BRIEF RESEARCH REPORT article

Front. Vet. Sci., 15 January 2025

Sec. Parasitology

Volume 11 - 2024 | https://doi.org/10.3389/fvets.2024.1527193

Molecular detection of Trypanosoma minasense in captive black-faced black spider monkeys Ateles chamek (mammalia; primate)

  • 1. Graduate Program in Biosciences and Biotechnology, Instituto Carlos Chagas, Fundação Oswaldo Cruz, Curitiba, Paraná, Brazil

  • 2. Curitiba City Secretary of Health, Curitiba, Paraná, Brazil

  • 3. Curitiba City Secretary of Environment, Curitiba, Paraná, Brazil

  • 4. Laboratory of Trypanosomatid Biology, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Rio de Janeiro, Brazil

  • 5. Department of Veterinary Medicine, Federal University of Paraná, Curitiba, Paraná, Brazil

Abstract

The present study aimed to assess Trypanosoma spp. infection in 17 captive black-faced black spider monkeys (Ateles chamek), living at the Zoological Garden of Curitiba, Paraná, Brazil. Blood samples (3 mL) were collected by femoral puncture by certified veterinarians. A total of 5 μL of extracted blood DNA was submitted to Nested-PCR 18S rDNA. In overall, 4/17 (23.5%) spider monkeys were positive to Trypanosoma spp. by PCR. Sequencing results for 18S rDNA revealed Trypanosoma minasense infection. This is the first report of T. minasense in black-faced black spider monkey worldwide and the first assessment of Trypanosoma species in NHP of southern Brazil.

1 Introduction

Non-human primates (NHPs) may be infected and participate in transmission cycle of zoonotic pathogens, as reported for rabies virus (1), Leishmania spp. (2), Yellow fever (3), Mayaro fever (4), and Trypanosoma spp. (5). Due to the phylogenetic proximity with humans and increased interaction with humans and vectors in periurban and urban areas (6), NHP infections by Trypanosoma spp. have been assessed in rural and periurban areas, along with wildlife centers and zoological gardens (6).

NHPs have been considered as sylvatic hosts of Trypanosoma spp. in South America, particularly of Trypanosoma cruzi, the protozoan agent of Chagas disease (5). T. cruzi infection has been reported in both free-ranging and captive primates of Brazil, including 17/26 (65.4%) primates from the Brasília Zoo, central-western region (7), 14/112 (12.5%) from Amapá, Pará, and Amazonas states, northern Brazil (8). A high diversity of natural trypanosome infection has been indicated in the Brazilian Amazon, with 22/46 (47.8%) NHPs infected by T. cruzi, T. minasense, T. devei and T. rangeli at the National Center of Primates, Pará State (5). In addition, 2/38 (5.3%) free-ranging and captive primates from the Mato Grosso State, central-western Brazil, were positive to T. minasense and T. rangeli (9). T. minasense has been considered one of the most common and highly specific parasites of NHP hosts, reportedly presenting low and persistent parasitemia (10). In addition, T. minasense has been identified as a primitive Trypanosoma species, with highly similar 18S rRNA to T. grayi and T. avium, respectively reptile and avian parasites (10).

Trypasonoma spp. infection in captive NHPs may contribute to infection and spreading in non-endemic areas, besides the potential zoonotic source for handling keepers, biologists and veterinarians (7). Accordingly, the present study aimed to assess and identify Trypanosoma spp. infection in a colony of captive, black-faced black spider monkeys (Ateles chamek) kept at the Zoological Garden of Curitiba, southern Brazil.

2 Method

2.1 Ethical statement

This study has been approved by the Ethics Committee of Animal Use (protocol number 071/2021) at the Federal University of Paraná and included as part of the surveillance activities of the Curitiba City Secretary of Environment.

