Role of wild birds in the circulation of Toxoplasma gondii in Southern Italy: molecular and epidemiological insights

Introduction: Toxoplasmosis is caused by the protozoal parasite Toxoplasma gondii and can be acquired through the consumption of food and water contaminated with sporulated oocysts and tissue cysts. The parasite is characterized by high host flexibility, being able to infect all warm-blooded animals, including birds and mammals. Wild birds are considered important reservoirs of infectious agents, some of which possess zoonotic potential. To date, few data are available on the role of these animals in the transmission of T. gondii, especially in the Italian Peninsula.

Methods: To address this gap, the present study investigated the circulation and genetic diversity of this parasite in various wild bird species, with the aim to assess the role of avian hosts in the epidemiology of the parasite. In 2023–2024, 256 carcasses belonging to 39 different wild bird species were collected in Campania and Calabria Regions and analyzed to assess the presence of T. gondii in the animal tissues.

Results: Out of 256 birds, 15 (5.9%) resulted positive for parasite DNA: 6 (40.0%) belonged to genotype GII and 1 (6.6%) to genotype GIII. Interestingly, 11/15 (73.3%) infected animals were non-migratory species and 10/15 (66.7%) were classified as omnivore/scavenger wild birds.

Discussion: Monitoring and genotyping T. gondii in birds could help to understand the environmental spread of oocysts. What's more, given the remarkable ecological diversity of wild avian species (different feeding habits and migratory behavior), surveillance of avian populations could deepen our understanding of T. gondii transmission dynamics and implement public health interventions and environmental management strategies.

1 Introduction

Toxoplasma gondii (phylum Apicomplexa, family Sarcocystidae) is an obligatory intracellular protozoan causing toxoplasmosis (1). The parasite can infect a wide group of warm-blooded animals (including humans) inducing a widespread infectious disease with medical and veterinary importance worldwide (2–4). In Europe, prevalence varies between species and regions being also influenced by rearing (indoor/outdoor) (5). Higher prevalences were found in Eastern Europe compared to Northern Europe and in outdoor-kept animals (5). In small ruminants, especially goats and sheep, there is a widespread distribution of T. gondii, reaching seroprevalence values of 93.7%−98.4% in a study conducted in Spain (6). In these animals, the parasite causes reproductive disorders, abortion, congenital malformation and stillborn (6–8). The life cycle of T. gondii is characterized by sexual reproduction, involving definitive hosts such as cats and other felids, and asexual reproduction, occurring in intermediate hosts such as mammals and birds (9, 10). The parasite had been previously classified into three predominant lineages, known as types I, II and III. Type I strains are highly virulent, whereas type II and type III are relatively nonvirulent (11). Subsequently, through new genotyping techniques and the use of a greater number of genetic markers, several new and atypical genotypes have been identified (12, 13). However, archetypal haplotypes, identified as genotypes I, II and III still play a central role in genotyping as they provide a stable phylogenetic reference for placing new isolates (14, 15). Clonal haplotypes, moreover, have biological and clinical value, as they are associated with differences in virulence and pathogenicity, and serve as reference markers to identify any recombination or atypical lineage (15, 16). Genotypes I and III, in particular, are widespread in Europe and North America. This is likely due to the combination of specific alleles during recombination, providing a selective advantage to these genotypes (17). T. gondii infection can occur through ingestion of water and vegetables contaminated with sporulated oocysts, unpasteurised milk containing tachyzoites, or raw/undercooked meat with pseudocysts (18). The consumption of fresh meat and meat products indeed represents an important source of human infection (19). Food and Agriculture Organization of the United Nations (FAO) classified toxoplasmosis among the 10 most important foodborne diseases of the world (20). In humans, toxoplasmosis is asymptomatic in immunocompetent people but can cause severe and fatal symptoms in immunosuppressed patients and in the fetus of pregnant women (9, 21). A high circulation and prevalence of T. gondii in intermediate hosts, both farmed animals and wildlife, has already been widely documented in Southern Italy (20, 22–24). In a study conducted between 2020 and 2022 in Campania region, T. gondii was detected in various wild mammal species with a non-negligible overall prevalence of 21.8% (n = 46/211) (20). In another study T. gondii DNA was found in the tissues of 78/177 (44%) wild boars examined (23). The seroprevalence of the parasite in livestock has been evaluated in a study conducted on sheep farms, in which 91 out of 117 (77.8%) farms tested had at least one animal IgG positive (15). In another study carried out on water buffaloes, 17 out of 124 (13.7%) animals tested positive for T. gondii IgG (17). To date, limited information is available on the potential role of wild birds in the spread of T. gondii infection. These animals due to their high dispersal capability and high ecological plasticity, are important reservoirs of infectious agents and play a crucial role in the spread and transmission of pathogens, some of which possess zoonotic potential (25–28). Indeed, these animals are frequently involved in the transmission cycles of various viruses, such as West Nile virus (26) and avian influenza viruses (25), as well as of parasites (27, 28). Birds may therefore represent a group at considerable risk for T. gondii infection and could act as a key link in the parasite's transmission, given their wide ecological distribution, diverse feeding habits, and role as prey for multiple predators (29). With respect to feeding habits, recent molecular studies interestingly showed that insect physiology can vary considerably (30, 31), and these variations may influence ecological interactions between insects and their predators, including insectivorous birds, potentially affecting the birds' exposure to T. gondii. Additionally, the availability and abundance of insect prey can strongly modulate these interactions, as insectivorous birds rely on fluctuations in insect populations for feeding and reproductive success (32). The coexistence of migratory and resident species further enhances their epidemiological relevance: while migratory birds can disseminate the parasite over long distances, potentially introducing T. gondii into previously uninfected areas, resident species may function as indicators of local environmental contamination, reflecting ongoing transmission dynamics within a specific ecosystem (29, 33–35). To date, few molecular studies were conducted on T. gondii infection in wild birds especially in Southern Italy. Furthermore, knowledge about the circulating genotypes and ecological host factors is limited. Therefore, the aim of the present study was to investigate, the presence of Toxoplasma gondii in wild birds collected in Southern Italy. Further genotyping was carried out with the scope to characterize the circulating parasite variants. In addition, the likely influence of feeding habits and migratory behavior of wild birds on T. gondii infection was investigated, considering the hypothesis that parasite exposure could be somehow influenced by birds' lifestyle.

