF 2023-00054-FHS, GDSTC), The Guangdong Provincial Funding Committee for Basic and Applied Fundamental Research (2022-Natural Science Foundation, EF019/FHS-ZWH/2022, GDSTC), University of Macau (File No. MYRG-CRG2024-00019-FHS, MYRG-GRG2023-00118-FHS-UMDF and MYRG 2022-00154-FHS). HU’s research is funded by the São Paulo Research Foundation (FAPESP proj. No. 2024/13124-4 and 2023/17147-6) and the Brazilian National Council for Scientific and Technological Development (CNPq proj. No. 406396/2021-3 and 308012/2021–6), Brazil.
Conflict of interest
Author RL was employed by Research and Development Department, Zhuhai Tengbai Pharmaceutical Co., Ltd.
The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Glossary
- AD
Alzheimer’s Disease
- AKT
Protein Kinase B
- ART
Artemisinin
- BBB
Blood-Brain Barrier
- BCA
Bicinchoninic Acid
- BSA
Bovine Serum Albumin
- CORT
Corticosterone
- CST
Cell Signaling Technology
- CUMS
Chronic Unpredictable Mild Stress
- DAPI
4′,6-diamidino-2-phenylindole
- DMEM
Dulbecco’s Modified Eagle’s Medium
- DMSO
Dimethyl sulfoxide
- ERK
Extracellular Signal-Regulated Kinase
- FDA
Food and Drug Administration
- FBS
Fetal Bovine Serum
- FST
Forced Swim Test
- H&E
Hematoxylin and Eosin
- HPA
Hypothalamic-Pituitary-Adrenal
- HRP
Horseradish Peroxidase
- LDH
Lactate Dehydrogenase
- MAOIs
Monoamine Oxidase Inhibitors
- MEK
Mitogen-Activated Protein Kinase/Extracellular Signal-Regulated Kinase Kinase
- MMP
Mitochondrial Membrane Potential
- PC12
Pheochromocytoma cell line
- PD
Parkinson’s Disease
- PI3K
Phosphoinositide 3-Kinase
- ROS
Reactive Oxygen Species
- SPT
Sucrose Preference Test
- SSRIs
Selective Serotonin Reuptake Inhibitors
- TCAs
Tricyclic Antidepressants
- TST
Tail Suspension Test
References
1
Al-HarbiK. S. (2012). Treatment-resistant depression: therapeutic trends, challenges, and future directions. Patient prefer. Adherence6, 369–388. 10.2147/PPA.S29716
2
BaldiE.BucherelliC. (2005). The inverted “u-shaped” dose-effect relationships in learning and memory: modulation of arousal and consolidation. Nonlinearity Biol. Toxicol. Med.3, 9–21. 10.2201/nonlin.003.01.002
3
BrzezickaA. (2013). Integrative deficits in depression and in negative mood states as a result of fronto-parietal network dysfunctions. Acta Neurobiol. Exp.73, 313–325. 10.55782/ane-2013-1939
4
CarvalhoA. F.SharmaM. S.BrunoniA. R.VietaE.FavaG. A. (2016). The safety, tolerability and risks associated with the use of newer generation antidepressant drugs: a critical review of the literature. Psychother. Psychosom.85, 270–288. 10.1159/000447034
5
CastagnéV.MoserP.RouxS.PorsoltR. D. (2010). Rodent models of depression: forced swim and tail suspension behavioral despair tests in rats and mice. Curr. Protoc. Pharmacol.49 (5.8.1)–5.8.14. 10.1002/0471141755.ph0508s49
6
ChuangH.-W.WeiI.-H.LinF.-Y.LiC.-T.ChenK.-T.TsaiM.-H.et al (2020). Roles of Akt and ERK in mTOR-dependent antidepressant effects of vanillic acid. ACS Omega5, 3709–3716. 10.1021/acsomega.9b04271
7