2.2 Study area

The present study was conducted in the Zoological Garden of Curitiba (25° 33′ 38″ S, 49° 14′ 07″ W), Curitiba, Paraná State, southern Brazil, which kept at the time approximately 2,300 animals of 300 species, distributed across 589,000 square meters (11, 12). Curitiba was ranked at the time the ninth most populated city in Brazil, with estimated population of 1.8 million habitants, presenting the tenth highest Human Development Index (HDI) with 0.783, out of 5,565 municipalities of Brazil (13). Although categorized as a 100% urban area city, Curitiba has been environmentally friendly and frequently ranked as first in sustainability and quality of life in Brazil, with a high green-area ratio throughout more than 40 in-city parks and preservation areas (14). Curitiba has presented a classically humid subtropical highland climate (Köppen: Cfb), with mild winters (average 19°C) and summers (average 25°C) due to low latitude, apart from the typically temperate climate (15).

2.3 Blood samples

Peripheral blood samples (3 mL) of black-faced black spider monkeys (Figure 1) were collected in 2021 by femoral puncture and performed by certified veterinarians, after physical restraint and inhalatory anesthesia with isoflurane (Figure 2). Blood samples were placed into EDTA tubes, separated into aliquots and stored at −20°C until testing.

Figure 1

Figure 2

2.4 Molecular analyses

DNA was extracted from blood using the commercial kit, DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany), following manufacturer instructions.

A total of 5 μL of extracted DNA was submitted to Nested-PCR 18S rDNA as target in two rounds, with 8.5 uL of commercially available enzyme (Go Taq Master Mix Promega, Madison, WI, USA) used for the reaction, a premixed ready-to-use solution containing bacterially derived Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers (16). A 0.5 μL volume of commercially available primers (Eurofins Genomics, Louisville, KY, USA) TRY R (5’CTACTGGGCAGCTTGGA3’) and F (5’GAAACAAGAAAC ACGGGAG3’) were used in the first round, and 0.5 μL of SSU R (5’CTGAGACTGTAACCTCAAAGC3’) and F (5’TGGGATAACAAA GGAGCA3’) in the second round. For the second round, 5 μL of amplified DNA with 1:10 of concentration was used. Both rounds were completed with 30 cycles, initial denaturation at 95°C for 3 min, followed by 30 cycles at 94°C for 30 s, 55°C for 60 s, 72°C for 90 s, 72°C for 10 min and kept at 4°C.

Amplified samples were purified using a commercial kit and Gel Band Purification (Illustra GFX PCR DNA GE Healthcare, Illinois, EUA), following the manufacturer protocol. Samples were sequenced by the Sanger method with a commercial kit (BigDye Terminator v3.1 Cycle Sequencing, Applied Biosystems, CA, USA) on a commercial sequencer (ABI 3730 DNA, Applied Biosystems, CA, USA) available at the PDTIS/Fiocruz sequencing platform. DNA sequences were analyzed using SeqManTM program 7.0 version (DNASTAR, Madison, Wisconsin, EUA) and BioEdit Sequence Alignment Editor v. 7.225 (17).

2.5 Phylogenetic analysis

The obtained consensus sequences were manually edited using the SeqMan-DNA Star Program and compared for similarity with sequences deposited in the GenBank database from the National Center for Biotechnology Information (NCBI), using the BLAST algorithm (Basic Local Alignment Search Tool). For species identification, the following values were adopted: cover (≥99%), identity (≥99%), and E-value (0.0). Sequence alignment was performed using the muscle method in the MEGA11 program, and the phylogenetic analysis of 18S rDNA gene sequences was performed by maximum likelihood (ML) to confirm the characterization of trypanosomatid species with the Kimura 2-parameter model and Gamma distribution to model evolutionary rate differences among sites [4 categories (+G, parameter = 0.2566)]. The percentage of trees in which the associated taxa clustered together was shown next to the branches of the figure.