2 Materials and methods

2.1 Study area and sampling

No approval from ethical committee was required, as all sampling procedures were run under the frame of a regional plan for wildlife surveillance (authorization no. DD 210-B7 DPAR), according to EU and National legislations. A total of 256 wild bird carcasses were collected between January 2023 and December 2024, from provinces of Campania (228) and Calabria (28) regions (Southern Italy). The two regions extend from 0 to 1,890 meters above sea level and are mainly characterized by hilly landscape and typical Mediterranean climate, with dry summers and rainy winters (22). All the carcasses (except crows) were found on the road following citizens' sighting and collected by veterinary practitioners involved in the regional plan; the crows came instead from regular hunting activities. All the carcasses were delivered at the Istituto Zooprofilattico Sperimentale del Mezzogiorno (Italy) for a complete necropsy examination, according to the regional plan for wildlife surveillance. For each animal, brain, heart, and skeletal muscle samples were collected with sterile scalpels, placed in sterile tubes, and stored at−20 °C for subsequent molecular investigations. Data on each bird's sex and species was recorded, and age was determined based on plumage (36). All the carcasses were identified at species level through the evaluation of anatomical features assessed by a veterinary practitioner specialized in avian pathology. In detail, 247 birds were adults (96.5%) and 9 juveniles (3.5%). Among the 256 specimens, 129 were males (51.4%) and 127 were females (49.6%). Furthermore, information on bird principal feeding habits was recorded. The 256 wild birds belonged to 39 species, of which 168 (65.6%) were non-migratory and 88 (34.3%) were migratory (Table 1).

Table 1

Table 1. Wildlife avian species investigated (39 in total).

2.2 Nucleic acids extraction procedures

Preliminary experiments were carried out with the aim of establishing the most efficient extraction procedure. For the scope, different sample quantities (25, 50 and 100 mg) were homogenized with phosphate-buffered saline (PBS) solution or ATL solution (Qiagen GmbH, Hilden, Germany). Prior to extraction a pretreatment stage of the homogenate (500 μl) with 20 μl of a 20 mg/ml proteinase K solution (Qiagen GmbH, Hilden, Germany) was also carried out. For the scope, the sample was incubated at two different temperatures (56 or 70 °C) for 20 min prior to extraction. The best results were obtained with 25 mg of sample homogenized in PBS by Tissue Lyser (Qiagen GmbH, Hilden, Germany) and directly (without pretreatment) extracted. All the successive experiments were therefore performed following preliminary results. Accordingly, each sample was inserted in a 2 ml Eppendorf safe-lock tube containing 1 ml PBS and a 4.8-mm stainless steel bead. Mechanical lysis was carried out at 30 Hz for 5 min; this step was followed by sample centrifugation at 2,000–4,000 rpm for 15 min to pellet the debris. Nucleic acids were extracted from 200 μl homogenate using QIAsymphony automated extraction system (Qiagen GmbH, Hilden, Germany) with the DSP Virus/Pathogen Mini kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer's instructions and eluted in 80 μl elution buffer. A sample made with 200 μl PBS was used as a negative process control (NPC). Furthermore, an external positive process control (EPC), murine norovirus, was spiked into each sample (including NPC) prior to extraction, and used to evaluate PCR inhibitors (37). Murine norovirus amplification results were interpreted as follows: if the threshold cycle (Ct) of the EPC in the eluted sample was comparable to that of the EPC in the NPC, the sample was further analyzed as undiluted. If, instead, the difference between the two Cts was at least three or a multiple of three, all the analyses were carried out on the sample diluted 1:10 or more (considering one decimal dilution every three threshold cycles of difference).

2.3 Real-time PCR for detection of Toxoplasma gondii

Molecular detection of T. gondii was carried out by a protocol identifying a small fragment of the B1 gene. The reaction was performed on a QuantStudio five Real-Time PCR thermal cycler (Thermo Fisher Scientific, Waltham, Massachusetts, USA) in a total volume of 25 μl containing 5 μl DNA extracted, 12.5 μl Universal Master Mix PCR 1X (Thermo Fisher Scientific, Waltham, Massachusetts, USA), 1 μl (12.5 μM) forward primer (TOXO-For 5′- TCCCCTCTGCTGGCGAAAACT 3′), 1 μl (12.5 μM) reverse primer (TOXO-Rev 5′-AGCGTTCGTGGTCAACTATCGATTG3′) and 0.5 μl (10 μM) probe TOXO-P (FAM5′-TCTGTGCAACTTTGGTGTATTCGCAG3′-TAMRA) (23). The thermal profile used was the following: initial denaturation at 95 °C for 15 min, 45 cycles of 95 °C for 15 s and 60 °C for 60 s.

2.4 Genotyping analysis of Toxoplasma gondii

Genetic characterization of T. gondii in positive samples was performed by Multiple Locus Variable Number of Short Tandem Repeats analysis (MLVA), based on the amplification of five microsatellite (MS) markers (TUB2, W35, TgM-A, B18 and B17) by multiplex PCR assay (38). This technique, is indeed more sensitive than PCR-RFLP and shows a higher level of resolution in detecting genetic diversity among genetically closely related T. gondii isolates (14, 16, 39, 40). Furthermore, STR analysis is faster than multilocus sequencing studies, which are time-consuming and unsuitable for a large set of isolates (38). In the end, STR typing represents the current reference method for T. gondii molecular characterization, thus allowing comparisons between strains collected from different geographical areas or animal species (41). PCR was performed in a 25 μl reaction mixture consisting of 12.5 μl of 2X Qiagen Multiplex PCR Master Mix (Qiagen, Hilden, Germany), 5 μl of Q solution 1X and 0.04 μM of each primer. Five microliters of the DNA from the positive samples were added to the reaction mixture. DNA from ATCC strains, PTG strain Type II (ATCC: 50941), CTG Type III (ATCC: 50842) and MAS atypical strain (ATCC: 50870), already genotyped previously (42) were used as positive controls. In each PCR reaction a negative control was added, represented by Rnase/Dnase free water (NC). Amplification was carried out in a SimpliAmp Touch thermal cycler (ThermoFisher Scientific, Waltham, MA, USA) and consisted of an initial denaturation at 95 °C for 15 min followed by 45 cycles consisting of 94 °C for 30 s, 55 °C for 3 min and 72 °C for 60 s. The last extension step was carried out at 60 °C for 30 min. One microliter of PCR product was mixed with 0.3 μl of LIZ 500 Standard Size and 13.7 μl of HIDi Formamide. The mixture was then denatured for 5 min at 95 °C and resolved by capillary electrophoresis with an ABI PRISM 3500 genetic analyzer (ThermoFisher Scientific, Waltham, MA, USA), equipped with a 50 cm long capillary filled with POP-7 separation medium. Analysis of the microsatellite fragments was carried out using GeneMapper software v5.0. The minimum fluorescence threshold for valid peaks was set at 200 RFU.

