Abstract
Background:
Carpesium abrotanoides has been traditionally used to treat various inflammatory and infectious diseases. However, there is no scientific report on its protective activity against intestinal inflammatory disorders, including ulcerative colitis (UC). In this study, we aimed to investigate the mechanisms underlying the protective effects of C. abrotanoides extract (CAE) in UC treatment.
Materials and Methods:
Key components of CAE were identified through ultra-performance liquidchromatography, and their potential targets and pathways were predicted through network pharmacology and molecular docking. The therapeutic effects of CAE were evaluated in a dextran sulfate sodium-induced UC mouse model by assessing clinical parameters, colon length, histopathology, and the expression of inflammatory, tight junction, and apoptosis-related markers.
Results:
The components of CAE, including chlorogenic acid, kaempferol 3-O-rhamnoside, 1,3-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid, and 4,5-dicaffeoylquinic acid, were identified. These components interacted with critical targets, including tumor necrosis factor, interleukin-6, interleukin-1β, caspase-3, and Bcl-2, modulating inflammatory and apoptotic pathways. In vivo experiments showed that CAE reduced the disease activity index, prevented colon shortening, and ameliorated histological damage. It preserved tight junction proteins (ZO-1 and claudin-1), reduced inflammatory cell infiltration, and downregulated pro-inflammatory mediators. Moreover, CAE inhibited the expression of the pro-apoptotic protein Bax, the execution-phase apoptotic markers cleaved caspase-3 and cleaved PARP, while upregulated the expression of the anti-apoptotic protein Bcl-2.
Conclusion:
CAE alleviates dextran sulfate sodium-induced colitis by exerting anti-inflammatory and anti-apoptotic effects and maintaining intestinal barrier integrity. These findings support the potential of CAE as a natural multitarget therapeutic agent for UC.
1 Introduction
Inflammatory bowel disease (IBD), most notably Crohn’s disease and ulcerative colitis (UC), is a chronic inflammatory disorder of the gastrointestinal tract. It is characterized by persistent mucosal inflammation and tissue injury in the small and large intestines, accompanied by clinical symptoms, including abdominal pain, diarrhea, and rectal bleeding. UC affects approximately 5 million people, with prevalence and incidence continuing to rise steadily worldwide (). The exact cause of the disease remains unclear; however, a complex interplay of autoimmune responses, genetic predisposition, alterations in the gut microbiota, and environmental factors is believed to be responsible (; ; ). In UC, an abnormal immune response to the intestinal microbiota triggers the release of pro-inflammatory cytokines and the infiltration of immune cells into the colonic mucosa. This damages the structure and function of tight junctions (TJ), increases intestinal permeability, and enables the passage of luminal antigens through the barrier to interact with the immune cells in the intestinal mucosa. This interaction activates immune pathways, secretes proinflammatory cytokines, and infiltrates inflammatory cells, creating a continuous vicious cycle of tissue damage and inflammation. Chronic UC may lead to serious complications, including colon cancer, strictures, and an increased risk of infection, thereby exacerbating systemic inflammation, which can significantly reduce a patient’s quality of life ().
Current treatments for UC focus on controlling inflammation, including mesalamine, corticosteroids, immunomodulators, biologics, and small molecule drugs that suppress excessive inflammatory responses. Mesalamine is considered afirst-line maintenance therapies, the remission rate is about 50%. However, these drugs cannot completely cure UC, are associated with a risk of relapse, often have reduced efficacy, and cause various side effects when used long-term (; ; ). Recently, TJ dysfunction has been closely associated with the severity, activity, and recurrence of IBD in patients. Therefore, in treating UC, it is important to suppress inflammation and repair damaged intestinal mucosa. Hence, multifaceted mechanistic studies are required (; ; ).
For these reasons, natural products are now considered promising therapeutic alternatives owing to their multicomponent properties and ability to simultaneously modulate multiple biological targets. Additionally, these products have low toxicity and are suitable for long-term use, which supports their potential as therapeutic agents for UC (; ; ). Network pharmacology is a systems biology approach in natural product research that enables the prediction and analysis of multi-target mechanisms by integrating chemical, pharmacological, and systems biology data (; ).
Carpesium abrotanoides, a member of the Asteraceae family, has been traditionally used in East Asian medicine to treat various inflammatory and infectious diseases, including sore throat, bronchitis, acute hepatitis, expelling worms, tonsillitis, malaria, and itchy skin (). Phytochemical analyses have been used to identify sesquiterpene lactones, flavonoids, and triterpenoids as major bioactive constituents. Reportedly, the extracts and compounds isolated from C. abrotanoides can exhibit anti-inflammatory, antioxidant, anti-tumor, anti-plasmodial, anti-fungal, anti-bacterial, and cytotoxic activities, suggesting their potential as a source of therapeutic agents. Furthermore, the aerial extract demonstrated antioxidant potential in various assays, including ABTS (2,2′-azinobis-3-ethylbenzothiazoline-6-sulfonic acid), DPPH (1,1-diphenyl-2-picrylhydrazyl), NOS (nitric oxide scavenging), and FIC (ferrous ion chelating). It also modulated cyclooxygenase-2 (COX-2) expression induced by various Toll-like receptor (TLR) agonists in mouse macrophages, demonstrating its efficacy as a therapeutic agent for chronic inflammatory diseases (; ; ; ). Although various studies have examined the anti-inflammatory properties of CAE, investigations specifically addressing its therapeutic effects on UC remain unexplored.
Therefore, in this study, we identified the main compounds in C. abrotanoides extract (CAE) and utilized network pharmacology to predict their mechanisms of action against UC. Furthermore, the therapeutic potential of CAE was validated in a dextran sulfate sodium (DSS)-induced colitis mouse model, confirming its efficacy and involvement in key pathways predicted by network pharmacology analysis. These findings offer evidence supporting the potential of CAE as a functional food ingredient or therapeutic agent for UC.
2 Materials and methods
2.1 Preparation of CAE
In July 2022, samples of C. abrotanoides were obtained from Jeju (South Korea) and identified by Professor Geung-Joo Lee (Chungnam National University, South Korea). A voucher specimen was deposited in the Korean Herbarium of Standard Herbal Resources of the Korea Institute of Oriental Medicine (202401025219, Daejeon, South Korea). Dried C. abrotanoides leaves were finely powdered with an electric mill, and 100 g of the sample was extracted with 1.5 L of 70% ethanol for 3 h at reflux. The extract was concentrated under reduced pressure, freeze-dried, and stored at 4 °C (yield: 26.7%).
2.2 Analytical conditions of CAE
An ultra performance liquid chromatography (UPLC, Waters, MA, United States) system equipped with a quaternary pump, auto–sampler, and photodiode array detector with UPLC® BEH C18 (150 × 2.1 mm, 1.7 μm particle size), was used for analysis. Elution was performed using solvent A (0.1% phosphoric acid with water) and solvent B (acetonitrile) in an elution gradient at a rate of 0.3 mL/min as follows: 0–2 min, 5%–5% B; 2–5 min, 5%–25% B; 5–10 min, 25%–25% B; 10–13 min, 40%–100% B; 17–19 min, 100%–5% B; 19–21 min, 5%–5% B. The detection wavelength was 284 nm, the column temperature was maintained at 40 °C, and the injection volume was 2 µL.
2.3 Network pharmacology analysis
2.3.1 Prediction of target genes
The structural data file of the target genes and SMILES format were obtained from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/) to predict the potential target genes of the selected compound. Target prediction was performed using SwissTargetPrediction (http://www.swisstargetprediction.ch/), PubChem (https://pubchem.ncbi.nlm.nih.gov/), STITCH (https://stitch.embl.de/), and BATMAN (http://bionet.ncpsb.org.cn/batman-tcm/#/home), based on their chemical structures. UC-related target genes were retrieved from the GeneCards database (https://www.genecards.org/), Online Mendelian Inheritance in Man (https://www.omim.org/), and Therapeutic Target Database (https://idrblab.net/ttd/) using the keyword “ulcerative colitis.” Common targets between the compound and the disease were identified by creating a Venn diagram using Venny 2.1 (https://bioinfogp.cnb.csic.es/tools/venny/).
2.3.2 Protein–protein interaction network
The common target genes were uploaded to the STRING database (https://string-db.org/) to create a protein–protein interaction (PPI) network. “Homo sapiens” was used for species, with a confidence score >0.400 (medium confidence). The resulting interaction network was visualized and further analyzed using Cytoscape (v3.9.1), and 10 hub genes were identified based on their degree of centrality using the CytoHubba plugin.
2.3.3 Gene ontology and kyoto encyclopedia of genes and genomes pathway enrichment analysis
Gene Ontology (GO) enrichment analysis, including biological processes, molecular functions, and cellular components, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, was conducted using the STRING platform. GO terms and KEGG pathways were further filtered to include those that (1) contained at least two genes among the top 30 hub genes identified from the PPI network, (2) had a count of five, and (3) showed a false discovery rate (FDR) < 0.01. The top 20 data points were visualized using the R software ().
2.3.4 Molecular docking simulation
The three-dimensional crystal structures of the target proteins were retrieved from the RCSB Protein Data Bank (PDB) (https://www.rcsb.org/), and Open Babel was used to prepare ligand structures. Active binding pockets were predicted using PrankWeb (https://prankweb.cz/) and CASTp (http://sts.bioe.uic.edu/castp/). Molecular docking and binding affinity calculations (kcal/mol) were performed using AutoDock tools 1.5.7 and AutoDock Vina software. Docking conformations were further visualized using Discovery Studio Visualizer (version 25.1.0.24284).
Binding affinities were interpreted based on widely accepted empirical criteria: strong binding interactions were defined as ≤ −9.0 kcal/mol; moderate binding between −7.0 and −9.0 kcal/mol; weak binding between −5.0 and −7.0 kcal/mol; and very weak or nonspecific binding interactions were indicated using values above −5.0 kcal/mol (; ; ; ).
2.4 In vivo experimental design
For the in vivo experiment, 7-week-old female C57BL/6 mice were obtained from Orient Bio (Seongnam, South Korea). The Institutional Animal Care and Use Committee of the Korea Institute of Oriental Medicine (KIOM-23-079) approved all experiments, which were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (Bethesda, MD, United States). The mice were allowed to acclimate for a 7-day period under standard laboratory conditions with ad libitum access to water and food. The mice were divided into five groups (n = 8 per group): vehicle-treated control (Con), 3.5% DSS (DSS), 3.5% DSS + CAE 100 mg/kg (CAE-100), 3.5% DSS + CAE 200 mg/kg (CAE-200), and 3.5% DSS + mesalamine 50 mg/kg (PC). CAE and mesalamine were administered orally for 7 days, followed by the induction of colitis using drinking water containing 3.5% DSS for 7 days, with CAE and mesalamine administration. On day 8, the blood and colon were collected, and the colon length was recorded. Body weight, stool condition, and total blood in the feces were recorded daily to monitor the severity of colitis (Table 1). The disease activity index (DAI) score was calculated as the mean value of body weight loss, stool consistency, and hematochezia scores (Table 1).
TABLE 1
| Score | Weight loss | Stool consistency | Visible blood in feces |
|---|---|---|---|
| 0 | None | Normal | None |
| 1 | 1%–5% | Soft stool but still formed | Positive hemoccult |
| 2 | 6%–10% | Loose stool | Observable traces of blood in stool |
| 3 | 11%–20% | Mild diarrhea | Mild bleeding |
| 4 | >20% | Severe diarrhea | Gross bleeding |
Scoring of the disease activity index.
2.5 Measurement of cytokines
Serum IL-6 and IL-1β levels were determined using an enzyme-linked immunosorbent assay kit (R&D System, MN, United States) following the manufacturer’s protocol.
2.6 Real-time quantitative polymerase chain reaction
Total RNA was extracted from colonic tissues in an RNase-free setting using the RNeasy Mini Kit (Cat# 74904; Qiagen), following the manufacturer’s instructions. The PrimeScript RT Master Mix Perfect Real-Time Kit (Cat# R047A; TaKaRa) was used to generate cDNA. Real-time quantitative polymerase chain reaction (PCR) was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) with the SYBR Green SYBR Premix Ex Taq kit (Cat# RR820A, TaKaRa). The gene expression levels were measured using the ΔΔCt method, and β-actin served as the internal control for normalization. The primer sequences are listed in Table 2.
TABLE 2
| Gene | Primer sequence | |
|---|---|---|
| Il1b | Forward | AGTGCAGCTGTCTAATGGGA |
| Reverse | GCCCATCCTCTGTGACTCA | |
| Tnf | Forward | GCAGAGAGGTTGACT TTC |
| Reverse | CTACTCCCAGGTTCTCTTCAA | |
| Il-6 | Forward | TCCAGTTGCCTTCTTGGGAC |
| Reverse | GTGTAATTAAGCCTCCGACTTG | |
| Ptgs2 | Forward | ACTCACTCAGTTTGTTGAGTCATTC |
| Reverse | TTTGATTAGTACTGTAGGGTTAATG | |
| Nos2 | Forward | GAGACAGGGAAGTCTGAAGCAC |
| Reverse | CCAGCAGTAGTTGCTCCTCTTC | |
| Casp3 | Forward | GGAGTCTGACTGGAAAGCCGAA |
| Reverse | CTTCTGGCAAGCCATCTCCTCA | |
| Parp1 | Forward | CCAGCGCAGCTCAGAGAAGCCA |
| Reverse | CATGTTCGATGGGAAAGTCCC | |
| Bax | Forward | GCTGATGGCAACTTCAACTG |
| Reverse | GATCAGCTCGGGCACTTTAG | |
| Bcl2 | Forward | TCCTTCCAGCCTGAGAGCAACC |
| Reverse | TCACGACGGTAGCGACGAGAG | |
| Gapdh | Forward | 5′- CATACCAGGAAATGAGCTTG-3′ |
| Reverse | 5′- ATGACATCAAGAAGGTGGTG-3′ |
Primer sequences that were used for the mRNA expression analyses.
2.7 Western blotting
Total protein was extracted from the cells using a radioimmunoprecipitation assay buffer. Approximately 15 μg of protein was separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subsequently transferred onto polyvinylidene difluoride membranes (Millipore, Burlington, MA, United States). The membranes were blocked with 5% non-fat milk in tris-buffered saline containing 0.05% Tween-20 for 1 h and incubated with primary antibodies overnight at 4 °C, followed by horseradish peroxidase-labeled secondary antibodies for 1 h at room temperature. The membranes were subsequently washed with 0.05% Tween-20, and signals were detected using an image analyzer (LAS 4000 mini; GE Healthcare Bio-Sciences, NJ, United States) with an enhanced chemiluminescence solution. β-actin was used as the internal reference, and relative expression was measured using the ImageJ software (National Institutes of Health, Bethesda, MD, United States).
2.8 Histological analysis
The dissected tissues were fixed in 10% neutral-buffered formalin for histological analysis and embedded in paraffin. Paraffin-embedded sections were cut into 4 µm-thick sections and stained with hematoxylin and eosin (H&E). Stained images were captured in random microscopic areas from independent animals using an Axioscan7 digital slide scanner (Zeiss, Germany). Histopathological scoring was performed in a blinded manner using a semi-quantitative scale ranging from 0 to 9, with higher scores indicating more severe pathological alterations. The scoring system consisted of three parameters: epithelial damage (0–3), inflammatory cell infiltration (0–3), and crypt damage/ulceration (0–3). The total histopathological score was calculated as the sum of these parameters (; ).
2.9 Immunohistochemistry
The paraffin sections were deparaffinized, hydrated, and treated with 1% hydrogen peroxide in methanol. After antigen retrieval and blocking, all sections were incubated with primary antibodies against caspase-3 (1:500 dilution, Cell Signaling, 9665S, Danvers, MA, United States) and zonula occludens-1 (ZO-1) (1:200 dilution, Abcam, ab96587, San Francisco, CA, United States) at appropriate temperatures and times. An immune response was induced using the ImmPRESS® horseradish peroxidase goat anti-rabbit IgG polymer detection kit peroxidase (Vector Laboratories, MP-7451, Burlingame, CA, United States). A DAB Chromogen/Substrate Kit (High Contrast) (Scytek, UT, United States) was used for visualization, and counterstaining was performed using hematoxylin. Image scanning, analysis, and editing were performed as described in Section 2.8.
2.10 Terminal deoxynucleotidyl transferase dUTP nick end labeling staining
The level of apoptosis in the colon sections was determined using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining (Roche, Cat# 11684795910) following the manufacturer’s instructions. The nucleus with 4,6′-Diamidino-2-phenylindole (DAPI; Abcam, Cat#: ab104139) was stained, and the TUNEL-positive cells were counted (a minimum of 10 crypts with normal morphology were counted per section).
2.11 Statistical analysis
GraphPad Prism 7 software (GraphPad Software, San Diego, CA, United States) was used to perform all statistical analyses. Data are shown as mean ± standard deviation. Differences between groups were evaluated using one-way ANOVA, followed by Dunnett’s multiple comparison test. Statistical significance was set at P < 0.05.
3 Results
3.1 Identification of CAE components
CAE was analyzed using UPLC. We identified five phytochemicals predominantly present in the extract by comparing the retention times and mass spectra with those of reference standards (A). The quantity of each compound was 25.1 ± 0.48 mg/g for chlorogenic acid, 10.8 ± 0.09 mg/g for Kaempferol 3-O-rhamnoside, 2.6 ± 0.05 mg/g for 1,3-dicaffeoylquinic acid, 39.5 ± 0.20 mg/g of 3,5-dicaffeoylquinic acid, and 2.2 ± 0.16 mg/g for 4,5-dicaffeoylquinic acid (Figure 1).
FIGURE 1
3.2 Network pharmacology analysis
3.2.1 Prediction of the potential targets for UC by CAE
A network pharmacology approach was used to investigate the mechanism of action of CAE in treating UC. The targets of the five CAE components were predicted using PubChem, STITCH, BATMAN, and SwissTarget Prediction. Overall, 407 targets were identified in the database. As the interaction between targets is essential in the interaction of CAE, we analyzed the compound-target network of CAE (Figure 2A). We searched for UC-related genes acquired from Online Mendelian Inheritance in Man, Therapeutic Target Database, and GeneCards to identify UC-associated targets of CAE. As shown in Figure 2B, 5,411 target genes were identified from the three databases after removing duplicate data. Potential targets of CAE for improving UC were screened using Venny 2.1, identifying 245 common genes (Figure 2C).
FIGURE 2
3.2.2 Analysis of targets in the PPI network
Using the STRING database, protein interaction analysis was performed on 245 common target genes to ameliorate UC from CAE. A PPI network was created (Figure 2D). Overall, 244 nodes and 5,688 edges were obtained. Core target proteins in the PPI network were screened using Cytoscape 3.9.1. The top 10 interactions were identified based on their degree of centrality within the CytoHubba plugin. The results showed that TNF, AKT1, TP53, ALB, IL6, IL1B, CASP3, BCL2, JUN, and NFKB1 were obtained (Figure 2E).
3.2.3 Enrichment analysis
GO and KEGG enrichment analyses were performed to investigate the potential mechanisms by which CAE exerts its therapeutic effects on UC. Significant terms and pathways were identified using the criteria: FDR <0.01 and gene count ≥5. GO analysis yielded 1,344 biological process terms, 94 cellular component terms, and 121 molecular function terms for UC. Additionally, 183 KEGG pathways were significantly enriched. Among these, the top 20 GO terms and KEGG pathways were selected for further analysis. The summary of the results is shown in Figure 3. Notably, KEGG enrichment analysis was used to identify significant enrichment in the TNF signaling pathway, apoptosis, MAPK signaling pathway, PI3K-Akt signaling pathway, and IL-17 signaling pathway, which are known to be involved in UC pathophysiology. Among these pathways, the TNF signaling pathway and apoptosis were most closely associated with inflammation and TJ dysfunction.
FIGURE 3
3.2.4 Molecular docking analysis
To investigate the therapeutic mechanism of CAE in UC, among the top 10 hub targets of the PPI network, representative biomarkers associated with inflammation and apoptosis, including (PDB ID: 1ITB), IL-6 (PDB ID: 1ALU), Bcl-2 (PDB ID: 1G5M), caspase-3 (PDB ID: 1PAU), and TNF-α (PDB ID: 1TNF) were selected and analyzed through molecular docking with chlorogenic acid (CID1794427), kaempferol 3-O-rhamnoside (CID5316673), 1,3-dicaffeoylquinic acid (CID6474640), 3,5-dicaffeoylquinic acid (CID6474310), and 4,5-dicaffeoylquinic acid (CID5281780) of main components of CAE. The molecular docking binding affinities (kcal/mol) between the five CAE components and the five target proteins are shown as a heatmap (Figure 4A). Each cell represents the relative strength of a protein-compound pair, with color intensity corresponding to the docking score. The results showed that the binding energies between the single compound of CAE and the core target proteins were mostly < −6 kcal/mol, indicating that the predicted CAE active compound had good binding properties with the key targets. Among the 25 available combinations, protein-compound interactions that showed high binding affinity were selected for each protein to build a unique one-to-one mapping (Figures 4B–F). Each complex illustrates the key molecular interactions and binding orientations between the compound and its target protein.
FIGURE 4
3.3 Effects of CAE in DSS-induced colitis mice
We induced severe colitis in mice by administering DSS in their drinking water to determine whether CAE improves colitis. Symptoms such as diarrhea, bloody stools, weight loss, colonic shortening, and mucosal ulcers were observed. Excessive inflammatory responses and persistent intestinal dysfunction were caused by DSS-induced weight loss. In DSS-treated mice, diarrhea and rectal bleeding were observed from day 2, and a noticeable change in body weight was observed from day 5. Administration of 100 mg/kg CAE and the positive control mesalamine (PC) ameliorated body weight loss and reduced the disease activity index (DAI), notably 200 mg/kg CAE produced a significantly greater improvement in DSS-treated mice. (Figures 5A,B).
FIGURE 5
Colonic shortening and luminal surface damage are important clinical manifestations of colitis inflammation (). Colon length was significantly decreased in the DSS group (P < 0.0001) compared with that in the control group, whereas CAE treatment at 200 mg/kg significantly restored colon length (P < 0.05) (Figure 5C).
Furthermore, to assess morphological changes in the colon tissue, H&E staining and semiquantitative analysis of pathological damage to the colon were performed. As shown in Figure 6, colonic distortion of crypt structures, loss of goblet cells, severe epithelial injury, and inflammatory cell infiltration in the mucosal and submucosal layers were observed in the DSS group. However, CAE administration to the DSS-induced mouse model revealed dose-dependent protection of the colon crypt structures and reduced histological inflammation. Notably, 200 mg/kg CAE exhibited a more pronounced protective effect, comparable to or better than the PC, indicating substantial amelioration of colonic injury. These results showed that CAE protected against DSS-induced colitis in mice.
FIGURE 6
3.4 Effects of CAE on intestinal barrier dysfunction in DSS-induced colitis in mice
Immunohistochemistry analysis was performed to investigate intestinal barrier dysfunction (Figure 7). In the DSS group, ZO-1 and claudin-1 expression notably decreased. However, CAE administration in the DSS-induced mouse model resulted in significantly higher ZO-1 and claudin-1 expression than in mice treated only with DSS. These findings showed that CAE alleviated DSS-induced colitis by protecting the intestinal barrier.
FIGURE 7
3.5 Effects of CAE on the inflammatory cytokines in DSS-induced colitis in mice
To explore the potential anti-inflammatory activities of CAE in a mouse model of DSS-induced UC, we evaluated the levels of proinflammatory cytokines, IL-6, and IL-1β in the serum. DSS administration significantly elevated the levels of inflammatory cytokines IL-6 (P < 0.0001) and IL-1β (P < 0.0001) in the mouse serum. However, IL-6 and IL-1β levels in mice treated with CAE at 200 mg/kg were reduced compared with those in the DSS-treated group (Figures 8A,B). Real-time PCR was performed to compare the mRNA expression levels of inflammation-related factors in the colon. The mRNA expression of inflammatory cytokines and mediators, including Il6, Il1b, Tnf, Nos2, and Ptgs2, was significantly higher in the colon tissue of the DSS group than in that of the Con group (P < 0.0001). Both the 100 mg/kg CAE and the positive control (PC) groups exhibited similar reductions, although the differences were not statistically significant. The 100 mg/kg CAE and PC groups showed similar reduction effects, but without significant differences. However, treatment with 200 mg/kg CAE resulted in a significant reduction in the mRNA expression of Il6 (P < 0.01), Il1b (P < 0.0001), Tnf (P < 0.0001), Ptgs2 (P < 0.05), and Nos2 (P < 0.001) (Figures 8C–G). These results indicate that although DSS treatment increased the expression of inflammatory cytokines in mice, CAE effectively suppressed their expression and attenuated the inflammatory response.
FIGURE 8
3.6 Effects of CAE on apoptosis in DSS-induced colitis mice
TUNEL assay, caspase-3 immunohistochemistry analysis, and Western blotting were performed to examine the changes in apoptosis. In the DSS-treated group, the number of apoptotic cells significantly increased. Conversely, CAE administration significantly decreased the number of apoptotic cells. Reduced caspase-3 expression was observed in the CAE group (Figure 9). Similarly, western blotting and mRNA showed that the expression of apoptosis related marker (caspase-3, PARP, Bax, and Bcl-2) was markedly reduced following CAE administration (Figure 10).
FIGURE 9
FIGURE 10
4 Discussion
Acute colitis primarily occurs in the large intestine; however, its etiology and pathogenesis remain unclear. The focus of recent research has been on developing candidate drugs that are effective against UC using the multiple and complex components of natural products to simultaneously modulate broad pharmacological activities (; ). Natural compounds have been shown to alleviate UC symptoms through various mechanisms, including regulating inflammatory signaling pathways, including NF-κB, JAK/STAT, and MAPK, protection of intestinal epithelial TJs, and restoration of the gut microbiota balance (; ; ; ; ; ). In the present study, we aimed to determine the effectiveness of CAE in a DSS-induced colitis model and to explore the therapeutic potential mechanism of CAE using a network pharmacology approach and molecular docking.
First, to identify potential therapeutic targets and pathways of CAE in UC, five CAE components comprising chlorogenic acid, kaempferol 3-O-rhamnoside, 1,3-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid, and 4,5-dicaffeoylquinic acid, were identified using UPLC analysis. KEGG pathway analysis of these components showed that CAE is closely associated with the TNF pathway, and apoptosis is a key pathway in UC pathogenesis (; ) (Figure 3). TNF induces chronic inflammation and cell apoptosis through pro-inflammatory cytokine upregulation. Consistent with this phenomenon, previous studies showed that TNF inhibition attenuates intestinal epithelial cell apoptosis and inflammatory responses in UC mouse models (; ). Therefore, the focus of this study was on the potential of CAE to alleviate UC symptoms by suppressing intestinal barrier dysfunction caused by inflammation and apoptosis, which are among the key mechanisms contributing to UC progression.
DSS-induced colitis in experimental animals is a chemically induced model that is used to mimic the UC pathology in humans. This model has many advantages, including easy use, reproducibility, and the ability to control the extent and severity of inflammation by varying the concentration and duration of DSS treatment, which induces clinical signs of colitis as early as day 1 of treatment. These signs are mainly associated with changes in the expression of TJ proteins, such as ZO-1, occludin, and various claudins (; ). Several studies reported that intestinal inflammation is preceded by a decrease in TJ complexes and a subsequent increase in colonic permeability, which, in turn, results in clinical symptoms. These symptoms are observed as typical histological changes in the colon tissue, including a decrease in mucus and goblet cells, epithelial erosion, ulcers, and granulocytic infiltration into the lamina propria and submucosa (; ). Moreover, inflammatory cytokines and mediators, such as IL-1β, IL-6, TNF-α, iNOS, and COX-2, are known to be increased in DSS-induced colitis animal models and are closely associated to developing IBD (; ). In our study, clinical symptoms such as diarrhea and bloody stools appeared 2 days after administration of 3.5% DSS and subsequently increased the DAI and shortened the colon, a finding consistent with those found with established biomarkers of UC (; ). Moreover, DSS induced a marked reduction in ZO-1 and claudin-1 expression, changes in the colonic crypt structure, loss of goblet cells, severe epithelial damage, and inflammatory cell infiltration into the mucosa and submucosa. Notably, our findings indicate that the CAE administration group showed preserved expression of TJ proteins compared with those of the DSS administration group, showing reduced infiltration of inflammatory cells, and decreased levels of inflammatory mediators. These results show that CAE mitigates colonic inflammation by maintaining intestinal barrier integrity, protecting mucosal structure, and restoring epithelial barrier function by preserving TJs.
Excessive apoptosis in intestinal epithelial cells can damage the intestinal barrier permeability, initiating and exacerbating colitis (). The number of apoptotic epithelial cells increases with the development of UC, leading to the destruction of mucosal integrity and directly affecting intestinal epithelial barrier function (). Apoptosis is tightly regulated by a balance between pro-apoptotic and anti-apoptotic proteins, and the most representative molecular markers involved are Bax, Bcl-2, and PARP (). PARP-1, a key member of the PARP family, regulates multiple cellular functions, including chromatin remodeling, DNA repair, and cell death (). During apoptosis, PARP is cleaved by caspases, especially caspase-3; the presence of cleaved PARP is a hallmark of apoptosis (). Bax and Bcl-2 work antagonistically; Bax promotes cell death, while Bcl-2 inhibits it (). Hence, upregulating Bax and PARP-1 and downregulating Bcl-2 may be important indicators of apoptosis. The results of this study show that CAE exerts anti-apoptotic effects in DSS-induced UC by downregulating pro-apoptotic proteins, including Bax, Cleaved-caspase-3, and PARP and upregulating the anti-apoptotic protein Bcl-2.
The main CAE components include chlorogenic acid, kaempferol, 3-O-rhamnoside, 1,3-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid, and 4,5-dicaffeoylquinic acid. In a previous study, chlorogenic acid was reported to have antioxidant and anti-inflammatory effects and promote the growth of beneficial intestinal bacteria while inhibiting the growth of harmful bacteria in DSS-induced colitis (). Reportedly, dicaffeoylquinic acid, which contains 3,5-dicaffeoylquinic acid and 4,5-dicaffeoylquinic acid, alleviates DSS-induced colitis, potentially by modulating alterations in the gut microbiota associated with the disease (). Meanwhile, the molecular docking results showed that these main components of CAE bind effectively to targets, including TNF, IL-6, IL-1β, caspase-3, and Bcl-2, which are critical in the inflammatory cascade underlying UC. Specifically, pro-inflammatory cytokines (TNF, IL-6, and IL-1β) indirectly activate endothelial cells through inflammation in target cells. CASP3 and BCL2 play critical roles in apoptosis and survival, which are central to UC pathophysiology. However, the doses of these compounds (chlorogenic acid, 3,5-dicaffeoylquinic acid, and 4,5-dicaffeoylquinic acid) used to evaluate their efficacy were significantly higher than those of CAE, making it difficult to attribute the effects of CAE solely to the actions of the individual compounds. Furthermore, the anti-inflammatory effects of kaempferol 3-O-rhamnoside and 1,3-dicaffeoylquinic acid have been reported; however, their effects on UC have not been studied (; ). Therefore, further studies are required to determine whether kaempferol 3-O-rhamnoside and 1,3-dicaffeoylquinic acid are the active components of CAE or whether the effect is due to a synergistic effect among other compounds present in CAE.
5 Conclusion
Our findings show that CAE effectively alleviates UC symptoms by preserving TJ protein expression, reducing inflammatory mediator levels, and restoring epithelial barrier integrity through anti-inflammatory and anti-apoptotic mechanisms. Thus, CAE is a promising therapeutic option for UC.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Ethics statement
The Institutional Animal Care and Use Committee of the Korea Institute of Oriental Medicine (KIOM-23-079) approved all experiments, which were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (Bethesda, MD, United States). The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
AK: Methodology, Investigation, Data curation, Writing – original draft, Visualization, Conceptualization. SK: Investigation, Writing – original draft, Visualization, Methodology, Data curation, Conceptualization. KJ: Data curation, Investigation, Visualization, Formal Analysis, Writing – original draft. ES: Formal Analysis, Investigation, Writing – original draft, Resources. C-SK: Investigation, Writing – original draft, Visualization. D-SK: Project administration, Writing – original draft, Resources, Funding acquisition. Y-HH: Funding acquisition, Project administration, Writing – original draft, Methodology. YL: Writing – review and editing, Software, Investigation, Methodology, Visualization, Writing – original draft, Conceptualization.
Funding
The author(s) declare that financial support was received for the research and/or publication of this article. This research was supported by Korea Institute of Oriental Medicine grant number KSN2224020, KSN1824311, and the Bio and Medical Technology Development Program of the National Research Foundation (NRF), funded by the Korean government (MSIT) (2022M3A9E4084134). The funders had no role in designing the experiment or publishing the manuscript.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that Generative AI was used in the creation of this manuscript. During the preparation of this work, the authors used ChatGPT to improve language and readability. After using this tool/service, the authors reviewed and edited the content as needed and take full responsibility for the publication’s content.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphar.2025.1672111/full#supplementary-material
Abbreviations
Bcl-2, B cell lymphoma 2; BP, biological process; CAE, Carpesium abrotanoides extract; CC, cellular component; COX, cyclooxygenase; DAI, disease activity index; DSS, dextran sulfate sodium; FDR, false discovery rate; GO, Gene Ontology; IBD, Inflammatory bowel disease; IL, interleukin; iNOS, inducible nitric oxide synthase; KEGG, Kyoto Encyclopedia of Genes and Genomes; KIOM, Korea Institute of Oriental Medicine; MF, molecular function; OMIM, Online Mendelian Inheritance in Man; PC, positive control; PCR, polymerase chain reaction; PDB, Protein Data Bank; PPI, protein–protein interaction; TJ, tight junction; TTD, Therapeutic Target Database; TUNEL, transferase dUTP Nick End Labeling; UC, ulcerative colitis; UPLC, ultra performance liquid chromatography; ZO-1, zonula occludens-1.
References
1
ChangS.MurphyM.MalterL. (2024). A review of available medical therapies to treat moderate-to-severe inflammatory bowel disease. Am. J. Gastroenterol.119 (1), 55–80. 10.14309/ajg.0000000000002485
2
ChassaingB.AitkenJ. D.MalleshappaM.Vijay-KumarM. (2014). Dextran sulfate sodium (DSS)-Induced colitis in mice. Curr. Protoc. Immunol.104, 15.25.11–15. 10.1002/0471142735.im1525s104
3
D'HaensG. (2007). Risks and benefits of biologic therapy for inflammatory bowel diseases. Gut56 (5), 725–732. 10.1136/gut.2006.103564
4
DallakyanS. A. J. O. (2015). “Small-molecule library screening by docking with PyRx,” in Chemical biology: methods in molecular biology (New York, NY: Humana Press).
5
EderP.Lykowska-SzuberL.Stawczyk-EderK.Krela-KazmierczakI.LinkeK. (2014). Alterations in programmed cell death mechanism and their role in the pathogenesis of inflammatory bowel diseases. Prz. Gastroenterol.9 (5), 275–279. 10.5114/pg.2014.46162
6
FangH. Z.ZhaoJ. H. (2007). Tujia medicine. China: China Medical Science Press.
7
FerreiraL. G.Dos SantosR. N.OlivaG.AndricopuloA. D. (2015). Molecular docking and structure-based drug design strategies. Molecules20 (7), 13384–13421. 10.3390/molecules200713384
8
GandhiG. R.MohanaT.AtheshK.HillaryV. E.VasconcelosA. B. S.Farias de FrancaM. N.et al (2023). Anti-inflammatory natural products modulate interleukins and their related signaling markers in inflammatory bowel disease: a systematic review. J. Pharm. Anal.13 (12), 1408–1428. 10.1016/j.jpha.2023.09.012
9
Garcia-CarbonellR.YaoS. J.DasS.GumaM. (2019). Dysregulation of intestinal epithelial cell RIPK pathways promotes chronic inflammation in the IBD gut. Front. Immunol.10, 1094. 10.3389/fimmu.2019.01094
10
GnanasekarP. J. V.Sundara GanapathyR.Manoj KumarS. B.Femila RaniJ.PoojaC. U.GowrishankarT.et al (2025). Overview of herbal plants used to treat ulcerative colitis. J. Pharmacogn. Phytochemistry14, 359–364. 10.22271/phyto.2025.v14.i1e.15257
11
HanS. H.LeeJ. H.WooJ. S.JungG. H.JungS. H.HanE. J.et al (2022). Myricetin induces apoptosis through the MAPK pathway and regulates JNK-Mediated autophagy in SK-BR-3 cells. Int. J. Mol. Med.49 (4), 54. 10.3892/ijmm.2022.5110
12
HiraiF.MatsuiT.AoyagiK.InoueN.HibiT.OshitaniN.et al (2010). Validity of activity indices in ulcerative colitis: comparison of clinical and endoscopic indices. Dig. Endosc.22 (1), 39–44. 10.1111/j.1443-1661.2009.00916.x
13
HufnagelM.RademaekersA.WeisertA.HaberleinH.FrankenS. (2024). Pharmacological profile of dicaffeoylquinic acids and their role in the treatment of respiratory diseases. Front. Pharmacol.15, 1371613. 10.3389/fphar.2024.1371613
14
IbrahimS. R. M.FadilS. A.FadilH. A.HareeriR. H.AbdallahH. M.MohamedG. A. (2022). Ethnobotanical uses, phytochemical composition, biosynthesis, and pharmacological activities of Carpesium abrotanoides L. (Asteraceae). Plants (Basel)11 (12), 1598. 10.3390/plants11121598
15
JeonS. J.ChoiE. Y.HanE. J.LeeS. W.MoonJ. M.JungS. H.et al (2023). Piperlongumine induces apoptosis via the MAPK pathway and ERK-mediated autophagy in human melanoma cells. Int. J. Mol. Med.52 (6), 115. 10.3892/ijmm.2023.5318
16
JungH.Leal-EkmanJ. S.LuQ.StappenbeckT. S. (2019). Atg14 protects the intestinal epithelium from TNF-triggered villus atrophy. Autophagy15 (11), 1990–2001. 10.1080/15548627.2019.1596495
17
KieslerP.FussI. J.StroberW. (2015). Experimental models of inflammatory bowel diseases. Cell Mol. Gastroenterol. Hepatol.1 (2), 154–170. 10.1016/j.jcmgh.2015.01.006
18
KoelinkP. J.WildenbergM. E.StittL. W.FeaganB. G.KoldijkM.van 't WoutA. B.et al (2018). Development of reliable, valid and responsive scoring systems for endoscopy and histology in animal models for inflammatory bowel disease. J. Crohns Colitis12 (7), 794–803. 10.1093/ecco-jcc/jjy035
19
KuoW. T.ZuoL.OdenwaldM. A.MadhaS.SinghG.GurniakC. B.et al (2021). The tight junction protein ZO-1 is dispensable for barrier function but critical for effective mucosal repair. Gastroenterology161 (6), 1924–1939. 10.1053/j.gastro.2021.08.047
20
Le BerreC.HonapS.Peyrin-BirouletL. (2023). Ulcerative colitis. Lancet402 (10401), 571–584. 10.1016/S0140-6736(23)00966-2
21
LiC.JiaW. W.YangJ. L.ChengC.OlaleyeO. E. (2022). Multi-compound and drug-combination pharmacokinetic research on Chinese herbal medicines. Acta Pharmacol. Sin.43 (12), 3080–3095. 10.1038/s41401-022-00983-7
22
LiB.XiuM.HeL.ZhouS.YiS.WangX.et al (2024). Protective effect of San Huang Pill and its bioactive compounds against ulcerative colitis in Drosophila via modulation of JAK/STAT, apoptosis, Toll, and Nrf2/Keap1 pathways. J. Ethnopharmacol.322, 117578. 10.1016/j.jep.2023.117578
23
LiangC.ChenS.LiuC.WangL.CuiH.DuK.et al (2025). Active components unveiling and pharmacodynamic research on Valeriana jatamansi jones for ameliorating ulcerative colitis based on pharmacokinetics and network pharmacology. J. Ethnopharmacol.341, 119299. 10.1016/j.jep.2024.119299
24
LiuJ.LiuJ.TongX.PengW.WeiS.SunT.et al (2021). Network pharmacology prediction and molecular docking-based strategy to discover the potential pharmacological mechanism of Huai Hua San against ulcerative colitis. Drug Des. Devel Ther.15, 3255–3276. 10.2147/DDDT.S319786
25
LiuH.ZhaoW.ChenH.WuH.LiX.SuA.et al (2025). Highland barley improves DSS-Induced ulcerative colitis in C57BL/6J mice. Food Sci. Nutr.13 (5), e70132. 10.1002/fsn3.70132
26
LiuX.AnL.ZhouY.PengW.HuangC. (2023). Antibacterial mechanism of Patrinia scabiosaefolia against Methicillin resistant Staphylococcus epidermidis. Infect. Drug Resist16, 1345–1355. 10.2147/IDR.S398227
27
LiuZ.MengL.WangM.WangL.LiuY.HouG.et al (2023). New iridoids from Patrinia scabiosaefolia and their hypoglycemic effects by activating PI3K/Akt signaling pathway. Fitoterapia165, 105423. 10.1016/j.fitote.2022.105423
28
LongD.MaoC.ZhangW.ZhuY.XuY. (2025). Natural products for the treatment of ulcerative colitis: focus on the JAK/STAT pathway. Front. Immunol.16, 1538302. 10.3389/fimmu.2025.1538302
29
LuK.LiuL.LinP.DongX.NiL.CheH.et al (2023). Saccharina japonica Ethanol Extract ameliorates Dextran sulfate sodium-induced colitis via reshaping intestinal microenvironment and alleviating inflammatory response. Foods12 (8), 1671. 10.3390/foods12081671
30
MengX. Y.ZhangH. X.MezeiM.CuiM. (2011). Molecular docking: a powerful approach for structure-based drug discovery. Curr. Comput. Aided Drug Des.7 (2), 146–157. 10.2174/157340911795677602
31
NoorF.AsifM.AshfaqU. A.QasimM.Tahir Ul QamarM. (2023). Machine learning for synergistic network pharmacology: a comprehensive overview. Brief. Bioinform24 (3), bbad120. 10.1093/bib/bbad120
32
PoritzL. S.GarverK. I.GreenC.FitzpatrickL.RuggieroF.KoltunW. A. (2007). Loss of the tight junction protein ZO-1 in dextran sulfate sodium induced colitis. J. Surg. Res.140 (1), 12–19. 10.1016/j.jss.2006.07.050
33
PorterR. J.KallaR.HoG. T. (2020). Ulcerative colitis: recent advances in the understanding of disease pathogenesis. F1000Res9, F1000 Faculty Rev-294. 10.12688/f1000research.20805.1
34
QiuW.WuB.WangX.BuchananM. E.RegueiroM. D.HartmanD. J.et al (2011). PUMA-Mediated intestinal epithelial apoptosis contributes to ulcerative colitis in humans and mice. J. Clin. Invest.121 (5), 1722–1732. 10.1172/JCI42917
35
QiuM. T.ZhouL.WangX. Y.LiZ. P.WeiM. X.ZengZ. H.et al (2025). Anti-colitis comparison of polysaccharides and anthocyanins extracted from Black wolfberry based on microbiomics, immunofluorescence and multi-cytokines profile analysis. Int. J. Biol. Macromol.310, 143700. 10.1016/j.ijbiomac.2025.143700
36
SchuerweghA. J.DombrechtE. J.StevensW. J.Van OffelJ. F.BridtsC. H.De ClerckL. S. (2003). Influence of pro-inflammatory (IL-1 alpha, IL-6, TNF-alpha, IFN-gamma) and anti-inflammatory (IL-4) cytokines on chondrocyte function. Osteoarthr. Cartil.11 (9), 681–687. 10.1016/s1063-4584(03)00156-0
37
SethyC.KunduC. N. (2022). PARP inhibitor BMN-673 induced apoptosis by trapping PARP-1 and inhibiting base excision repair via modulation of pol-beta in chromatin of breast cancer cells. Toxicol. Appl. Pharmacol.436, 115860. 10.1016/j.taap.2021.115860
38
SiegmundB. (2002). Interleukin-1beta converting enzyme (caspase-1) in intestinal inflammation. Biochem. Pharmacol.64 (1), 1–8. 10.1016/s0006-2952(02)01064-x
39
SouzaR. F.CaetanoM. A. F.MagalhaesH. I. R.CastelucciP. (2023). Study of tumor necrosis factor receptor in the inflammatory bowel disease. World J. Gastroenterol.29 (18), 2733–2746. 10.3748/wjg.v29.i18.2733
40
SubudhiR. N.PooniaN.SinghD.AroraV. (2024). Natural approaches for the management of ulcerative colitis: evidence of preclinical and clinical investigations. Nat. Prod. Bioprospect14 (1), 42. 10.1007/s13659-024-00463-x
41
TeamR. C. (2023). R: a language and environment for statistical computing.
42
van der LelieD.OkaA.TaghaviS.UmenoJ.FanT. J.MerrellK. E.et al (2021). Rationally designed bacterial consortia to treat chronic immune-mediated colitis and restore intestinal homeostasis. Nat. Commun.12 (1), 3105. 10.1038/s41467-021-23460-x
43
VillanacciV.Del SordoR.LanzarottoF.RicciC.SidoniA.ManentiS.et al (2025). Claudin-2: a marker for a better evaluation of histological mucosal healing in inflammatory bowel diseases. Dig. Liver Dis.57 (4), 827–832. 10.1016/j.dld.2024.08.001
44
WanP.PengY. J.ChenG. J.XieM. H.DaiZ. Q.HuangK. Y.et al (2019). Dicaffeoylquinic acids from ilex kudingcha attenuate dextran sulfate sodium-induced colitis in C57BL/6 mice in association with the modulation of gut microbiota. J. Funct. Foods61, 103468. 10.1016/j.jff.2019.103468
45
WanY.YangL.JiangS.QianD.DuanJ. (2022). Excessive apoptosis in ulcerative colitis: crosstalk between apoptosis, ROS, ER stress, and intestinal homeostasis. Inflamm. Bowel Dis.28 (4), 639–648. 10.1093/ibd/izab277
46
WangM.WanM.LiuM.ZhouW.ZhangX.LiuW.et al (2025). Integrated network pharmacology and metabolomics analysis to reveal the potential mechanism of ershen wan in ameliorating ulcerative colitis. J. Ethnopharmacol.346, 119690. 10.1016/j.jep.2025.119690
47
WangW.ZhaoY.WangZ.WangC.BiL.WangY. (2025). Thlaspi arvense suppresses gut microbiota related TNF inflammatory pathway to alleviates ulcerative colitis. Front. Immunol.16, 1537325. 10.3389/fimmu.2025.1537325
48
WeberC. R.NalleS. C.TretiakovaM.RubinD. T.TurnerJ. R. (2008). Claudin-1 and claudin-2 expression is elevated in inflammatory bowel disease and may contribute to early neoplastic transformation. Lab. Invest.88 (10), 1110–1120. 10.1038/labinvest.2008.78
49
WuP.ChangC.ZhuG.ZhaiL.ZhangX.HuanQ.et al (2023). Network pharmacology study of bioactive components and molecular mechanisms of the glycoside fraction from Picrorhiza scrophulariiflora against experimental colitis. Drug Des. Devel Ther.17, 1531–1546. 10.2147/DDDT.S407339
50
XuP.ChenS.FuQ.ZhuS. Y.WangZ.LiJ. (2024). Amelioration effects of chlorogenic acid on mice colitis: anti-inflammatory and regulation of gut flora. Food Biosci.61, 104942. 10.1016/j.fbio.2024.104942
51
ZengY. S.PengJ.GaoX. F.TianD.ZhanW.LiuJ.et al (2022). A novel gut-restricted RIPK1 inhibitor, SZ-15, ameliorates DSS-induced ulcerative colitis. Eur. J. Pharmacol.937, 175381. 10.1016/j.ejphar.2022.175381
52
ZhaiY.LiuL.ZhangF.ChenX.WangH.ZhouJ.et al (2025). Network pharmacology: a crucial approach in traditional Chinese medicine research. Chin. Med.20 (1), 8. 10.1186/s13020-024-01056-z
53
ZhangJ. P.WangG. W.TianX. H.YangY. X.LiuQ. X.ChenL. P.et al (2015). The genus carpesium: a review of its ethnopharmacology, phytochemistry and pharmacology. J. Ethnopharmacol.163, 173–191. 10.1016/j.jep.2015.01.027
54
ZhangR.ZhuX.BaiH.NingK. (2019). Network pharmacology databases for traditional Chinese medicine: review and assessment. Front. Pharmacol.10, 123. 10.3389/fphar.2019.00123
55
ZhangY.JiW.QinH.ChenZ.ZhouY.ZhouZ.et al (2025). Astragalus polysaccharides alleviate DSS-induced ulcerative colitis in mice by restoring SCFA production and regulating Th17/Treg cell homeostasis in a microbiota-dependent manner. Carbohydr. Polym.349 (Pt A), 122829. 10.1016/j.carbpol.2024.122829
56
ZhaoC.WangF.TangB.HanJ.LiX.LianG.et al (2021). Anti-inflammatory effects of kaempferol-3-O-rhamnoside on HSV-1 encephalitis in vivo and in vitro. Neurosci. Lett.765, 136172. 10.1016/j.neulet.2021.136172
57
ZhaoM.ChuJ.FengS.GuoC.XueB.HeK.et al (2023). Immunological mechanisms of inflammatory diseases caused by gut microbiota dysbiosis: a review. Biomed. Pharmacother.164, 114985. 10.1016/j.biopha.2023.114985
Summary
Keywords
Carpesium abrotanoides, ulcerative colitis, network pharmacology, inflammation, apoptosis, tight junction
Citation
Kim A, Kim SY, Jo K, Son E, Kim C-S, Kim D-S, Hwang Y-H and Lee YM (2025) Carpesium abrotanoides ethanol extract alleviates dextran sulfate sodium-induced ulcerative colitis by suppressing inflammation and apoptosis. Front. Pharmacol. 16:1672111. doi: 10.3389/fphar.2025.1672111
Received
29 July 2025
Accepted
03 September 2025
Published
29 September 2025
Volume
16 - 2025
Edited by
Annalisa Chiavaroli, University of Studies G.d'Annunzio Chieti and Pescara, Italy
Reviewed by
Caiyun Huang, Fujian agriculture and Forestry University, China
Beibei Zhang, Henan University of Chinese Medicine, China
Updates
Copyright
© 2025 Kim, Kim, Jo, Son, Kim, Kim, Hwang and Lee.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yun Mi Lee, candykong@kiom.re.kr
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.