The initial tree(s) for heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree was drawn to a scale, with branch lengths measured in the number of substitutions per site. Evolutionary analyses were conducted in MEGA11. To support the branch, ultrafast bootstrapping of 5,000 replications with 1,000 maximum interactions. Representative sequences from GenBank were used for the construction of the phylogenetic tree, among all the sequences obtained in this study.

3 Results

The full population of 17 healthy, black-faced spider monkeys kept at the time in the Zoological Garden of Curitiba were sampled, with 4/17 (23.5%) positive animals by PCR to Trypanosoma spp. infection, including two males and two females, with ages ranging from four to 25 years-old. All sampled animals were born at the Zoological Garden of Curitiba with no historic displacement. Although vertical transmission should be considered, both mothers of sampled animals have died long before samplings herein. Results of 18S rDNA sequencing have shown Trypanosoma minasense infection, confirmed by BLAST algorithm and deposited at GenBank (numbers PQ038845; PQ038846; PQ038847; PQ038848). A phylogenetic tree based on 18 S rRNA gene sequences was constructed (Figure 3). Mutations were considered synonymous, as the percentage of identity between the sequences obtained and the sequences deposited at NCBI presented nearly 100% identity (PQ038845 - Identity: 99.56%; PQ038846 - Identity: 99.64%; PQ038847 - Identity: 99.45%; PQ038848 - Identity: 99.11%).

Figure 3

4 Discussion

This is the first report of T. minasense in black-faced black spider monkeys worldwide and the first study accessing Trypanosoma species in NHP of southern Brazil.

In the present study, all positive primates were infected by T. minasense, trypanosomatid from Megatrypanum subgenera reported to infect several monkey families in South America (18). In Brazil, previous studies have shown natural infection by T. minasense in approximately 30 different Neotropical primates, including Callithrix penicillata jordani and Callithrix geoffroyi in southern (19), Callithrix penicillata trapped in southeastern (20), Callithrix geoffroyi (19), Saimiri sciureus in northern (21), Sapajus paella in central-western (9), and Alouatta caraya in southeastern Brazil (22). T. minasense was also previously detected in NHP of Brazilian botanical gardens and conservation institutions, including Callithrix spp. from Rio de Janeiro, southeastern region (23), and different species kept at the National Center of Primates, Pará State, northern Brazilian region (5). Infection of T. minasense was also reported in other South American countries, including Alouatta caraya in Argentina (24), Alouatta palliata in Costa Rica (25) and Leontocebus weddelli in Peru (26). Although very frequent in NHP from different geographical areas, the mode of transmission and potential vectors of T. minasense are still unknown (27).

Trypanosoma minasense has been classified as a primitive and non-pathogenic species, being commonly detected in NHP (28). As T. minasense may not be able to infect blood-sucking triatomines, information about which vectors could be involved or other transmission routes remains unclear (28). As primate hosts of T. minasense have been primarily arboreal, arboreous insects have been indicated as potential vectors (27). No clinical signs have been observed in naturally infected primates (29), nor human infection by T. minasense reported to date (20). All sampled animals herein were born in captivity at the Zoological Garden of Curitiba, excluding the possibility of previous or outside infection. Thus, the ecological environment in which the Zoological Garden of Curitiba is inserted, enable T. minasense transmission, either associated to an unknown vector or even derived from direct contact between these NHP. In addition, insects and other potential vectors should be further investigated by entomological surveillance and molecular testing, to fully establish T. minasense spreaders and reservoirs.

Herein, Trypanosoma spp. infection, including by T. minasense, was reported for the first time in spider monkeys. The black-faced black spider monkey has been currently classified as Endangered by the International Union for Conservation of Nature (30), mostly related to hunting and habitat loss due to agricultural expansion, with 50% decline in population over the past 45 years (30). In Brazil, this species has been distributed within transitional regions among Amazonia, Cerrado and Pantanal biomes (31). As previously suggested for different NHP species, the overall absence of clinical signs and low or null levels of pathogenicity have not itself supported additional risks and parasite impact on NHP species (23, 32), including the spider monkey population surveyed herein.