2.5 Statistical analysis

Exact binomial 95% confidence intervals (95% CIs) by Wilson's method were calculated for the proportions of infection herein found. A chi-square test (χ²) was used to assess any statistical difference in the frequency of infection, based on bird's species (migratory/non-migratory), age (juvenile/adult), sex, geographical origin and feeding habits. Considering the different diets of the wild birds, a statistical analysis was carried out grouping the species in two categories based on their principal feeding habits: “meat consumers” which included: omnivore, carnivore, piscivore, omnivore/scavenger, carnivore/scavenger, omnivore/granivore and non-meat consumers including: insectivore, herbivore, granivore, insectivore/granivore, insectivore/frugivore. The value of p < 0.05 was considered statistically significant. The Odds ratio (OR) was used to verify difference of infection risk according to the geographical origin of birds. Statistical analyses were performed by using the online software Epitools-Epidemiological Calculators (43). The distribution of T. gondii-positive birds in the study area was obtained with QGIS software (version 3.34.10-Prizren LTR).

3 Results

Out of 256 bird specimens analyzed, 15 (i.e., 5.9%, 95% CI: 3.6–9.4) resulted positive for T. gondii DNA, with Ct values ranging between 32.5 and 37. Parasite DNA was detected in the heart and muscle of 9 infected animals and in the brain of five birds. Furthermore, it was found in more than one tissue in seven of the 15 infected animals (46.6%; see Table 2). Parasite genotyping, carried out by MLVA characterization, assigned 6/15 (40%) T. gondii as belonging to GII genotype, 1/15 (6.6%) to GIII genotype. In eight animals, T. gondii was not characterized probably due to the poor quality or quantity of the genetic material. As shown in Figure 1, positive birds were distributed across the study area, with 14/15 (93.3%) animals from Campania Region and 1/15 (6.7%) from Calabria Region. With respect to species, T. gondii was found in 6/58 Pica pica (10.3%), 4/86 Corvus corone (4.6%), 1/4 Cairina moschata (25.0%), 1/4 Athene noctua (25.0%), 1/2 Falco tinnunculus (50.0%), 1/18 Garrulus glandarius (5.5%) and 1/2 Podiceps cristatus (50.0%; Table 3). The 15 infected birds were all adults, eight of which males (53.3%) and seven females (46.7%). Interestingly, most of the positive birds (11/15, 73.3%) belonged to non-migratory species. Furthermore, when looking at their feeding habits, all were meat-consumers and 10/15 (66.7%) were omnivore/scavengers. Statistical analyses, reported in Table 4, revealed no significant difference in T. gondii prevalence with respect to migratory behavior (p = 0.520), principal feeding habits (p = 0.167), sex (p = 0.450), age (p = 0.450), and geographical origin (p = 0.970). No significant difference (p = 0.187) was also observed when comparing parasite prevalence in the two wild bird species most frequently collected (C. corone, n = 86; P. pica, n = 58). A higher infection risk was however found in adult birds compared to juvenile ones (OR = 5.8) and in “meat consumers” compared to the “non-meat consumers” (OR = 6.4).

Table 2

Table 2. Prevalence of Toxoplasma gondii in the tissues investigated (brain, heart, and skeletal muscle; n = 256).

Figure 1

Figure 1. Toxoplasma gondii-positive birds in Campania (A) and Calabria (B) regions, southern Italy, in 2023–2024.

Table 3

Table 3. Wild birds in which T. gondii DNA was identified.

Table 4

Table 4. Prevalence of Toxoplasma gondii according to migratory behavior, principal feeding habits, sex, age, and geographic origin.

4 Discussion

Our study focused on the detection of T. gondii in wild birds from the provinces of the Campania and Calabria regions (Southern Italy). Molecular investigations revealed a non- negligible positivity rate of 5.9%, which is, however, lower than those reported in the few previous studies on avian species carried out in Italy, particularly in Central and Northern regions (33, 44, 45). An epidemiological investigation performed on wild birds from Central Italy reported serological and molecular prevalences of 11.6% (n = 25/216) and 8.8% (n = 19/216), respectively (33). In a recent study carried out in 2021–2022, a positivity rate of 14% was found on wild waterbirds (44). This difference in molecular prevalence could be related to the species analyzed (39 in our study) as well as to the uneven distribution of cysts in the animal tissues which may determine a casual underestimation of parasite prevalence (46). Higher prevalence rates of T. gondii have been documented in wild bird species more likely to be exposed to infection due to their feeding habits and ecological behavior. For instance, an epidemiological study on wild birds of prey hospitalized in Wildlife Recovery Center (WRCs) in Northern Italy, showed a positivity rate of 62.5% (45). As a matter of fact, raptors can become infected through predation on birds and small mammals, thereby harboring tissue cysts and acting as intermediate hosts within the complex life cycle of the parasite (47–49). In the present study, T. gondii, investigated in 39 wild bird species, was detected with a slightly higher prevalence (6.5%) in non-migratory birds with respect to migratory ones (4.5%), although statistical analysis revealed no significant difference. Migratory species may represent an important potential vector for the spread of infection to new geographic areas, whereas non-migratory ones represent a sentinel of the local environmental contamination. Moreover, non-migratory species living in human-dominated habitats are exposed to higher infection risk due to the elevated density of free-roaming domestic cats and consequent soil contamination (50–53). Recent habitat-ecology studies suggested that urban and anthropogenic landscapes can provide suitable habitats for certain bird species, shaping community composition and favoring species that tolerate human-modified environments (54), thereby increasing their likelihood of encountering contaminated resources. Wild birds investigated, when grouped according to their primary feeding habits, revealed a higher infection risk (OR = 6.4) in the “meat consumers” group compared with the “non-meat consumers.” Interestingly, all 15 infected animals belonged to the “meat consumers” group, and twelve of them belonged to the Corvidae family. Corvids are very versatile and opportunistic in their feeding behavior, acting as scavenger that consume animal carcasses, exploit anthropogenic food waste and prey on live animals (55–57). The susceptibility of these non-migratory birds to T. gondii infection has already been reported in the literature. In an epidemiological survey of 771 wild corvids, (651 magpies and 120 hooded crows Corvus cornix), hunted for faunistic restoration across various areas in Central Italy, 45 birds (41 magpies and four hooded crows) were found positive for anti-T. gondii antibodies (5.8%). Therefore, carnivorous and scavenger species appear to be at higher risk of T. gondii infection, likely influenced by dietary habits (45, 58). In line with Wilson et al. (59), these findings emphasize that feeding ecology is a key determinant of T. gondii exposure risk in wild birds. Our results showed that the parasite was found with interesting prevalence of 10.3% in Eurasian magpies and of 4.6% in crows. Terrestrial carnivores and omnivores, such as magpies and crows, acquire infection through consumption of tissue cysts present in infected vertebrates, whereas herbivores and insectivores are mainly exposed via oocysts in soil, water, or invertebrates (60, 61). Furthermore, opportunistic carnivores with scavenging behavior, (such as magpies and crows, exploit carcasses, anthropogenic food waste, and live prey), thereby increasing the likelihood of exposure to T. gondii (58, 62, 63). Other investigated variables, such as sex and age did not show any statistically significant effect on parasite prevalence, consistent with previous findings (58, 64). Nevertheless, a higher infection risk (OR = 5.8) was observed in adult birds compared to juvenile specimens. This aligns with another study on pet birds, which reported a significantly higher prevalence of T. gondii in adult animals (13.2%) than in juveniles (5.3%; OR = 2.76; p = 0.004) (65).

Regarding T. gondii genetic diversity, MLVA analysis revealed, in the infected birds, the presence of two distinct genotypes: type II (six samples) and type III (one sample). These results are consistent with previous studies reporting the circulating T. gondii genotypes in Europe, where type II and, to a lesser extent, type III strains, dominate in both domestic and wild environments (66–68). The advent of Whole Genome Sequencing (WGS) and single nucleotide polymorphisms (SNPs) analysis improved our knowledge of the genotypic structure and the evolutionary history of T. gondii. Minot et al. (17) used WGS to analyze isolates belonging to major clonal genotypes and atypical strains, mapping thousands of SNPs distributed across the genome and detecting recombination events, genomic mosaics and tissue tropism differences with high resolution. More recent studies, including Joeres et al. (41), further consolidated the use of genome-wide SNPs panels for T. gondii genotyping, applying them to clinical samples and field isolates. Analysis of SNPs allows for more precise definition of phylogenetic relationships between strains and identification of recombinant lineages. However, the routine use of WGS and SNPs analysis remains limited due to high costs, bioinformatics complexity, and the need for high DNA quantities and qualities, often unavailable in clinical samples. Therefore, MLVA analysis still represents the current reference standard for T. gondii genotyping (41), particularly in epidemiological, surveillance and inter-laboratory comparison studies, being a good compromise between discriminating ability, speed, reproducibility and cost, allowing the distinction of closely related isolates even from low amounts of DNA. Interestingly, T. gondii DNA was detected in all analyzed organs, most frequently in the heart and skeletal muscle, consistent with the parasite's known tissue tropism in wild birds (33). The presence of tissue cysts in edible muscles supports the potential for transmission via meat consumption. Wild birds can be therefore a source of infection for felids and other animals that consume many domestic and wild birds as part of their diet (12). As to humans, in this study, T. gondii was found in seven different wild bird species of which, only one is enters human food diet. Interestingly, T. gondii was indeed detected in one of the four Cairina moschata specimens analyzed. Muscovy ducks are non-migratory wild birds whose meat is highly appreciated in several countries for its nutritional qualities (69). Moreover, these birds are valued for their relatively higher breast and leg meat yield, and their lower content of skin and abdominal fat. Therefore, the detection of T. gondii in Cairina moschata is particularly relevant, as this species may enter human food chains, highlighting a potential public health risk associated with the consumption of its meat. Indeed, the consumption of their raw or undercooked meat is considered an important source of human infection in various countries (12, 70–72). According to the literature, there is no scientific evidence of human consumption of meat from the other infected species. Poor palatability, legal restrictions, and religious beliefs may contribute to their limited consumption. Indeed, some wild birds, such as raptors and corvids, are considered mythical, spiritual, and religious symbols in many cultures (73, 74). In addition, these animals are protected by European law (Birds Directive 2009/147/EC), which prohibits their hunting, killing, or consumption (75, 76).

Overall, the present study gives interesting results on T. gondii prevalence and distribution in poorly investigated but with high reservoir potential animals like wild birds. Important bias must be however taken into account: for some species the sample size was small compared to others like corvids. This was due to the fact that animals were collected following a Regional plan (found dead or hunted) and have not been selected upstream. The different sample size of the species investigated thus reflects their different abundance in Campania and Calabria Region (77, 78). Furthermore, due to the challenges encountered during molecular investigations and the poor quality of the genetic material, T. gondii was not characterized in all animals analyzed. A limitation of the present survey, which is also a future perspective, is the focus only toward T. gondii instead of other zoonotic foodborne parasites potentially present in birds, such as Trichinella spp. and Sarcocystis spp., that have been reported to circulate in wild mammals (boars, wolves, foxes) in the same study area (79, 80).

5 Conclusions

In summary, this study highlights the importance of monitoring Toxoplasma gondii and its genotypes in wild birds and shows that the risk of T. gondii infection is likely influenced by these animals' dietary habits. The detection of the parasite in a species consumed by humans further emphasizes the critical role of surveillance within a One Health framework. This integrated perspective is fundamental for the development and implementation of effective strategies to control the spread of T. gondii as well as other zoonotic foodborne parasites.

Data availability statement

The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.

Ethics statement

Ethical approval was not required for the study involving animals in accordance with the local legislation and institutional requirements because the ethical committee was not required since this study was run on carcasses of birds already deceased at the moment of sampling.

Author contributions

FS: Conceptualization, Investigation, Methodology, Writing – original draft, Writing – review & editing. SS: Writing – review & editing. GS: Writing – original draft, Writing – review & editing. MR: Methodology, Writing – review & editing. MB: Writing – review & editing. MP: Formal analysis, Writing – review & editing. SR: Data curation, Formal analysis, Writing – review & editing. ML: Formal analysis, Writing – review & editing. ED: Formal analysis, Writing – review & editing. GB: Methodology, Software, Writing – review & editing. BC: Formal analysis, Writing – review & editing. ND'A: Conceptualization, Funding acquisition, Methodology, Writing – review & editing. VV: Writing – review & editing. GG: Resources, Supervision, Writing – review & editing. OP: Resources, Supervision, Writing – review & editing. GI: Resources, Supervision, Writing – review & editing. MA: Investigation, Methodology, Project administration, Writing – review & editing.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This research was funded by the Italian Ministry of Heath, Project IZSME 06/22.

Acknowledgments

The authors are grateful to the veterinary practitioners involved in the field activities.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The reviewer LZ declared a past co-authorship with the authors GS and MB to the handling editor.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher's note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

1. Delgado ILS, Zúquete S, Santos D, Basto AP, Leitão A, Nolasco S. The apicomplexan parasite Toxoplasma gondii. Encyclopedia. (2022) 2:189–211. doi: 10.3390/encyclopedia2010012

Crossref Full Text | Google Scholar

2. Stock I. Toxoplasmosis. Med Monatsschr Pharm. (2023) 46.

PubMed Abstract | Google Scholar

3. Liu Q, Wang ZD, Huang SY, Zhu XQ. Diagnosis of toxoplasmosis and typing of Toxoplasma gondii. Parasit Vectors. (2015) 8:292. doi: 10.1186/s13071-015-0902-6

PubMed Abstract | Crossref Full Text | Google Scholar

4. Sanchez SG, Besteiro S. The pathogenicity and virulence of Toxoplasma gondii. Virulence. (2021) 12. doi: 10.1080/21505594.2021.2012346

PubMed Abstract | Crossref Full Text | Google Scholar

5. Dámek F, Swart A, Waap H, Jokelainen P, Le Roux D, Deksne G, et al. Systematic review and modeling of age-dependent prevalence of Toxoplasma gondii in livestock, wildlife and felids in Europe. Pathogens. (2023) 12:97. doi: 10.3390/pathogens12010097

Crossref Full Text | Google Scholar

6. Jiménez-Martín D, García-Bocanegra I, Almería S, Castro-Scholten S, Dubey JP, Amaro-López MA, et al. Epidemiological surveillance of Toxoplasma gondii in small ruminants in southern Spain. Prev Vet Med. (2020) 183:105137. doi: 10.1016/j.prevetmed.2020.105137

PubMed Abstract | Crossref Full Text | Google Scholar

7. Ceylan C, Sevinc F, Ceylan O. Serostatus of small ruminant toxoplasmosis and neosporosis throughout the southeastern Anatolia Region of Türkiye. Pak Vet J. (2024) 44:917–23. doi: 10.29261/pakvetj/2024.247

Crossref Full Text | Google Scholar

8. Irshad A, Noreen S, Khan W, Rasool A. Sero-epidemiology, spatial distribution and phylogenetic analysis of Toxoplasma gondii in goats of Malakand division of Pakistan. Pak Vet J. (2024) 44:1–7. doi: 10.29261/pakvetj/2024.152

Crossref Full Text | Google Scholar

9. Ahmed M, Sood A, Gupta J. Toxoplasmosis in pregnancy. Eur J Obstet Gynecol Reprod Biol. (2020) 255:44–50. doi: 10.1016/j.ejogrb.2020.10.003

PubMed Abstract | Crossref Full Text | Google Scholar

10. Puchalska M, Wiśniewski J, Klich D, Gołab E, Jańczak D, Sokołowska J, et al. A serological survey of Toxoplasma gondii in polish pigs from organic farms, other housing systems and in pigs of different age groups. Acta Vet Scand. (2022) 64:3. doi: 10.1186/s13028-022-00623-4

PubMed Abstract | Crossref Full Text | Google Scholar

11. Khan A, Su C, German M, Storch GA, Clifford DB, Sibley LD. Genotyping of Toxoplasma gondii strains from immunocompromised patients reveals high prevalence of type I strains. J Clin Microbiol. (2005) 43:5881–7. doi: 10.1128/JCM.43.12.5881-5887.2005

PubMed Abstract | Crossref Full Text | Google Scholar

12. Galeh TM, Sarvi S, Khalilian A, Hosseini SA, Daryani A. Genetic diversity of Toxoplasma gondii isolates from birds in the world: a systematic review. Exp Parasitol. (2023) 248:108480. doi: 10.1016/j.exppara.2023.108480

PubMed Abstract | Crossref Full Text | Google Scholar

13. Sgroi G, Viscardi M, Santoro M, Borriello G, D'Alessio N, Boccia F, et al. Genotyping of Toxoplasma gondii in wild boar (Sus scrofa) in southern Italy: epidemiological survey and associated risk for consumers. Zoonoses Public Health. (2020) 67:805–13. doi: 10.1111/zph.12762

PubMed Abstract | Crossref Full Text | Google Scholar

14. Blackston CR, Dubey JP, Dotson E, Su C, Thulliez P, Sibley D, et al. High-resolution typing of Toxoplasma gondii using microsatellite loci. J Parasitol. (2001) 87:1472–5. doi: 10.2307/3285322

PubMed Abstract | Crossref Full Text | Google Scholar

15. Su C, Khan A, Zhou P, Majumdar D, Ajzenberg D, Dardé ML, et al. Globally diverse Toxoplasma gondii isolates comprise six major clades originating from a small number of distinct ancestral lineages. Proc Natl Acad Sci U S A. (2012) 109:5844–9. doi: 10.1073/pnas.1203190109

PubMed Abstract | Crossref Full Text | Google Scholar

16. Ajzenberg D, Bañuls AL, Tibayrenc M, Dardé ML. Microsatellite analysis of Toxoplasma gondii shows considerable polymorphism structured into two main clonal groups. Int J Parasitol. (2002) 32:27–38. doi: 10.1016/S0020-7519(01)00301-0

PubMed Abstract | Crossref Full Text | Google Scholar

17. Minot S, Melo MB, Li F, Lu D, Niedelman W, Levine SS, et al. Admixture and recombination among Toxoplasma gondii lineages explain global genome diversity. Proc Natl Acad Sci U S A. (2012) 109:13458–63. doi: 10.1073/pnas.1117047109

PubMed Abstract | Crossref Full Text | Google Scholar

18. Varsa RG, Gica N, Demetrian M, Ciobanu AM, Botezatu R, Gica C, et al. Toxoplasma gondii infection in pregnancy. Rom J Infect Dis. (2021) 24:24–8. doi: 10.37897/RJID.2021.S.5

Crossref Full Text | Google Scholar

19. Condoleo R, Rinaldi L, Sette S, Mezher Z. Risk assessment of human toxoplasmosis associated with the consumption of pork meat in Italy. Risk Analysis. (2018) 38:1202–22. doi: 10.1111/risa.12934

PubMed Abstract | Crossref Full Text | Google Scholar

20. Dakroub H, Sgroi G, D'Alessio N, Russo D, Serra F, Veneziano V, et al. Molecular survey of Toxoplasma gondii in wild mammals of southern Italy. Pathogens. (2023) 12:471. doi: 10.3390/pathogens12030471

PubMed Abstract | Crossref Full Text | Google Scholar

21. Montoya JG, Liesenfeld O. Toxoplasmosis. Lancet. (2004) 363:1965–76. doi: 10.1016/S0140-6736(04)16412-X

PubMed Abstract | Crossref Full Text | Google Scholar

22. Fusco G, Rinaldi L, Guarino A, Proroga YTR, Pesce A, Giuseppina DM, et al. Toxoplasma gondii in sheep from the Campania region (Italy). Vet Parasitol. (2007) 149:271–4. doi: 10.1016/j.vetpar.2007.07.020

PubMed Abstract | Crossref Full Text | Google Scholar

23. Santoro M, Viscardi M, Sgroi G, D'Alessio ND, Veneziano V, Pellicano R, et al. Real-time PCR detection of Toxoplasma gondii in tissue samples of wild boars (Sus scrofa) from southern Italy reveals high prevalence and parasite load. Parasit Vectors. (2019) 12:335. doi: 10.1186/s13071-019-3586-5

PubMed Abstract | Crossref Full Text | Google Scholar

24. Ciuca L, Borriello G, Bosco A, D'andrea L, Cringoli G, Ciaramella P, et al. Seroprevalence and clinical outcomes of Neospora caninum, Toxoplasma gondii and Besnoitia besnoiti infections in water buffaloes (Bubalus bubalis). Animals. (2020) 10:532. doi: 10.3390/ani10030532

PubMed Abstract | Crossref Full Text | Google Scholar

25. Mihiretu BD, Usui T, Kiyama M, Soda K, Yamaguchi T. Novel genotype of HA clade 2.3.4.4b H5N8 subtype high pathogenicity avian influenza virus emerged at a wintering site of migratory birds in Japan, 2021/22 winter. Pathogens. (2024) 13:380. doi: 10.3390/pathogens13050380

PubMed Abstract | Crossref Full Text | Google Scholar

26. Talmi-Frank D, Byas AD, Murrieta R, Weger-Lucarelli J, Rückert C, Gallichotte EN, et al. Intracellular diversity of WNV within circulating avian peripheral blood mononuclear cells reveals host-dependent patterns of polyinfection. Pathogens. (2023) 12:767. doi: 10.1101/2023.01.27.525959

PubMed Abstract | Crossref Full Text | Google Scholar

27. Martínez-De La Puente J, Merino S, Tomás G, Moreno J, Morales J, Lobato E, et al. Nest ectoparasites increase physiological stress in breeding birds: an experiment. Naturwissenschaften. (2011) 98:99–106. doi: 10.1007/s00114-010-0746-z

PubMed Abstract | Crossref Full Text | Google Scholar

28. Sánchez-Carrión SA, Dimov I, Márquez Jiménez FJ, de Rojas Álvarez M. Morphometrical identification and phylogenetic analysis of rhinonyssidae (Acari: Mesostigmata) parasitizing avian hosts: new molecular data. Microorganisms. (2023) 11:1783. doi: 10.3390/microorganisms11071783

PubMed Abstract | Crossref Full Text | Google Scholar

29. Buschang KE, Bennett J, Lagrue C, Poulin R. Global analysis of Toxoplasma gondii prevalence in wild avian hosts: effects of phylogeny, ecology, and detection methods. Int J Parasitol. (2025) 55:721–9. doi: 10.1016/j.ijpara.2025.06.007

PubMed Abstract | Crossref Full Text | Google Scholar

30. Song J, Li W, Gao L, Yan Q, Zhang X, Liu M, et al. miR-276 and miR-182013-5p modulate insect metamorphosis and reproduction via dually regulating juvenile hormone acid methyltransferase. Commun Biol. (2024) 7:1604. doi: 10.1038/s42003-024-07285-0

PubMed Abstract | Crossref Full Text | Google Scholar

31. Qiao L, Zhuang Z, Wang Y, Xie K, Zhang X, Shen Y, et al. Nocturnin promotes NADH and ATP production for juvenile hormone biosynthesis in adult insects. Pest Manag Sci. (2025) 81:3103–11. doi: 10.1002/ps.8676

PubMed Abstract | Crossref Full Text | Google Scholar

32. Nyffeler M, Sekercioglu ÇH, Whelan CJ. Insectivorous birds consume an estimated 400–500 million tons of prey annually. Sci Nat. (2018) 105. doi: 10.1007/s00114-018-1571-z

PubMed Abstract | Crossref Full Text | Google Scholar

33. Nardoni S, Rocchigiani G, Varvaro I, Altomonte I, Ceccherelli R, Mancianti F. Serological and molecular investigation on Toxoplasma gondii infection in wild birds. Pathogens. (2019) 8:58. doi: 10.3390/pathogens8020058

PubMed Abstract | Crossref Full Text | Google Scholar

34. Dubey JP. A review of toxoplasmosis in wild birds. Vet Parasitol. (2002) 106:121–53. doi: 10.1016/S0304-4017(02)00034-1

PubMed Abstract | Crossref Full Text | Google Scholar

35. Zaki L, Olfatifar M, Ghaffarifar F, Eslahi AV, KarimiPourSaryazdi A, Taghipour A, et al. Global prevalence of Toxoplasma gondii in birds: a systematic review and meta-analysis. Parasite Epidemiol Control. (2024) 25:e00350. doi: 10.1016/j.parepi.2024.e00350

PubMed Abstract | Crossref Full Text | Google Scholar

36. Lars S, Killian M, Dan Z, Grant PJ. Collins Bird Guide. New York, NY: HarperCollins (2009). p. 445.

Google Scholar

37. Amoroso MG, Serra F, Esposito C, D'alessio N, Ferrara G, Cioffi B, et al. Prevalence of infection with porcine circovirus types 2 and 3 in the wild boar population in the campania region (Southern italy). Animals. (2021) 11:3215. doi: 10.3390/ani11113215

PubMed Abstract | Crossref Full Text | Google Scholar

38. Ajzenberg D, Dumètre A, Dardé ML. Multiplex PCR for typing strains of Toxoplasma gondii. J Clin Microbiol. (2005) 43:1940–3. doi: 10.1128/JCM.43.4.1940-1943.2005

PubMed Abstract | Crossref Full Text | Google Scholar

39. Ajzenberg D. Type I strains in human toxoplasmosis: myth or reality? Future Microbiol. (2010) 5:841–3. doi: 10.2217/fmb.10.55

PubMed Abstract | Crossref Full Text | Google Scholar

40. Feitosa TF, Ribeiro Vilela VL, de Almeida-Neto JL, dos Santos A, de Morais DF, Alves BF, et al. High genetic diversity in Toxoplasma gondii isolates from pigs at slaughterhouses in Paraíba state, northeastern Brazil: circulation of new genotypes and Brazilian clonal lineages. Vet Parasitol. (2017) 244:76–80. doi: 10.1016/j.vetpar.2017.07.017

PubMed Abstract | Crossref Full Text | Google Scholar

41. Joeres M, Maksimov P, Höper D, Calvelage S, Calero-Bernal R, Fernández-Escobar M, et al. Genotyping of European Toxoplasma gondii strains by a new high-resolution next-generation sequencing-based method. Eur J Clin Microbiol Infect Dis. (2024) 43:355–71. doi: 10.1007/s10096-023-04721-7

PubMed Abstract | Crossref Full Text | Google Scholar

42. Ajzenberg D, Collinet F, Mercier A, Vignoles P, Dardé ML. Genotyping of Toxoplasma gondii isolates with 15 microsatellite markers in a single multiplex PCR assay. J Clin Microbiol. (2010) 48:4641–5. doi: 10.1128/JCM.01152-10

PubMed Abstract | Crossref Full Text | Google Scholar

43. Sargento ESG. Epitools Epidemiological Calculators. Ausvet (2018). Available online at: https://epitools.ausvet.com.au/

Google Scholar

44. Dini FM, Graziosi G, Lupini C, Catelli E, Galuppi R. Migratory wild birds as potential long-distance transmitters of Toxoplasma gondii infection. Pathogens. (2023) 12:478. doi: 10.3390/pathogens12030478

PubMed Abstract | Crossref Full Text | Google Scholar

45. Gazzonis AL, Villa L, Lubian E, Ressegotti S, Grilli G, Raimondi S, et al. Molecular survey on Toxoplasma gondii and Neospora caninum infection in wild birds of prey admitted to recovery centers in northern Italy. Microorganisms. (2021) 9:736. doi: 10.3390/microorganisms9040736

PubMed Abstract | Crossref Full Text | Google Scholar

46. Condoleo R, Santori D, Sezzi E, Serra S, Tonon S, Eleni C, et al. Comparison of direct and indirect detection of Toxoplasma gondii in ovine using real-time PCR, serological and histological techniques. Animals. (2024) 14:1432. doi: 10.3390/ani14101432

PubMed Abstract | Crossref Full Text | Google Scholar

47. Lindsay DS, Smith PC, Hoerr FJ, Blagburn BL. Prevalence of encysted Toxoplasma gondii in raptors from Alabama. J Parasitol. (1993) 79:870–3. doi: 10.2307/3283724

PubMed Abstract | Crossref Full Text | Google Scholar

48. Atkinson CT, Thomas NJ, Hunter DB. Parasitic Diseases of Wild Birds. Hoboken: John Wiley & Sons (2009). doi: 10.1002/9780813804620

Crossref Full Text | Google Scholar

49. Ammar S, Wood L, Su C, Spriggs M, Brown J, Van Why K, et al. Toxoplasma gondii prevalence in carnivorous wild birds in the eastern United States. Int J Parasitol Parasites Wildl. (2021) 15:3–157. doi: 10.1016/j.ijppaw.2021.04.010

PubMed Abstract | Crossref Full Text | Google Scholar

50. Johnston RF. Synanthropic birds of North America. In: Avian Ecology and Conservation in an Urbanizing World. Boston, MA: Springer US (2001). p. 49–67. doi: 10.1007/978-1-4615-1531-9_3

Crossref Full Text | Google Scholar

51. Lancaster RK, Rees WE. Bird communities and the structure of urban habitats. Can J Zool. (1979) 57:2358–68. doi: 10.1139/z79-307

Crossref Full Text | Google Scholar

52. Schlesinger MD, Manley PN, Holyoak M. Distinguishing stressors acting on land bird communities in an urbanizing environment. Ecology. (2008) 89:2302–14. doi: 10.1890/07-0256.1

PubMed Abstract | Crossref Full Text | Google Scholar

53. Gotteland C, Gilot-Fromont E, Aubert D, Poulle M-L, Dupuis E, Dardé M-L, et al. Spatial distribution of Toxoplasma gondii oocysts in soil in a rural area: influence of cats and land use. Vet Parasitol. (2014) 205:629–37. doi: 10.1016/j.vetpar.2014.08.003

PubMed Abstract | Crossref Full Text | Google Scholar

54. Dong Y, Cai J, Dong W, Wang N, An Q. The impact of urban residential areas on bird diversity: a case study from Harbin, Northeast China. Habitat Int. (2025) 163:103463. doi: 10.1016/j.habitatint.2025.103463

Crossref Full Text | Google Scholar

55. Antonio R. I corvidi italiani : sistematica, faunistica, eco-etologia, problemi di conservazione e controllo. Bologna: Edagricole. (1995). p. 142. Italian.

Google Scholar

56. Mancianti F, Terracciano G, Sorichetti C, Vecchio G, Scarselli D, Perrucci S. Epidemiologic survey on Toxoplasma gondii and Trichinella pseudospiralis infection in corvids from Central Italy. Pathogens. (2020) 9:336. doi: 10.3390/pathogens9050336

PubMed Abstract | Crossref Full Text | Google Scholar

57. Salant H, Hamburger J, King R, Baneth G. Toxoplasma gondii prevalence in Israeli crows and Griffon vultures. Vet Parasitol. (2013) 191:23–8. doi: 10.1016/j.vetpar.2012.07.029

PubMed Abstract | Crossref Full Text | Google Scholar

58. Cabezón O, García-Bocanegra I, Molina-López R, Marco I, Blanco JM, Höfle U, et al. Seropositivity and risk factors associated with Toxoplasma gondii infection in wild birds from Spain. PLoS ONE. (2011) 6:e29549. doi: 10.1371/journal.pone.0029549

PubMed Abstract | Crossref Full Text | Google Scholar

59. Wilson AG, Lapen DR, Mitchell GW, Provencher JF, Wilson S. Interaction of diet and habitat predicts Toxoplasma gondii infection rates in wild birds at a global scale. Glob Ecol Biogeogr. (2020) 29:1189–98. doi: 10.1111/geb.13096

Crossref Full Text | Google Scholar

60. Dubey JP. Toxoplasmosis of Animals and Humans. Boca Raton, FL: CRC Press (2023).

Google Scholar

61. Bettiol SS, Obendorf DL, Nowarkowski M, Milstein T, Goldsmid JM. Earthworms as paratenic hosts of toxoplasmosis in eastern Barred Bandicoots in Tasmania. J Wildl Dis. (2000) 36:145–8. doi: 10.7589/0090-3558-36.1.145

PubMed Abstract | Crossref Full Text | Google Scholar

62. Hollings T, Jones M, Mooney N, McCallum H. Wildlife disease ecology in changing landscapes: mesopredator release and toxoplasmosis. Int J Parasitol Parasites Wildl. (2013) 2:110–8. doi: 10.1016/j.ijppaw.2013.02.002

PubMed Abstract | Crossref Full Text | Google Scholar

63. Pinto-Ferreira F, Caldart ET, Pasquali AKS, Mitsuka-Breganó R, Freire RL, Navarro IT. Patterns of transmission and sources of infection in outbreaks of human toxoplasmosis. Emerg Infect Dis. (2019) 25:2177–82. doi: 10.3201/eid2512.181565

PubMed Abstract | Crossref Full Text | Google Scholar

64. Iemmi T, Vismarra A, Mangia C, Zanin R, Genchi M, Lanfranchi P, et al. Toxoplasma gondii in the Eurasian kestrel (Falco tinnunculus) in northern Italy. Parasit Vectors. (2020) 13:262. doi: 10.1186/s13071-020-04134-x

PubMed Abstract | Crossref Full Text | Google Scholar

65. Cong W, Meng QF, Song HQ, Zhou DH, Huang SY, Qian AD, et al. Seroprevalence and genetic characterization of Toxoplasma gondii in three species of pet birds in China. Parasit Vectors. (2014) 7:152. doi: 10.1186/1756-3305-7-152

PubMed Abstract | Crossref Full Text | Google Scholar

66. Khan A, Fux B, Su C, Dubey JP, Darde ML, Ajioka JW, et al. Recent transcontinental sweep of Toxoplasma gondii driven by a single monomorphic chromosome. Proc Natl Acad Sci U S A. (2007) 104:14872–7. doi: 10.1073/pnas.0702356104

PubMed Abstract | Crossref Full Text | Google Scholar

67. Lorenzi H, Khan A, Behnke MS, Namasivayam S, Swapna LS, Hadjithomas M, et al. Local admixture of amplified and diversified secreted pathogenesis determinants shapes mosaic Toxoplasma gondii genomes. Nat Commun. (2016) 7:10147. doi: 10.1038/ncomms10147

PubMed Abstract | Crossref Full Text | Google Scholar

68. Fernández-Escobar M, Schares G, Maksimov P, Joeres M, Ortega-Mora LM, Calero-Bernal R. Toxoplasma gondii genotyping: a closer look into Europe. Front Cell Infect Microbiol. (2022) 12:842595. doi: 10.3389/fcimb.2022.842595

PubMed Abstract | Crossref Full Text | Google Scholar

69. Larzul C, Imbert B, Bernadet MD, Guy G, Rémignon H. Meat quality in an intergeneric factorial crossbreeding between muscovy (Cairina moschata) and Pekin (Anas platyrhynchos) ducks. Anim Res. (2006) 55:219–29. doi: 10.1051/animres:2006010

Crossref Full Text | Google Scholar

70. Alvarado-Esquivel C, Rajendran C, Ferreira LR, Kwok OCH, Choudhary S, Alvarado-Esquivel D, et al. Prevalence of Toxoplasma gondii infection in wild birds in Durango, Mexico. J Parasitol. (2011) 97:809–12. doi: 10.1645/GE-2844.1

PubMed Abstract | Crossref Full Text | Google Scholar

71. Vieira FEG, Sasse JP, Minutti AF, Miura AC, de Barros LD, Cardim ST, et al. Toxoplasma gondii: prevalence and characterization of new genotypes in free-range chickens from south Brazil. Parasitol Res. (2018) 117:681–8. doi: 10.1007/s00436-017-5730-5

PubMed Abstract | Crossref Full Text | Google Scholar

72. Zou Y, Nie LB, Zhang NZ, Zou FC, Zhu XQ, Cong W. First genetic characterization of Toxoplasma gondii infection in poultry meat intended for human consumption in Eastern China. Infect Genet Evol. (2017) 55:172–4. doi: 10.1016/j.meegid.2017.08.022

PubMed Abstract | Crossref Full Text | Google Scholar

73. Droege G, Töpfer T. The corvids literature database-500 years of ornithological research from a crow's perspective. Database. (2016) 2016:bav112. doi: 10.1093/database/bav122

PubMed Abstract | Crossref Full Text | Google Scholar

74. Kumar N, Jhala YV, Qureshi Q, Gosler AG, Sergio F. Human-attacks by an urban raptor are tied to human subsidies and religious practices. Sci Rep. (2019) 9:2545. doi: 10.1038/s41598-019-38662-z

PubMed Abstract | Crossref Full Text | Google Scholar

75. EU. Directive 2009/147/EC of the European Parliament and of the Council of 30 November 2009 on the Conservation of Wild Birds. Bruxelles: EC Official Journal (2009). p. L 20.

Google Scholar

76. Brochet AL, Van Den Bossche W, Jones VR, Arnardottir H, Damoc D, Demko M, et al. Illegal killing and taking of birds in Europe outside the Mediterranean: assessing the scope and scale of a complex issue. Bird Conserv Int. (2019) 29:10–40. doi: 10.1017/S0959270917000533

Crossref Full Text | Google Scholar

77. Fraissinet M, Usai A. The Checklist of Birds From Campania Region (updated to 31th January 2021). Napoli: Bulletin of Regional Natural History (BORNH) (2021). p. 1.

Google Scholar

78. Urso S, Crispino F, Gervasio G, Venuto G, Aloise G. Density of Corvus corone cornix and Pica pica in different environmental typologies of North Calabria. Rivista Italiana di Ornitologia. (2012) 82:146–9. doi: 10.4081/rio.2012.140

Crossref Full Text | Google Scholar

79. Sgroi G, D'Alessio N, Marucci G, Pacifico L, Buono F, Deak G, et al. Trichinella britovi in wild boar meat from Italy, 2015–2021: a citizen science approach to surveillance. One Health. (2023) 16:100480. doi: 10.1016/j.onehlt.2022.100480

PubMed Abstract | Crossref Full Text | Google Scholar

80. Scarcelli S, Buono F, D'Alessio N, Rea S, Castaldo E, Pesce A, et al. Trichinella spp. in wolves (Canis lupus) and red foxes (Vulpes vulpes) of southern Italy. Res Vet Sci. (2024) 179:105381. doi: 10.1016/j.rvsc.2024.105381

PubMed Abstract | Crossref Full Text | Google Scholar