Den HeijerT.TiemeierH.LuijendijkH. J.van der LijnF.KoudstaalP. J.HofmanA.et al (2011). A study of the bidirectional association between hippocampal volume on magnetic resonance imaging and depression in the elderly. Biol. Psychiatry70, 191–197. 10.1016/j.biopsych.2011.04.014
8
DengP.-X.SilvaM.YangN.WangQ.MengX.YeK.-Q.et al (2024). Artemisinin inhibits neuronal ferroptosis in Alzheimer's disease models by targeting KEAP1. Acta Pharmacol. Sin.46, 326–337. 10.1038/s41401-024-01378-6
9
DudekH.DattaS. R.FrankeT. F.BirnbaumM. J.YaoR.CooperG. M.et al (1997). Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science275, 661–665. 10.1126/science.275.5300.661
10
DulawaS. C.HolickK. A.GundersenB.HenR. (2004). Effects of chronic fluoxetine in animal models of anxiety and depression. Neuropsychopharmacology29, 1321–1330. 10.1038/sj.npp.1300433
11
EfferthT.RomeroM. R.WolfD. G.StammingerT.MarinJ. J.MarschallM. (2008). The antiviral activities of artemisinin and artesunate. Clin. Infect. Dis.47, 804–811. 10.1086/591195
12
Elderkin-ThompsonV.MintzJ.HaroonE.LavretskyH.KumarA. (2007). Executive dysfunction and memory in older patients with major and minor depression. Arch. Clin. Neuropsychol.22, 261–270. 10.1016/j.acn.2007.01.021
13
FirestoneG. L.SundarS. N. (2009). Anticancer activities of artemisinin and its bioactive derivatives. Expert Rev. Mol. Med.11, e32. 10.1017/S1462399409001239
14
GaoY.CuiM.ZhongS.FengC.NwobodoA. K.ChenB.et al (2020). Dihydroartemisinin ameliorates LPS-induced neuroinflammation by inhibiting the PI3K/AKT pathway. Metab. Brain Dis.35, 661–672. 10.1007/s11011-020-00533-2
15
HansonN. D.OwensM. J.NemeroffC. B. (2011). Depression, antidepressants, and neurogenesis: a critical reappraisal. Neuropsychopharmacology36, 2589–2602. 10.1038/npp.2011.220
16
HeY.XuL.LiY.TangY.RaoS.LinR.et al (2021). Synergistic integration of dihydro-artemisinin with γ-aminobutyric acid results in a more potential anti-depressant. Bioorg. Chem.110, 104769. 10.1016/j.bioorg.2021.104769
17
HoW. E.PehH. Y.ChanT. K.WongW. F. (2014). Artemisinins: pharmacological actions beyond anti-malarial. Pharmacol. Ther.142, 126–139. 10.1016/j.pharmthera.2013.12.001
18
HolmesA.WellmanC. L. (2009). Stress-induced prefrontal reorganization and executive dysfunction in rodents. Neurosci. Biobehav. Rev.33, 773–783. 10.1016/j.neubiorev.2008.11.005
19
HuangS.GalajE.WangJ.GuoY.WangS.ShiM.et al (2023). Repurposing antimalarial artesunate for the prophylactic treatment of depression: evidence from preclinical research. Brain Behav.13, e2833. 10.1002/brb3.2833
20
KennedyS. H. (2006). A review of antidepressant treatments today. Eur. Neuropsychopharmacol.16, S619–S623. 10.1016/s0924-977x(06)70007-4
21
KimS.HongK.-B.KimS.SuhH. J.JoK. (2020). Creatine and taurine mixtures alleviate depressive-like behaviour in Drosophila melanogaster and mice via regulating Akt and ERK/BDNF pathways. Sci. Rep.10, 11370. 10.1038/s41598-020-68424-1
22
LevinR. L.HellerW.MohantyA.HerringtonJ. D.MillerG. A. (2007). Cognitive deficits in depression and functional specificity of regional brain activity. Cogn. Ther. Res.31, 211–233. 10.1007/s10608-007-9128-z
23
LevyM. J. F.BoulleF.EmeritM. B.PoilboutC.SteinbuschH. W. M.Van den HoveD. L. A.et al (2019). 5-HTT independent effects of fluoxetine on neuroplasticity. Sci. Rep.9, 6311. 10.1038/s41598-019-42775-w
24
LiT.ChenH.WeiN.MeiX.ZhangS.LiuD.-L.et al (2012). Anti-inflammatory and immunomodulatory mechanisms of artemisinin on contact hypersensitivity. Int. Immunopharmacol.12, 144–150. 10.1016/j.intimp.2011.11.004
25
LiX.TengT.YanW.FanL.LiuX.ClarkeG.et al (2023). AKT and MAPK signaling pathways in hippocampus reveals the pathogenesis of depression in four stress-induced models. Transl. Psychiatry13, 200. 10.1038/s41398-023-02486-3
26
LinS.-P.LiW.WintersA.LiuR.YangS.-H. (2018). Artemisinin prevents glutamate-induced neuronal cell death via Akt pathway activation. Front. Cell. Neurosci.12, 108. 10.3389/fncel.2018.00108
27
LinS.-P.WeiJ.-X.HuJ.-S.BuJ.-Y.ZhuL.-D.LiQ.et al (2021). Artemisinin improves neurocognitive deficits associated with sepsis by activating the AMPK axis in microglia. Acta Pharmacol. Sin.42, 1069–1079. 10.1038/s41401-021-00634-3
28
LiuY.LanN.RenJ.WuY.WangS. T.HuangX. F.et al (2015). Orientin improves depression-like behavior and BDNF in chronic stressed mice. Mol. Nutr. Food Res.59, 1130–1142. 10.1002/mnfr.201400753
29
LupienS. J.De LeonM.De SantiS.ConvitA.TarshishC.NairN. P. V.et al (1998). Cortisol levels during human aging predict hippocampal atrophy and memory deficits. Nat. Neurosci.1, 69–73. 10.1038/271
30
MathersC. D.LoncarD. (2006). Projections of global mortality and burden of disease from 2002 to 2030. PLoS Med.3, e442. 10.1371/journal.pmed.0030442
31
MaudeR. J.WoodrowC. J.WhiteL. J. (2010). Artemisinin antimalarials: preserving the magic bullet. Drug Dev. Res.71, 12–19. 10.1002/ddr.20344
32
MillerL. H.SuX. (2011). Artemisinin: discovery from the Chinese herbal garden. Cell146, 855–858. 10.1016/j.cell.2011.08.024
33
MojtabaiR.OlfsonM.HanB. (2016). National trends in the prevalence and treatment of depression in adolescents and young adults. Pediatrics138, e20161878. 10.1542/peds.2016-1878
34
NolletM.GuisquetA. M. L.BelzungC. (2013). Models of depression: unpredictable chronic mild stress in mice. Curr. Protoc. Pharmacol.61, 5.65.61–5.65.17. 10.1002/0471141755.ph0565s61
35
NovakovicM. M.KorshunovK. S.GrantR. A.MartinM. E.ValenciaH. A.BudingerG. S.et al (2023). Astrocyte reactivity and inflammation-induced depression-like behaviors are regulated by Orai1 calcium channels. Nat. Commun.14, 5500. 10.1038/s41467-023-40968-6
36
NuttD.WilsonS.PatersonL. (2008). Sleep disorders as core symptoms of depression. Neurosci10, 329–336. 10.31887/DCNS.2008.10.3/dnutt
37
ParianteC. M. (2003). Depression, stress and the adrenal axis. J. Neuroendocrinol.15, 811–812. 10.1046/j.1365-2826.2003.01058.x
38
PorsoltR.BertinA.JalfreM. (1977). Behavioral despair in mice: a primary screening test for antidepressants. Arch. Int. Pharmacodyn. Ther.229, 327–336.
39
PosadinoA. M.GiordoR.PintusG.MohammedS. A.OrhanI. E.FokouP. V. T.et al (2023). Medicinal and mechanistic overview of artemisinin in the treatment of human diseases. Biomed. Pharmacother.163, 114866. 10.1016/j.biopha.2023.114866
40
PukhovS. A.SemakovA. V.PukaevaN. E.KukharskayaO. A.IvanovaT. V.KryshkovaV. S.et al (2025). Artemisinin stimulates neuronal cell viability and possess a neuroprotective effect in vitro. Molecules30, 198. 10.3390/molecules30010198
41
RanF.HsuP. D.WrightJ.AgarwalaV.ScottD. A.ZhangF. (2013). Genome engineering using the CRISPR-Cas9 system. Nat. Protoc.8, 2281–2308. 10.1038/nprot.2013.143
42
RuizN. A. L.Del ÁngelD. S.OlguínH. J.SilvaM. L. (2018). Neuroprogression: the hidden mechanism of depression. Neuropsychiatr. Dis. Treat.14, 2837–2845. 10.2147/NDT.S177973
43
RushA. J.TrivediM. H.WisniewskiS. R.NierenbergA. A.StewartJ. W.WardenD.et al (2006). Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: a STAR* D report. Am. J. Psychiatry163, 1905–1917. 10.1176/ajp.2006.163.11.1905
44
SapolskyR. M. (2000). Glucocorticoids and hippocampal atrophy in neuropsychiatric disorders. Arch. Gen. Psychiatry57, 925–935. 10.1001/archpsyc.57.10.925
45
ShiJ. Q.ZhangC. C.SunX. L.ChengX. X.WangJ. B.ZhangY. D.et al (2013). Antimalarial drug Artemisinin extenuates amyloidogenesis and neuroinflammation in APP swe/PS 1dE9 Transgenic Mice via inhibition of nuclear factor-κ B and NLRP 3 Inflammasome Activation. CNS Neurosci. Ther.19, 262–268. 10.1111/cns.12066
46
SteruL.ChermatR.ThierryB.SimonP. (1985). The tail suspension test: a new method for screening antidepressants in mice. Psychopharmacology85, 367–370. 10.1007/BF00428203
47
StoneE. A.LinY.SarfrazY.QuartermainD. (2011). Antidepressant-like action of intracerebral 6-fluoronorepinephrine, a selective full α-adrenoceptor agonist. Int. J. Neuropsychopharmacol.14, 319–331. 10.1017/S1461145710000507
48
StrawnJ. R.MillsJ. A.PoweleitE. A.RamseyL. B.CroarkinP. E. (2023). Adverse effects of antidepressant medications and their management in children and adolescents. Pharmacotherapy43, 675–690. 10.1002/phar.2767
49
TangC.LiuH.ZouH.SuM.YinH.SunM.et al (2024). Dihydroartemisinin protects mice from CUMS-induced depression-like behaviors by regulating gut microbes. Neuroscience547, 28–36. 10.1016/j.neuroscience.2023.11.029
50
ThomasG. M.HuganirR. L. (2004). MAPK cascade signalling and synaptic plasticity. Nat. Rev. Neurosci.5, 173–183. 10.1038/nrn1346
51
WangJ. (2005). Work stress as a risk factor for major depressive episode(s). Psychol. Med.35, 865–871. 10.1017/s0033291704003241
52
WangH.ZhouX.HuangJ.MuN.GuoZ.WenQ.et al (2013). The role of Akt/FoxO3a in the protective effect of venlafaxine against corticosterone-induced cell death in PC12 cells. Psychopharmacology228, 129–141. 10.1007/s00213-013-3017-9
53
WangH.HeY.SunZ.RenS.LiuM.WangG.et al (2022). Microglia in depression: an overview of microglia in the pathogenesis and treatment of depression. J. Neuroinflammation19, 132. 10.1186/s12974-022-02492-0
54
WeinbergerA. H.GbedemahM.MartinezA. M.NashD.GaleaS.GoodwinR. D. (2018). Trends in depression prevalence in the USA from 2005 to 2015: widening disparities in vulnerable groups. Psychol. Med.48, 1308–1315. 10.1017/S0033291717002781
55
WHO (2017). Depression and other common mental disorders: global health estimates. Geneva, Switzerland: World Health Organization.
56
WillnerP. (1997). Validity, reliability and utility of the chronic mild stress model of depression: a 10-year review and evaluation. Psychopharmacology134, 319–329. 10.1007/s002130050456
57
XuH.-X.LinS.-X.GongY.HuoZ.-X.ZhaoC.-Y.ZhuH.-M.et al (2020). Chaiyu-Dixian formula exerts protective effects on ovarian follicular abnormal development in chronic unpredictable mild stress (CUMS) rat model. Front. Pharmacol.11, 245. 10.3389/fphar.2020.00245
58
YanJ.MaH.LaiX.WuJ.LiuA.HuangJ.et al (2021). Artemisinin attenuated oxidative stress and apoptosis by inhibiting autophagy in MPP+-treated SH-SY5Y cells. J. Biol. Res.-Thessalon.28, 6–10. 10.1186/s40709-021-00137-6
59
ZengB.LiY.NiuB.WangX.ChengY.ZhouZ.et al (2016). Involvement of PI3K/Akt/FoxO3a and PKA/CREB signaling pathways in the protective effect of fluoxetine against corticosterone-induced cytotoxicity in PC12 cells. J. Mol. Neurosci.59, 567–578. 10.1007/s12031-016-0779-7
60
ZengZ.XuJ.ZhengW. (2017). Artemisinin protects PC12 cells against β-amyloid-induced apoptosis through activation of the ERK1/2 signaling pathway. Redox Biol.12, 625–633. 10.1016/j.redox.2017.04.003
61
ZhaoX.FangJ.LiS.GaurU.XingX.WangH.et al (2019a). Artemisinin attenuated hydrogen peroxide (H2O2)-induced oxidative injury in SH-SY5Y and hippocampal neurons via the activation of AMPK pathway. Int. J. Mol. Sci.20, 2680. 10.3390/ijms20112680
62
ZhaoX.ZengZ.GaurU.FangJ.PengT.LiS.et al (2019b). Metformin protects PC12 cells and hippocampal neurons from H2O2-induced oxidative damage through activation of AMPK pathway. J. Cell. Physiol.234, 16619–16629. 10.1002/jcp.28337
63
ZhaoX.LiS.GaurU.ZhengW. (2020a). Artemisinin improved neuronal functions in Alzheimer's disease animal model 3xtg mice and neuronal cells via stimulating the ERK/CREB signaling pathway. Aging Dis.11, 801–819. 10.14336/AD.2019.0813
64
ZhaoY.-N.CaoY.-F.ZhangY.-H.LuY.PingX.QinS.-K.et al (2020b). Nelumbo nucifera gaertn stems (hegeng) improved depression behavior in CUMS mice by regulating NCAM and GAP-43 expression. Evid.-Based Complement. Altern. Med.2020, 3056954. 10.1155/2020/3056954
65
ZhengW.ChongC.-M.WangH.ZhouX.ZhangL.WangR.et al (2016). Artemisinin conferred ERK mediated neuroprotection to PC12 cells and cortical neurons exposed to sodium nitroprusside-induced oxidative insult. Free Radic. Biol. Med.97, 158–167. 10.1016/j.freeradbiomed.2016.05.023
66
ZhengD.LiuT.YuS.LiuZ.WangJ.WangY. (2024). Antimalarial mechanisms and Resistance Status of artemisinin and its derivatives. Trop. Med. Infect. Dis.9, 223. 10.3390/tropicalmed9090223
67
ZhouB.ZhuZ.RansomB. R.TongX. (2021). Oligodendrocyte lineage cells and depression. Mol. Psychiatry26, 103–117. 10.1038/s41380-020-00930-0
68
ZhouZ.FarhanM.XingX.ZhouW.LinR.ZengS.et al (2025). Artemisinin suppressed Melanoma Recurrence and Metastasis after radical Surgery through the KIT/PI3K/AKT pathway. Int. J. Biol. Sci.21, 75–94. 10.7150/ijbs.97341
69
ZhuY.-L.LiS.-L.ZhuC.-Y.WangW.ZuoW.-F.QiuX.-J. (2020). Metabolomics analysis of the antidepressant prescription Danzhi Xiaoyao powder in a rat model of chronic unpredictable mild stress (CUMS). J. Ethnopharmacol.260, 112832. 10.1016/j.jep.2020.112832
Summary
Keywords
artemisinin, depression, corticosterone, chronic unpredictable mild stress, oxidative stress, Akt/Erk signaling
Citation
Lin R, Zhou Z, Jiang Y, Liu S, Xie J, Wang H, Ulrich H and Zheng W (2025) Artemisinin exerts antidepressant-like effects via activation of AKT and ERK signaling pathways. Front. Pharmacol. 16:1642167. doi: 10.3389/fphar.2025.1642167
Received
06 June 2025
Accepted
16 September 2025
Published
17 October 2025
Volume
16 - 2025
Edited by
Zhaohui Song, University of Louisville, United States
Reviewed by
José Fernandes Vieira, Federal University of Pará, Brazil
Kinga Sałaciak, Jagiellonian University Medical College, Poland
Updates
Copyright
© 2025 Lin, Zhou, Jiang, Liu, Xie, Wang, Ulrich and Zheng.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Wenhua Zheng, wenhuazheng@um.edu.mo
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.