Although T. minasense has been classified as a primitive and non-pathogenic species commonly detected in NHP, the transmission routes and consequences for coinfection with Trypanosoma cruzi remain unclear. Thus, surveillance of Trypanosoma spp. infection should be always considered in both captive and free-range non-human primates to establish such transmission routes, besides host and vector species involved.

Statements

Data availability statement

The datasets generated for this study can be accessed in GenBank nucleotide database (NCBI repository) under the following numbers; PQ038845, PQ038846, PQ038847 and PQ038848.

Ethics statement

The animal study was approved by this study has been approved by the Ethics Committee of Animal Use (protocol number 071/2021) at the Federal University of Paraná. The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

LK: Conceptualization, Data curation, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing. AP: Conceptualization, Data curation, Investigation, Methodology, Writing – review & editing. MB: Investigation, Methodology, Writing – review & editing. VM: Conceptualization, Data curation, Investigation, Methodology, Writing – review & editing. AB: Formal analysis, Investigation, Methodology, Validation, Writing – review & editing. AR: Formal analysis, Investigation, Methodology, Supervision, Validation, Writing – review & editing. FF: Conceptualization, Funding acquisition, Investigation, Methodology, Resources, Supervision, Writing – review & editing. ABi: Conceptualization, Investigation, Methodology, Writing – review & editing.

Funding

The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This research was funded by FAPERJ, grant number E-26/010.002276/2019.

Acknowledgments

The authors would like to thank the Curitiba Zoological Garden and City Hall of Curitiba that allowed this work to be performed.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The authors declare that no Gen AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1.

    KotaitIOliveiraRNCarrieriMLCastilhoJGMacedoCIPMCPet al. Non-human primates as a reservoir for rabies virus in Brazil. Zoonoses Public Health. (2019) 66:47–59. doi: 10.1111/zph.12527

  • 2.

    MaltaMCCTinocoHPXavierMNVieiraALSCostaÉASantosRL. Naturally acquired visceral leishmaniasis in non-human primates in Brazil. Vet Parasitol. (2010) 169:193–7. doi: 10.1016/j.vetpar.2009.12.016

  • 3.

    TranquilinMVLehmkuhlRCMaronÂDaSLRZiliottoLSekiMCet al. First report of yellow fever virus in non-human primates in the state of Paraná, Brazil. Rev Soc Bras Med Trop. (2013) 46:522–4. doi: 10.1590/0037-8682-0106-2013

  • 4.

    CeloneMOkechBHanBAForsheyBMAnyambaADunfordJet al. A systematic review and meta-analysis of the potential non-human animal reservoirs and arthropod vectors of the Mayaro virus. PLoS Negl Trop Dis. (2021) 15:e0010016. doi: 10.1371/journal.pntd.0010016

  • 5.

    ZiccardiMLourenço-De-OliveiraRLainsonRBrígidoMCMunizJA. Trypanosomes of non-human primates from the National Centre of Primates, Ananindeua, state of Pará, Brazil. Mem Inst Oswaldo Cruz. (2000) 95:157–9. doi: 10.1590/S0074-02762000000200004

  • 6.

    ChavesAdel CarmenV-SMAyalaJRSChavesÓMBicca-MarquesJCSolórzano-GarcíaBet al. Neotropical Primates and humans: risk of bidirectional parasite transmission and disease sharing in fragmented and pristine landscapes In: Acosta-JamettGChavesA, editors. Ecology of wildlife diseases in the Neotropics. Cham: Springer International Publishing (2024). 213–53.

  • 7.

    Minuzzi-SouzaTTCNitzNKnoxMBReisFHagströmLCuba CubaCAet al. Vector-borne transmission of Trypanosoma cruzi among captive Neotropical primates in a Brazilian zoo. Parasit Vectors. (2016) 9:39. doi: 10.1186/s13071-016-1334-7

  • 8.

    BahiaMde Nazaré Leite BarrosFMagalhães-MatosPCde Souza GonçalvesTChiesorin NetoLDCLOFet al. Trypanosoma cruzi infection in captive Neotropical primates in the Brazilian Amazon. Am J Primatol. (2017) 79:1–6. doi: 10.1002/ajp.22590

  • 9.

    CândidoSLPaveleginiLADPacheco T dosAPacheco R deCDe BSVLMorgado TOet al. Molecular detection of trypanosomatids in neotropical primates in the state of Mato Grosso, Midwest, Brazil. Rev Bras Parasitol Vet. (2021) 30:e001321. doi: 10.1590/s1984-29612021041

  • 10.

    HoareCA. The trypanosomes of mammals: a zoological monograph. Oxford: Blackwell Scientific Publications (1973).

  • 11.

    CuritibaPDe. (2024). Zoológico Municipal de Curitiba. Available at: . (https://www.curitiba.pr.gov.br/locais/zoologico-municipal-de-curitiba/1572)

  • 12.

    CuritibaPDe. (2024). Zoológico de Curitiba. Available at: . (https://www.curitiba.pr.gov.br/conteudo/zoologico-de-curitiba/3300)

  • 13.

    IBGE. (2024). Cidades e Estados. Available at: . (https://www.ibge.gov.br/cidades-e-estados/pr/curitiba.html)

  • 14.

    CuritibaPDe. (2024). Parques e Bosques - Endereços e Horários. Available at: . (https://www.curitiba.pr.gov.br/servicos/parques-e-bosques-enderecos-e-horarios/782)

  • 15.

    CuritibaPDe. (2024). Perfil da Cidade de Curitiba. Available at: . (https://www.curitiba.pr.gov.br/conteudo/perfil-da-cidade-de-curitiba/174)

  • 16.

  • 17.

    Software Informer. (2024). BioEdit. Get the software safely and easily. Available at: . (https://bioedit.software.informer.com/7.2/)

  • 18.

    ZiccardiMLourenco-de-OliveiraR. Polymorphism in trypomastigotes of Trypanosoma (Megatrypanum) minasense in the blood of experimentally infected squirrel monkey and marmosets. Mem Inst Oswaldo Cruz. (1999) 94:649–53. doi: 10.1590/S0074-02761999000500016

  • 19.

    DeaneLMda SilvaJELouresFL. Nycthemeral variation in the parasitaemia of Trypanosoma minasense in naturally infected marmosets of the genus Callithrix (primates, Callithricidae). Rev Inst Med Trop Sao Paulo. (1974) 16:1–6. PMID:

  • 20.

    de ResendeDMPereiraLHLôboA. Long-term patency of blood parasitism by Trypanosoma minasense and microfilariae in Callithrix penicillata marmosets (Primates, Callitrichidae), caught at the wild and maintained in captivity. Mem Inst Oswaldo Cruz. (1994) 89:127–8. doi: 10.1590/S0074-02761994000100025

  • 21.

    ZiccardiMLourenço-de-OliveiraR. Morphological features of trypanosomes from squirrel monkeys from the Brazilian Amazon. Mem Inst Oswaldo Cruz. (1998) 93:301–1. doi: 10.1590/S0074-02761998000100010

  • 22.

    TenórioMSOliveira e SousaLAlves-MartinMFPaixãoMSRodriguesMVStarke-BuzettiWAet al. Molecular identification of trypanosomatids in wild animals. Vet Parasitol. (2014) 203:203–6. doi: 10.1016/j.vetpar.2014.02.010

  • 23.

    CoimbraDPPenedoDMSilvaMOMAbreuAPMSilvaCBVeronaCEet al. Molecular and morphometric identification of Trypanosoma (Megatrypanum) minasense in blood samples of marmosets (Callithrix: Callithrichidae) from the city of Rio de Janeiro, Brazil. Parasitol Int. (2020) 75:101999. doi: 10.1016/j.parint.2019.101999

  • 24.

    MartínezMFKowalewskiMMSalomónODSchijmanAG. Molecular characterization of trypanosomatid infections in wild howler monkeys (Alouatta caraya) in northeastern Argentina. Int J Parasitol Parasites Wildl. (2016) 5:198–206. doi: 10.1016/j.ijppaw.2016.05.001

  • 25.

    ChinchillaMTroyoAGuerreroOMGutiérrez-EspeletaGASánchezR. Presencia de Trypanosoma minasense (Kinetoplastida: Trypanosomatidae) en Alouatta palliata (Primates: Cebidae) de Costa Rica. Parasitol Latinoam. (2005) 60:90–2. doi: 10.4067/S0717-77122005000100017

  • 26.

    ErkenswickGAWatsaMGozaloASDmytrykNParkerPG. Temporal and demographic blood parasite dynamics in two free-ranging neotropical primates. Int J Parasitol Parasites Wildl. (2017) 6:59–68. doi: 10.1016/j.ijppaw.2017.03.004

  • 27.

    DunnFLLambrechtFLDuplessisR. Trypanosomes of south American monkeys and marmosets. Am J Trop Med Hyg. (1963) 12:524–34. doi: 10.4269/ajtmh.1963.12.524

  • 28.

    ZiccardiMLourenço-de-OliveiraRNogueiraR. The haemoculture of Trypanosoma minasense chagas, 1908. Mem Inst Oswaldo Cruz. (1996) 91:501–5. doi: 10.1590/S0074-02761996000400019

  • 29.

    Rovirosa-HernándezMJLópez-MonteonAGarcía-OrduñaFTorres-MonteroJGuzmán-GómezDDumonteilEet al. Natural infection with Trypanosoma cruzi in three species of non-human primates in southeastern Mexico: a contribution to reservoir knowledge. Acta Trop. (2021) 213:105754. doi: 10.1016/j.actatropica.2020.105754

  • 30.

    IUCN. (2024). IUCN Red list of threatened species. Available at: . (https://www.iucnredlist.org/es)

  • 31.

    Dos Santos-FilhoMBernardoCSSVan der Laan BarbosaHWGusmãoACJerusalinskyLCanaleGR. A new distribution range of Ateles chamek (Humboldt 1812) in an ecotone of three biomes in the Paraguay River basin. Primates. (2017) 58:441–8. doi: 10.1007/s10329-017-0601-3

  • 32.

    Carrillo-BilbaoGNavarroJCMartin-SolanoSChávez-LarreaMACholota-IzaCSaegermanC. First molecular identification of trypanosomes and absence of Babesia sp. DNA in faeces of non-human Primates in the Ecuadorian Amazon. Pathogens. (2022) 11:1490. doi: 10.3390/pathogens11121490

Summary

Keywords

captive primates, blood parasites, molecular analysis, non-human primates, Trypanosoma spp.

Citation

Kmetiuk LB, Passerino ASM, Bonat M, Morikawa VM, Berbigier AP, Roque ALR, Figueiredo FB and Biondo AW (2025) Molecular detection of Trypanosoma minasense in captive black-faced black spider monkeys Ateles chamek (mammalia; primate). Front. Vet. Sci. 11:1527193. doi: 10.3389/fvets.2024.1527193

Received

13 November 2024

Accepted

30 December 2024

Published

15 January 2025

Volume

11 - 2024

Edited by

Yadong Zheng, Zhejiang Agriculture and Forestry University, China

Reviewed by

Benjamin Cull, University of Minnesota Twin Cities, United States

Catalina Avendano, Beckmaan Research Institute, City of Hope, United States

Updates

Copyright

*Correspondence: Fabiano Borges Figueiredo, Alexander Welker Biondo,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics