Integrative and conjugative elements in Mycoplasmopsis bovis from Western Canadian feedlot cattle: characterization and conjugative transfer

Introduction: Bovine respiratory disease (BRD) is the most significant disease affecting North American feedlot cattle. It is a multifactorial disease influenced by bacterial and viral pathogens, as well as management and environmental factors. Mycoplasmopsis bovis is among the most pathogenic bovine mycoplasmas and is associated with chronic BRD that often fails to respond to antimicrobial therapy. Integrative and conjugative elements (ICE) facilitate horizontal gene transfer among mycoplasmas and may contribute to the spread of antimicrobial resistance in M. bovis.

Methods: We identified mycoplasma ICEs (MICE) in the genomes of sequenced M. bovis isolates from western Canadian feedlot cattle (n = 124) and in vitro mating experiments to assess conjugation.

Results and Discussion: Of these isolates, 33.1% harbored the array of MICE genes required for conjugation. M. bovis isolates conjugated at frequencies of 10–7–10–8 when cultured in SP4 broth under orbital agitation. Since MICE circularization is the initial step in conjugation, the presence of circular MICE (cMICE) was used as a proxy for conjugation capability (n = 451). Interestingly, 25.7% of the isolates were cMICE-positive, with a higher prevalence observed in M. bovis isolated from dairy as compared to beef feedlot cattle. Additionally, calves classified as high-risk for BRD were more likely to harbor cMICE-positive M. bovis in both cattle types. Backgrounded dairy cattle had a higher likelihood of carrying cMICE-positive M. bovis than those originating from ranches. These findings lay the groundwork for assessing cattle source as a determinant of cMICE-positive M. bovis and for developing targeted strategies to mitigate antimicrobial resistance.

1 Introduction

Bovine respiratory disease (BRD) is the most significant health and economic challenge affecting feedlot cattle in North America (1). Together with Mannheimia haemolytica, Pasteurella multocida, and Histophilus somni, Mycoplasmopsis bovis is one of the main opportunistic bacteria involved in BRD (2–4). Among mycoplasma species, M. bovis is one of the most pathogenic and is associated with chronic pneumonia, polyarthritis syndrome, mastitis, genital disorders, otitis media, and keratoconjunctivitis (5). Control of M. bovis infections is hampered by a lack of effective vaccines and increasing resistance to antimicrobials in Europe and North America (6–9).

Mobile genetic elements (MGE), such as plasmids, transposons, and integrative and conjugative elements (ICE) are known to play a key role in the horizontal dissemination and persistence of antimicrobial resistance (AMR) in bacteria (10). Integrative and conjugative elements are MGEs that integrate into the bacterial host chromosome with the capacity for self-excision from the donor cell, circularization, horizontal transmission by conjugation to a recipient cell, and integration into the recipient cell chromosome (11). These MGEs have been recognized as the most abundant conjugative elements in prokaryotes, outnumbering conjugative plasmids (12). Despite their reduced genomes (13), mycoplasma species exhibit remarkable genomic plasticity, largely driven by ICE-mediated horizontal gene transfer. A comprehensive analysis of 1,433 Mollicutes genomes (including Mycoplasma, Ureaplasma, and Spiroplasma) revealed that 83.9% of these species show evidence of horizontal gene transfer (HGT), with ICEs and integrative and mobilizable elements (IMEs) playing a central role (14). ICEs are capable of cross-species transfer, particularly among Mycoplasma species sharing ecological niches, and play a pivotal role in the adaptive evolution of these pathogens through creating mosaic genomes (14). Integrative and conjugative elements are prevalent in M. bovis (15, 16), but unlike ICE in BRD-associated Pasteurellaceae, mycoplasma ICEs (MICE) do not carry AMR genes (13, 17). However, MICEs have been associated with the horizontal transfer of virtually any gene between mycoplasma cells, including those associated with AMR by point mutations (18). Mycoplasmopsis agalactiae has been used extensively as a conjugation model, and HGT has been documented among M. agalactiae strains, between M. agalactiae and M. bovis, and among M. bovis strains (18, 19). Horizontal, MICE-mediated transfer of enrofloxacin-resistance has been demonstrated between M. agalactiae cells (20), but the horizontal transmission of AMR across M. bovis and other mycoplasma species relevant in feedlot cattle has not been a subject of previous research.

Building on existing evidence that MICEs mediate horizontal gene transfer in mycoplasma species, we hypothesized that North American M. bovis possesses functional MICE capable of conjugation, potentially facilitating the transfer of genes with mutations that contribute to AMR. Therefore, the objectives of this study were to document the presence of MICE and epidemiology of circular MICE (cMICE) in M. bovis isolated from feedlot cattle in western Canada; to characterize the structure and diversity of the detected MICE; to perform a comparative genomic analysis of such MICE; and to determine the in vitro conjugation capabilities of M. bovis through MICE.

2 Materials and methods

2.1 Isolates and culture

Field isolates of M. bovis were sourced from two different collections originating in western Canada (TMC and MJC collections) (Supplementary material 2, Table S1). The TMC collection included 455 respiratory isolates (used for cMICE epidemiological studies), each from a different calf, sampled from 10 different feedlots between 2017 and 2019 (9). Isolates in the MJC collection (n = 211; used for MICE genomic analyses) were obtained from 96 feedlot cattle from different types of samples, across 21 different feedlots, and between 2006 and 2018 (6). For conjugation studies, M. agalactiae reference strain PG2 (NCTC 10123) was kindly provided by Dr. John Devenish (CFIA, Canada).

All M. bovis isolates, transformants, and transconjugants were grown at 37 °C in SP4 broth (Supplementary material 2, Table S2), with or without 5% CO₂ according to experimental conditions (21), and without ampicillin unless otherwise specified. Additional media formulations, including N broth, PPLO, Eaton’s, and SP4 with fetal bovine serum (FBS) substituted by Proliferum (Multus Biotechnology; London, UK), were tested for their suitability for M. bovis conjugation studies (Supplementary material 2, Tables S3, S4). For culturing transformants and transconjugants, SP4 medium with puromycin (PURO; 5 μg/mL), gentamicin (GEN; 50 μg/mL), or tetracycline (TET; 8 μg/mL), either individually or in combination, was used (22). The concentration of tetracycline in SP4 media for the growth of TFs was 4-fold higher than the previously recommended 2 μg/mL (23) due to the widespread of tetracycline resistance among M. bovis isolates (6, 9). At 2 μg/mL (22), tetracycline was found to not inhibit the growth of M. bovis. Therefore, the maximum tetracycline concentration tolerated by M. bovis TET-transformants was determined using SP4 agar (data not shown).

2.2 Bacterial genome sequencing and assembly

For the study of MICE and the identification of conjugation candidates, we leveraged 120 genomes previously sequenced from the MJC collection of M. bovis using Illumina short read technology (BioProject ID PRJNA642970; Supplementary material 3, Tables S5, S6) (24). Briefly, genomic library construction was performed using the Illumina Nextera XT DNA sample preparation kit (Illumina Inc.; San Diego, CA, USA). Libraries were sequenced on an Illumina MiSeq platform using the MiSeq Reagent Kit V2 to generate 2 × 250 bp paired-end reads. Additionally, several isolates from the TMC and MJC collections were subjected to Illumina short read (re)sequencing to support hybrid genomic assemblies with long read sequencing and/ or for MICE characterization (Supplementary material 3, Tables S5, S7). Specifically, isolates with relevant antimicrobial susceptibility profiles (6, 9), MICE types (Genomic analyses section), or cMICE presence (cMICE epidemiology section) were sequenced, i.e., M. bovis from MJC [646, 645, 643, 019; n = 124 in total] and TMC [J288, C176, J10]. For this, the aforementioned short read sequencing procedure was used with the only difference being that the MiSeq Reagent Kit V3 was used to generate 2 × 300 bp paired-end reads. For long read sequencing (n = 10; Supplementary material 3, Tables S7–S9), high molecular weight genomic DNA was extracted using the Qiagen HMW Blood & Cell Culture DNA Kit with Genomic-tip 20/G (Qiagen, Toronto, ON, Canada). DNA was end-repaired using the NEBNext Ultra II End Repair/dA-Tailing kit (New England Biolabs Ltd. Whitby, ON, Canada). Barcoding was performed using the Oxford Nanopore barcoding kit EXP-NBD196), and samples were pooled and cleaned to remove reagents of the previous step(s) using the Omega-bind NGS beads (Omegabiotek, M1378-01) following manufacturer’s instructions. Sequencing adapters were then ligated using Adapter Mix II Expansion kit EXP-AMII001 (Nanopore Technologies) and sequenced on a PromethION sequencing platform. MinKNOW Core 3.1.20 and guppy 2.0.10 were used for flow cell signal processing and base calling in real time.

The Galaxy platform (25) was used to check the quality and processing of Illumina raw reads. Read quality was assessed using FastQC v0.12.1 (26), and trimming was performed with Trimmomatic (Galaxy v0.39 + galaxy2) using the following parameters: head crop = 19, trailing = 20, and minimum length = 36 bp (27). Draft genome assemblies were generated de-novo using Illumina short-reads only (Shovill pipeline v1.1.0) (28), and annotation was performed with Prokka (Galaxy v1.14.6 + galaxy1) (29) using the M. bovis PG45 genome as reference (NC_014760.1). For hybrid assembly of M. bovis genomes, the Mycovista pipeline (30) was used as it specifically addresses highly repetitive genomes like M. bovis. Mycovista used Oxford Nanopore long reads as the reference assembly in combination with Illumina short reads for polishing. The pipeline was run in a high-performance computing cluster, and it was modified to use Apptainers (i.e., containers) instead of Conda environments. Apptainers with the same versions of tools as in the published Mycovista workflow were used. All default hybrid assembly pipeline parameters were retained with the exception of Trimmomatic which was set with the same trimming settings as described above for Illumina short reads pre-processing. Hybrid genomes were quality checked using Quast (included in Mycovista; v5.0.2) and BUSCO (v5.8.0; Metaeuk gene predictor, Mycoplasmatales Lineage).

2.3 Genomic analyses

Mycoplasmopsis bovis MICE genomic analyses were carried out using published sequences as a reference for hominis-type (H-type) MICE which included Mycoplasmopsis agalactiae 5,632 ICEA₅₆₃₂-I (GenBank: CT030003.1) and M. bovis PG45 ICEB-2_PG45 (NCBI accession number: NC_014760.1); and spiroplasma-type (S-type) MICE M. bovis PG45 vICEB-1_PG45 (vICE, vestigial ICE; NCBI accession number: NC_014760.1) (16). Coding regions (CDS) CDS1, 13, 14, 15, 16, 17, 19, 22, 30, 5, 7, A, and G in ICEB-2_PG45 [CDSs identified in the literature as essential for conjugation in M. agalactiae strain 5,632 (22)] and CDS3, 14, 15, 16, 17, 19, 22 in vICEB-1_PG45 were searched (minimum alignment coverage threshold of 70% and a sequence identity cutoff of 90%). The CDSC is not annotated in ICEB-2_PG45, but it is described as part of the MICE conjugative machinery in ICEA₅₆₃₂-I (22) and was therefore included in the screening (minimum alignment coverage threshold of 35% and a sequence identity cutoff of 50%). Additionally, the two non-coding regions (ncr) ncr16-27 and ncrD-5 were extracted because of their potential role in conjugation as regulatory and/ or cis-acting elements (22). All MICE-CDS screening were carried out in Geneious (v.10.2.6) using the custom BLAST tool to determine presence/absence.

Mycoplasmopsis bovis draft genomes from MJC collection (n = 124; Supplementary material 3, Table S5) were screened for the presence/absence of the aforementioned MICE-CDSs and ncr, whereas hybrid assemblies were used for a more detailed comparative study of the structure and composition of H and S-type MICE. A total of 41 hybrid assemblies were included for the analyses, i.e., 10 generated in this study and 31 from the literature (30–32) (Supplementary material 4, Table S10). MICE from hybrid assemblies were manually annotated as specified elsewhere (16). Vestigial MICE that contained a few MICE-CDSs were excluded from the hybrid assembly studies, i.e., for H-type MICE, only those harboring the CDSs from CS1 to CDS22 were included; likewise, for S-type MICE, CDS3 to CDS22 were included. Additionally, 12 M. agalactiae genomes (Accession numbers: GCA_009150585.1, GCA_012689495.1, GCA_019552405.1, GCA_024582795.1, GCA_036542405.1, GCA_036542425.1, GCA_036542445.1, GCA_036542465.1, GCA_036549555.1, GCA_900088695.1), at the complete or scaffold level, were retrieved from the NCBI database (May 2025) and searched for H and S-type MICE by BLAST as specified for M. bovis.

2.4 Circular MICE: qPCR assay development and culture conditions

Initial cMICE screening, performed using previously described cPCR with left1/right2 primers (16), identified M. bovis 646 as cMICE-positive. The resulting M. bovis 646 cMICE cPCR amplicon was verified by Sanger sequencing (Eurofins Genomics) (16) and used to develop a qPCR assay that targeted the cMICE junction region (primers designed in Geneious v10.2.6; cMICE-F: 5′ – TCTTATGCATAGAAGTAAAGTAGAGT – 3′; cMICE-R: 5′ – ACCCACTTTCTTCTATCAGTTC – 3′) (Supplementary materials 5, 6). Subsequently, different culture/environmental conditions in SP4 broth were explored, individually or in combination, to identify those associated with the largest quantity of cMICE, i.e., growth at different phases, temperatures, cell densities, pH, nutrients availability, UV light exposure, mitomycin C exposure, and atmospheric CO₂ concentrations (Supplementary material 7). Standard culture conditions were set at 37 °C, 5% CO₂, without agitation. Each treatment was tested in 3 independent experiments (biological replicates, BR). For each environmental stressor, mycoplasma cell survival was assessed before and after treatment by M. bovis colony enumerations on SP4 agar. The gDNA of treated and un-treated, control cultures was extracted using the DNeasy Blood & Tissue DNA isolation kit (Qiagen). From each treated and control sample, the relative cMICE quantity was determined by the ΔΔCt method in a StepOnePlus qPCR thermocycler (Applied Biosystems). The single-copy, housekeeping uvrC gene was used as the endogenous standard (33) and SYBR green chemistry was used for fluorescence measurements. The ΔΔCt method followed Pfaff’s principle (34) which allows for relative quantification of a target compared to a reference gene, enabling comparison between treated and control samples without the need of calibration curves (each BR was qPCR-tested in triplicates). cMICE quantity levels were compared across treatments using the Kruskal-Wallis test (p < 0.05).

2.5 cMICE epidemiology

The presence of cMICE was used as a proxy of conjugation capabilities amongs 451 M. bovis isolates from the TMC collection (9). This collection was obtained from a previous cross-sectional study aiming to determine AMR levels at feedlot entry of the 4 main bacterial species involved in BRD, including M. bovis. For that study, deep nasopharyngeal swabs (DNPS, n = 2,824) were collected during two sampling periods (August 2017–May 2018 and August 2018–April 2019) from 10 different feedlots in Alberta, Canada. From each calf, only one DNPS was obtained before antimicrobials were administrated at processing, and a series of epidemiological factors were recorded to investigate their possible relationship with higher AMR sources, i.e., arrival date, cattle type (beef, dairy), sex (heifer, bull, steer), weight (kg), age class (calf, yearling), origin (ranch direct, auction barn, backgrounding operation), feedlot, and BRD risk during the feeding period (high, low) (9). Transport trailer was considered the primary sampling unit, with cattle from the same truckload considered a cluster (STC or same truck load). The majority of beef-type cattle were sourced through auction marts whereas most dairy-type cattle were farm-direct. When auction mart beef cattle were from different locations, but transported in the same truck, the random effect was nested (arrived from within STC). For dairy-type cattle models, 2 random effects were included (STC and arrived from) when the location of their origin was known. cMICE screening was carried out for each M. bovis isolate following the above described direct-qPCR assay.

Mycoplasmopsis bovis isolates were grown in SP4 broth (1 replicate/isolate), without shaking, to early stationary phase. Growth phase was confirmed by broth turbidity either manually (spectrophotometer Genesis 20, Thermo Scientific) or automatically (Stratus, Cerillo, Charlottesville, VA) [absorbance at 450 nm (35)]. To validate results, a subset of direct-qPCR-screened cMICE positive (n = 35) or negative (n = 22) M. bovis were subjected to gDNA extraction followed by the detection of cMICE by conventional PCR (cPCR) using the published left1/right2 primers (Supplementary material 6) (23). To further verify that the binding sites of the new cMICE qPCR primers were conserved across isolates, a subset of cPCR amplicon products (n = 25/35) were Sanger sequenced (Eurofins Genomics) and analyzed in silico using the Geneious Alignment Tool (Geneious v10.2.6).

Generalized linear mixed models (GLMM; GLIMMIX procedure in SAS) were used to model cMICE as a binary response variable (presence/absence). Age, country, feedlot, risk, season, sex, source, weight, and year were initially included as fixed factors and dropped from the models where not statistically significant. Feedlot capacity was not included in the models owing to the relatively problematic level of multicollinearity, as quantified by the variance inflation factor (data not shown). The proposed random effects were dropped from the models when the GLIMMIX procedure did not converge. Models were run for the full dataset and also for data stratified by cattle type since the relevancy of this variable was confirmed in previous AMR studies (9). For beef-type models, the samples from the US were excluded because none of the samples were cMICE-positive (n = 0/5). Likewise, in the dairy-type dataset, samples from auction (n = 0/1 cMICE positive) and female (n = 0/2 cMICE positive) cattle were excluded.

2.6 Bacterial transformation

Mycoplasmopsis bovis transformation was carried out as previously described (23) using the pMT85 derived plasmids to tag isolates with antimicrobial resistance genes (ARG) conferring resistance to PURO, GEN, or TET (22). The pMT85 plasmids carry a mini transposon (Tn) composed of the ARG cassette flanked by two Tn4001 inverted repeats (IR). The mini-Tn4001 lacks the transposase gene, resulting in the stable insertion of the ARGs in the mycoplasma chromosome that prevents spontaneous relocation of the resistance gene markers within the mycoplasma chromosome.

The insertion of ARGs in the M. bovis genome was verified using a direct qPCR approach aiming to bypass genomic DNA (gDNA) extraction (33). For this, new qPCR assays were developed to detect PURO, GEN, and TET genes (primers designed in Geneious v.10.2.6) (Supplementary materials 5, 6). The performance of these assays was validated by amplifying the corresponding ARGs from purified gDNA of mycoplasma transformants and purified plasmid DNA (pDNA). For this, nine M. bovis 057 PURO transformants, nine M. bovis 643 GEN transformants, and nine M. bovis D317A TET transformants were subjected to gDNA extraction using the DNeasy Blood & Tissue DNA isolation kit (Qiagen), followed by cPCR using primers Gm1/Gm2, IntMtet1/IntMtet2, and purF/purR for the amplification of GEN, TET, and PURO genes, respectively (Supplementary material 6) (23).

2.7 Conjugation studies

Conjugation in M. bovis was assessed using a previously developed reference method (21). To verify conjugates, M. bovis transformants carrying pMT85-PURO and pMT85-GEN plasmids (transformants designated as Mbov^P and Mbov^G, respectively) were used as mating parents (23). Unless otherwise stated, conjugation parents consisted of pools of either Mbov^P or Mbov^G transformants (up to 9 different transformants/pool), instead of individual transformant colonies to increase the likelihood of detecting conjugation events (23). Initially, conjugation was attempted using M. bovis 646 as one of the parenteral isolates since it was the first one identified as cMICE positive (Supplementary material 8, Table S14). Due to the absence of conjugation mating M. bovis 646 with M. agalactiae PG2, conjugation was attempted in a series of 20 mating experiments involving 10 different M. bovis field isolates and M. agalactiae PG2, in different combinations (Supplementary material 8, Table S14). However, successful conjugation was observed in only 2 out of 20 experiments. In both cases, the same parent containing ICEB-2, M. bovis isolate 643, successfully conjugated with either M. bovis isolate I100 or 057. Therefore, to optimize conjugation efficiency, various experimental parameters were tested, including incubation time, parent-to-parent ratios, media type, and agitation, to determine their impact on MICE-mediated conjugation in M. bovis (Supplementary material 9). Among these, orbital agitation was the only factor that consistently increased conjugation between M. bovis 643 and I100 (Supplementary material 8, Table S15). As a result, agitation was incorporated into the optimized conjugation protocol for M. bovis in SP4 broth (Supplementary material 10). Three independent conjugation experiments using M. bovis 643^G x I100^P were conducted to determine conjugation frequency and optimal incubation time. After cloning and filtering (21), all suspected transconjugants were screened using direct qPCR for the presence of both PURO and GEN markers. Transconjugants testing positive for both markers were further verified by gDNA purification and cPCR using previously published primers (Supplementary material 6).

3 Results

3.1 Isolates and culture

SP4 media has been used for mycoplasma conjugation experiments before (21), but it can be expensive due to the supplements it contains such as FBS. Consequently, different media were tested for their suitability in this study (Supplementary material 2). SP4 outperformed the other media formulations tested (N, PPLO, and Eaton’s; Supplementary material 2, Table S3), and the substitution of FBS by Proliferum did not support optimum growth of M. bovis in SP4 (Supplementary material 2, Table S4, Figures S1, S2).

3.2 Bacterial genome sequencing and assembly

Draft genomes of the 124 MJC isolates produced assemblies with an average N50 of 21,391 bp (range: 1,952 to 45,260 bp) and an average of 212 contigs per genome (range: 123 to 488) (Supplementary material 3, Table S6). The 10 hybrid assemblies presented from 1 to 4 contigs with a largest contig length range of 976,369–1,154,934 bp and a CG average content of 29.2% (Supplementary material 3, Table S8). In 2 instances, 1 and 2 genes (BUSCOs) were missing in a total of 4 hybrid assemblies out of a total of 174 BUSCOs included in the quality analysis (Supplementary material 3, Table S9).

3.3 Genomic analyses

The draft genomes obtained from MJC isolates were screened for the presence/absence of hominis and spiroplasma-type MICE-CDSs. All the draft genomes included (n = 124) contained at least one MICE-CDS (sequence identity range 94.8–100%), with 64.5% (80/124) presenting MICE-CDSs of two MICE types, i.e., hominis and spiroplasma (Tables 1, 2). Spiroplasma-like MICE-CDSs were found in all genomes, either alone or in consort with hominis-like MICE-CDSs in the same genome, whereas hominis-like MICE-CDSs were only found as genome co-residents of the spiroplasma-type. Half (41/80) of the isolates with hominis-type MICE-CDSs presented all the MICE-CDSs identified in the literature as essential for conjugation in M. agalactiae strain 5,632 (Table 1) (22), meaning that 33.1% (41/124) of the isolates (which included M bovis 643) presented potentially functional hominis MICE.

Table 1

Table 1. Hominis-type MICE-CDSs detected using ICEB-2_PG45 as a reference (n = 80/124).

Table 2

Table 2. Spiroplasma-type MICE-CDSs detected using ICEB-1_PG45 as a reference (n = 124/124).

Compared to ICEA₅₆₃₂-I, M. bovis H-type MICEs from all the draft and hybrid assemblies lacked CDSH. The CDS13 from M. bovis ICEB-2_PG45 had to be manually annotated for every M. bovis H-type MICE. The CDSC was detected in H-type M. bovis MICE with a 58.4–62.6% of pairwise identity (size range: 211–298 bp; CDSC from ICEA₅₆₃₂-I is 561 bp) and aligned with CDS11 from ICEB-2_PG45 (MBOVPG45_207 and MBOVPG45_208, of 660 and 636 bp, respectively) and vICEB-1_PG45 (MBOVPG45_489 and MBOVPG45_488, of 663 and 660 bp, respectively). The ncr16-27 presented an 88.3–89.7% pairwise identity (146 bp in all cases, matching the size in ICEA₅₆₃₂-I), whereas the ncrD-5 exhibited lower identity (46.9–52.9%) with 50–51 bp length, except for one instance of 64 bp (compared to 94 bp in ICEA₅₆₃₂-I). Notably, 17.5% of draft (n = 14/80 MJC isolates presenting H-type MICE) and 36% of hybrid (n = 9/25 from TMC and NCBI) M. bovis assemblies contained CDS1 alone from H-type MICE.

Mycoplasma hybrid assemblies were used for a comparative analysis of MICE structure. The overall structure and synteny of M. bovis MICE were conserved across isolates (Supplementary material 4, Figures S3, S4). Insertion sequences (IS) were present within all the studied H-type and in most of S-type MICE (29/38) in M. bovis, but were absent in M. agalactiae MICE. In M. bovis, IS were found both between and within MICE-CDSs. Out of the 12 M. agalactiae genomes (including strains PG2 and 5,632), only 2 strains, 5,632 and 4,867 harbored H-type MICE (Supplementary material 4, Figure S3), whereas 8 out of 12 had S-type MICE.

3.4 Circular MICE: qPCR assay development and culture conditions

The presence of cMICE was used as a proxy of conjugation capabilities on M. bovis isolates from the TMC collection. For that, a new qPCR assay was developed targeting the cMICE junction region. In silico sequence alignments showed that the qPCR primer binding sites were conserved across all sequenced isolates (data not shown). The direct-qPCR limit of detection (LOD) showed a positive result for bacterial growth in SP4 broth at concentrations between 10⁹ and 10⁷ CFU/mL (Supplementary material 5). Among the 57 cMICE PCR assays performed, 56 (98.3%) showed a concordant result between cPCR and qPCR, with only one sample being qPCR-positive but cPCR-negative (Table 3).

Table 3

Table 3. Comparative results of the screening of cMICE by qPCR and cPCR.

Once the cMICE qPCR assay was developed, different environmental factors were tested to determine if they had an effect on cMICE quantity. Although some of the environmental conditions showed varying cMICE quantity ratios (Figure 1), none differed significantly from the non-treated control (p > 0.05). However, cells at early stationary phase (20 h) possessed the highest cMICE (RQ value >2). Due to the simplicity of culturing M. bovis isolates to the early stationary phase in SP4 broth, this approach was selected to study cMICE epidemiology. Culture conditions assessed for the quantification of cMICE did not impact the viability of M. bovis 646, as confirmed by colony enumeration (Supplementary material 7).

Figure 1

Figure 1. Relative expression ratio (RQ, linear scale) of cMICE under different culture conditions/stressors. RQ values per environmental factor: representation of three biological replicates (each containing 3 technical replicates). Orange, horizontal line represents the RQ value for controls, i.e., the RQ baseline value in a linear scale (equal to 1); cMICE, circular MICE. Atmosphere in logarithmic phase (Atm-Log) p = 0.9999; atmosphere in stationary phase (Atm-Stat) p = 0.9932; cold (4 °C) p = 1; higher M. bovis cell density p = 1; growth at 15 h p = 0.8456, 20 h p = 0.1318, and 25 h p = 0.9999; heat (45 °C) p = 0.9999; mitomycin C (MMC; sub-inhibitory concentrations tested at μg/mL) [0.016] p = 1, and [0.032] p = 1; pH equal to 5 p = 0.9999, and 9 p = 0.8075; starvation (DPBS) p = 0.9999; starvation (DPBS) + cold (4 °C) + higher M. bovis cell density (S4D) followed by an incubation under standard conditions of 1 h p = 1, or overnight (OV) p = 0.9999; UV light (100 J/m²) p = 0.9705.

3.5 cMICE epidemiology

To estimate the conjugation capabilities of the entire TMC M. bovis isolates collection (n = 451; 4/455 isolates did not grow when retrieved from long term storage), the new cMICE qPCR assay was used for the isolates growing under those environmental conditions previously determined to have higher cMICE quantities. Of the 451 M. bovis isolates tested, 25.7% (n = 116) were cMICE-positive (Table 4). The prevalence of cMICE varied by cattle type, with 41.3% of isolates from dairy cattle testing positive, compared to 13.7% from beef cattle (Table 4).

Table 4

Table 4. Proportion of positive M. bovis cMICE in total samples and as stratified by cattle type from various sources.

Cattle at higher risk of developing clinical BRD during the feeding period had a higher cMICE percentage regardless of cattle type (Table 5). When compared to isolates from ranch direct-sourced calves, isolates from backgrounding dairy-type cattle carried more cMICE. However, the mean percentage of isolates with cMICE from beef cattle sourced from auction marts did not differ (p = 0.12) from beef cattle sourced from backgrounding operations.

Table 5

Table 5. Mycoplasmopsis bovis cMICE in total samples, stratified by cattle type from various sources.

3.6 Bacterial transformation

For the identification of M. bovis transconjugants, parental strains were tagged with ARGs (transformants). To eliminate the need for gDNA extraction prior to ARGs cPCR amplification, new direct-qPCR assays were developed. The new direct-qPCR assays designed for the detection of pMT85 antimicrobial resistance markers proved to be specific, with a dynamic range for pDNA and M. bovis transformants growing in broth that spanned several dilutions (Supplementary material 5). M. bovis 057 PURO- transformants, 643 GEN- transformants, and D317A TET- transformants were cPCR positive for the ARGs that were used to genetically mark them. Transformation was successful for 29/32 isolate-ARG combinations but failed for 13 isolate-ARG combinations (data not shown). For the isolates resulting in successful transformation, up to 9 transformants were stored per isolate-ARG combination. In summary, a total of 123 transformants were obtained belonging to 19 different isolate-antibiotic combinations (Supplementary material 3, Table S7).

3.7 Conjugation studies

From 20 independent conjugation experiments conducted using a previously published conjugation method referred to as the “reference conjugation method” (21), transconjugants were obtained in two instances (Supplementary material 8, Table S14). Those successful instances originated from conjugations between M. bovis isolate 643 (cMICE positive; contains two ICEB-2 and one ICEB-1 elements, Supplementary material 4, Figures S3, S4), and two independent recipient isolates M. bovis I100 (cMICE negative; its genome was not sequenced) and 057 (cMICE negative; contains one ICEB-1 element, Supplementary material 4, Figure S4). The rest of the suspected transconjugants obtained from the remaining 18 conjugation experiments were positive for just for one of the ARGs present in the parental isolates (i.e., PURO or GEN). These non-transconjugants were visible after 4–5 d and more frequently on SP4 + PURO+GEN agar plates incubated at 5% CO₂ versus 0% CO₂ (data not shown). Unlike non-transconjugants, most transconjugants were observed on SP4 + PURO+GEN plates only after 2 d of incubation and were PCR positive for both PURO and GEN.

Of the modifications to the reference conjugation method, only orbital agitation of the bi-parent mixture consistently promoted conjugation (Supplementary material 8). Based on 3 different experiments with varying incubation time, the conjugation frequency between M. bovis 643^G and I100^P was optimal for incubations less than 10 h with agitation in SP4 broth (conjugation mean value ± standard deviation (x10⁻⁶): 11.2 ± 789.4) (Table 6).

Table 6

Table 6. Conjugation frequencies between M. bovis 643^G and M. bovis I100^P with orbital shaking.

4 Discussion

4.1 MICEs are widespread in Canadian Mycoplasmopsis bovis

Compared to ICEA₅₆₃₂-I, the H-type MICE identified in M. bovis exhibited structural differences that may have played a role in the enhanced conjugation efficiency observed with agitation. While CDSC has been described as part of the minimal ICEA₅₆₃₂ machinery, its function remains unknown (22). In our study, only approximately half of ICEA₅₆₃₂-I-CDSC length aligned with the CDS11 described in M. bovis MICE (data not shown). Likewise, ICEA₅₆₃₂-I-CDSH was found to be homologous to several bacterial DNA methyltransferases and hypothesized to be involved in the control of ICEA₅₆₃₂-I survival and propagation in various hosts by protecting transferred DNA from restriction enzymes (15). However, CDSH was absent in all of the M. bovis genomes screened. Two non-coding regions, ncr16/27 and ncrD/5, previously described as possible regulatory and/ or cis-acting elements needed for conjugation (22) were also examined. The ncr16/27 was found to be highly conserved in this study, which further supports its relevance in MICE. However, M. bovis ncrD/5 differed in both size and sequence from that found in M. agalactiae. The H-Type CDS1 was found alone in 21.9% of the (draft and hybrid) assemblies in our study, and in all instances, it was associated with ISs, suggesting they may be remnants of an H-type MICE that degenerated over time.

Insertion sequences are important in bacterial evolution and are widespread in prokaryotes, but variation exists within and between species and frequently exhibit an evolutive history (36, 37). While IS have the ability to regulate transcription, their insertion within coding regions may interrupt gene function (38, 39). In our study, all H-type M. bovis MICE contained ISs either between or within CDSs (Supplementary material 4, Figure S3), whereas ICEA₅₆₃₂-I, II, and III did not (16). When M. agalactiae NCBI genomes (n = 10) were screened for IS in the ISFinder database (Aug 2024), with the exception of strain 5,632 (n = 28 complete IS), no more than 6 ISs were found per genome (data not shown). This contrasts with what has been described in M. bovis for which up to 103 ISs have been identified within a single genome (32). These results coincided with previous observations describing a higher IS density in M. bovis compared to M. agalactiae (40). Whether IS contribute to the reduced conjugation efficiency observed in M. bovis in SP4 broth as compared to M. agalactiae remains unclear due to the limited availability of M. agalactiae genomes with H-type MICE.

4.2 cMICE is positively associated to antimicrobial use in Mycoplasmopsis bovis

Although ICE circularization in bacteria does not guarantee conjugative transfer, PCR-detection of an ICE junction following chromosomal excision is frequently used as indirect evidence of ICE functionality (41). In our study, the overall percentage of cMICE-positive M. bovis isolates from the TMC collection (25.7%) was relatively close to the proportion of MJC isolates that carried all the MICE-CDSs required for conjugation in M. agalactiae 5,632 (33.1%), which could reflect the in vivo conjugation potential of M. bovis.

Dairy cattle were more positively associated to cMICE as compared to beef cattle. Additionally, within dairy, calves that originated from backgrounding operations were more likely to be cMICE-positive than those sourced directly from ranches. For beef cattle, backgrounded cattle tended to have more cMICE (9.7%) than auction-derived calves (2.3%), but this difference was not significant (p = 0.12). Given the low overall prevalence of cMICE in M. bovis from beef cattle (13.7%), power calculations indicated that a four-year sampling period would be required to detect statistically meaningful differences between sources at an 80% confidence level in beef cattle (data not shown). Antimicrobial use is generally higher in dairy farms than in the beef industry in western Canada (42, 43). Additionally, backgrounding operations, characterized by confinement and higher calf population density, are associated with increased antimicrobial use compared to ranches. Collectively, these findings suggest a correlation between elevated antimicrobial use and cMICE presence in M. bovis which could ultimately lead to the horizontal transmission of AMR in M. bovis populations. To date, the relationship between cMICE presence and AMR has not been directly investigated, but is currently being evaluated in our laboratory. Regardless of the cattle type, high risk calves were positively associated with cMICE as compared to low risk. The BRD risk level during the feeding period is determined by a series of animal and environmental factors such as age, weight, vaccination status, degree of commingling, transport distance, or extreme weather changes. The biological basis for the association between BRD risk status and the likelihood of isolating cMICE-positive M. bovis before the administration of antimicrobials at the feedlot remains unclear and warrants further investigation.

Interpretation of these epidemiological patterns should also consider broader contextual factors. Environmental and management-related variables, including antimicrobial use practices and co-infections, may influence cMICE distribution and warrant further exploration in future studies that integrate high-resolution genomic data with complementary management and environmental information. In addition, the binding sites of the newly developed qPCR primers (cMICE detection) were conserved across the hominis-type MICE identified in our isolates. However, the presence of additional MICE variants circulating within M. bovis populations that are not captured by the current direct-qPCR assay cannot be excluded.

4.3 Mycoplasmopsis bovis conjugates in SP4 broth

Two types of mycoplasma ICE have been described in previous research: hominis-type (H-type) and spiroplasma-type (S-type) (13). To-date, conjugation has only been demonstrated for H-type MICE, both in SP4 broth and cell culture (19), as the S-type MICE are typically degenerative and non-conjugative (23). In M. agalactiae, the horizontal transfer of MICE between donor and recipient cells has been documented, along with chromosomal transfer (CT) of random DNA fragments in the opposite direction (13). While CT uses MICE machinery, it occurs independently of MICE transfer (13). Importantly, CT can involve any region of the chromosome, including genes with mutations conferring enrofloxacin resistance, potentially contributing to the spread of AMR in mycoplasmas (20). More recently, H-type MICE transfer has also been documented between M. bovis strains in cell culture but failed in SP4 broth (19). In that study, M. agalactiae showed higher conjugation frequency in cell culture compared to axenic (SP4 broth) conditions. Moreover, M. bovis conjugation frequency in cell culture was similar to that in M. agalactiae, but the presence of CT between M. bovis cells was not determined.

Previous research has shown that shaking bacterial cultures can increase E. coli conjugation frequencies by up to 4 fold (44). In our study, shaking cultures in SP4 broth resulted in conjugation between M. bovis cells at comparable frequencies to those of M. agalactiae in SP4 broth (23). The presence of both parental antimicrobial markers (i.e., PURO and GEN) was confirmed by PCR using purified gDNA from transconjugants, suggesting the transfer of chromosomal fragments and/or MICE between cells as described in M. agalactiae (19). Therefore, a detailed genomic analysis of CT in M. bovis is warranted but falls outside the scope of this study. It is noteworthy that only those conjugation events that involved the transfer of the chromosomal region containing the ARG markers could be detected. Given that any genomic region has the potential to be horizontally transferred between mycoplasma cells (13), (undetected) chromosomal transfer events not involving the transfer of ARGs may have also taken place and have under estimated the conjugation frequency. Further investigation is needed to determine the degree that horizontal AMR transfer occurs in M. bovis.

The ruminants mycoplasma conjugation protocol does not specify the use of CO₂ during the mating incubation. However, we selected a 5% CO₂ atmosphere for conjugation experiments as this approximates its concentration in mammalian tissues (45), and is recommended for the isolation of mycoplasmas from ruminants (46). However, we observed a higher number of non-transconjugants M. bovis colonies (i.e., only PCR-positive for one of the ARG markers) on selective SP4 agar plates under 5% CO₂. This may be due to CO₂-induced acidification of media, which is known to impact the efficacy of penicillins, aminoglycosides, quinolones, macrolides, and tetracyclines (47). Therefore, we elected to not incubate SP4 agar containing antimicrobials under 5% CO₂ for selection of transconjugants, as a decrease in pH may reduce antimicrobial activity. Nevertheless, our high-throughput direct-qPCR assays designed for the detection of the antimicrobial markers may still be a valuable tool for screening suspected transconjugants grown with or without 5% CO₂, as it eliminates the need for gDNA extraction.

The development of serum-free media for culturing mycoplasmas has been attempted in the past with limited success (48–50). More recently, laboratory-grown meat technologies have developed alternatives to FBS that support the growth of eukaryotic cells, like Proliferum (Multus Biotechnology. London, UK). When the suitability of Proliferum was tested in this study for the support of the in vitro growth of M. bovis in broth and agar, we obtained little success. However, other alternatives to FBS are now commercially available which warrant further investigation in the field. Ideally, a fully synthetic formula would provide greater consistency across mycoplasma media batches and eliminate the reliance on animal-derived components.

5 Conclusion

This study provides genomic and experimental evidence supporting the widespread presence and functionality of MICE in M. bovis isolates from Canadian feedlot cattle. Through whole-genome sequencing and cMICE screening, we confirmed the widespread presence of MICE-harboring M. bovis isolates, and importantly, demonstrated that these elements are capable of mediating conjugation in vitro. These findings emphasize the potential role of MICE in facilitating horizontal gene transfer, including the dissemination of AMR, and underscore their relevance in the epidemiology and evolution of M. bovis.

Data availability statement

The datasets presented in this study can be found in online repositories. All sequence read data from the current study were deposited in the NCBI database as Short Read Archive (SRA) under BioProject ID PRJNA1298945. Gene Bank https://www.ncbi.nlm.nih.gov/bioproject/PRJNA642970/ (BioProject ID PRJNA642970) (24).

Ethics statement

The animal studies were approved by Lethbridge Research Centre Animal Care and Use Committee (Protocol #1641, Jan 18th, 2017) and was conducted according to the Canadian Council of Animal Care Guidelines. All isolates were obtained from this approved study. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.

Author contributions

SA-L: Formal analysis, Visualization, Data curation, Methodology, Writing – original draft, Conceptualization. RZ: Conceptualization, Methodology, Writing – review & editing, Software, Visualization, Data curation. RO-P: Formal analysis, Software, Data curation, Writing – review & editing. TS: Data curation, Writing – review & editing, Formal analysis. SA: Writing – review & editing, Methodology, Validation. AZ: Software, Writing – review & editing, Methodology, Resources. S-e-ZZ: Formal analysis, Data curation, Writing – review & editing, Methodology. MJ: Conceptualization, Funding acquisition, Supervision, Resources, Writing – review & editing. TM: Writing – review & editing, Supervision, Funding acquisition, Conceptualization, Resources, Project administration.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This study was made possible by the Saskatchewan Agricultural Development Fund (Grant #20210814), the Canadian Cattlemen’s Association, Beef Cattle Research Council Division (Grant #ANH.30.17), and the Beef Cattle Research Council (Grant #ANH. 16.21). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgments

Thanks to Curtis Claassen, and Chloe Brennan (AAFC, Lethbridge Research and Development Centre) for their help with mycoplasmas DNA extraction/standardization and PCR assays; to Dr. Erik Baranowski (Institut national derecherche pour l’Agriculture, l’alimentation et l’environnement, INRAE, France) for kindly sharing the pMT85 plasmids; to Dr. Christine Citti and Dr. Florence Tardy (INRAE and L’Université de Lyon, France) for sharing their expertise in the mycoplasmas field; to Dr. John Devenish (CFIA, Canada) for providing the M. agalactiae reference strain PG2 (NCTC 10123); and to Multus Biotechnology (London, UK) for kindly providing Proliferum samples.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that Generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fvets.2026.1719776/full#supplementary-material

References

1. USDA–APHIS–VS–CEAH–NAHMS. United States Department of Agriculture (USDA). Part IV: Health and health management on U.S. feedlots with a capacity of 1,000 or more head. Fort Collins, CO: (2013).

Google Scholar

2. Kumar, R, Register, K, Christopher-Hennings, J, Moroni, P, Gioia, G, Garcia-Fernandez, N, et al. Population genomicanalysis of Mycoplasma bovis elucidates geographical variations and genes associated with host-types. Microorganisms. (2020) 8:1561

Google Scholar

3. Griffin, D, Chengappa, MM, Kuszak, J, and McVey, DS. Bacterial pathogens of the bovine respiratory disease complex. Vet Clin North Am Food Anim Pract. (2010) 26:381–94. doi: 10.1016/j.cvfa.2010.04.004,

PubMed Abstract | Crossref Full Text | Google Scholar

4. Hayajneh, FMF, Ahmed, Z, Khatoon, A, Saleemi, MK, Arshad, MI, and Gul, ST. Epidemiological investigations of Mycoplasma bovis-associated mastitis in dairy animals along with analysis of interleukin-6 (IL-6) as a potential diagnostic marker. Int J Vet Sci. (2023) 1:120–6.

Google Scholar

5. Calcutt, MJ, Lysnyansky, I, Sachse, K, Fox, LK, Nicholas, RAJ, and Ayling, RD. Gap analysis of Mycoplasma bovis disease, diagnosis and control: an aid to identify future development requirements. Transbound Emerg Dis 2018;65 Suppl:91–109.

Google Scholar

6. Jelinski, M, Kinnear, A, Gesy, K, Andres-Lasheras, S, Zaheer, R, Weese, S, et al. Antimicrobial sensitivity testing of Mycoplasma bovis isolates derived from western Canadian feedlot cattle. Microorganisms. (2020) 8:124

Google Scholar

7. Dudek, K, and Szacawa, E. Mycoplasma bovis infections: occurrence, pathogenesis, diagnosis and control. Pathogens. (2020) 9:640

Google Scholar

8. Perez-Casal, J. Pathogenesis and virulence of mycoplasma bovis. Vet Clin North Am Food Anim Pract. (2020) 36:269–78. doi: 10.1016/j.cvfa.2020.02.002,

PubMed Abstract | Crossref Full Text | Google Scholar

9. Andrés-Lasheras, S, Ha, R, Zaheer, R, Lee, C, Booker, CW, Dorin, C, et al. Prevalence and risk factors associated with antimicrobial resistance in bacteria related to bovine respiratory disease—a broad cross-sectional study of beef cattle at entry into Canadian feedlots. Front Vet Sci. (2021) 8:1

Google Scholar

10. Munita, JM, and Arias, CA. Mechanisms of antibiotic resistance. Microbiol Spectr. (2016) 4, 1–24. doi: 10.1128/microbiolspec.VMBF-0016-2015

Crossref Full Text | Google Scholar

11. Wozniak, RA, and Waldor, MK. Integrative and conjugative elements: mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat Rev Microbiol. (2010) 8:552–63. doi: 10.1038/nrmicro2382,

PubMed Abstract | Crossref Full Text | Google Scholar

12. Guglielmini, J, Quintais, L, Garcillan-Barcia, MP, de la Cruz, F, and Rocha, EP. The repertoire of ICE in prokaryotes underscores the unity, diversity, and ubiquity of conjugation. PLoS Genet. (2011) 7:e1002222. doi: 10.1371/journal.pgen.1002222,

PubMed Abstract | Crossref Full Text | Google Scholar

13. Citti, C, Dordet-Frisoni, E, Nouvel, LX, Kuo, CH, and Baranowski, E. Horizontal gene transfers in mycoplasmas (Mollicutes). Curr Issues Mol Biol. (2018) 29:3–22. doi: 10.21775/cimb.029.003,

PubMed Abstract | Crossref Full Text | Google Scholar

14. Chai, Z, Guo, Z, Chen, X, Yang, Z, Wang, X, Zhang, F, et al. Comprehensive profiling of integrative conjugative elements (ICEs) in Mollicutes: distinct catalysts of gene flow and genome shaping. NAR Genom Bioinform. (2025) 7:lqaf083

Google Scholar

15. Marenda, M, Barbe, V, Gourgues, G, Mangenot, S, Sagne, E, and Citti, C. A new integrative conjugative element occurs in Mycoplasma agalactiae as chromosomal and free circular forms. J Bacteriol. (2006) 188:4137–41.

PubMed Abstract | Google Scholar

16. Tardy, F, Mick, V, Dordet-Frisoni, E, Marenda, MS, Sirand-Pugnet, P, Blanchard, A, et al. Integrative conjugative elements are widespread in field isolates of Mycoplasma species pathogenic for ruminants. Appl Environ Microbiol. (2015) 81:1634–43. doi: 10.1128/AEM.03723-14,

PubMed Abstract | Crossref Full Text | Google Scholar

17. Stanford, K, Zaheer, R, Klima, C, McAllister, T, Peters, D, Niu, YD, et al. Antimicrobial resistance in members of the bacterial bovine respiratory disease complex isolated from lung tissue of cattle mortalities managed with or without the use of antimicrobials. Microorganisms. (2020) 8:288

Google Scholar

18. Dordet-Frisoni, E, Sagne, E, Baranowski, E, Breton, M, Nouvel, LX, Blanchard, A, et al. Chromosomal transfers in mycoplasmas: when minimal genomes go mobile. mBio. (2014) 5:e01958. doi: 10.1128/mBio.01958-14,

PubMed Abstract | Crossref Full Text | Google Scholar

19. Derriche, M, Nouvel, LX, Gaudino, M, Sagne, E, Simon, E, Robert, H, et al. Bacterial conjugation in the ruminant pathogen Mycoplasma agalactiae is influenced by eukaryotic host factors. Appl Environ Microbiol. (2025):e0086825

Google Scholar

20. Faucher, M, Nouvel, LX, Dordet-Frisoni, E, Sagne, E, Baranowski, E, Hygonenq, MC, et al. Mycoplasmas under experimental antimicrobial selection: the unpredicted contribution of horizontal chromosomal transfer. PLoS Genet. (2019) 15:e1007910. doi: 10.1371/journal.pgen.1007910,

PubMed Abstract | Crossref Full Text | Google Scholar

21. Sagne, E, Citti, C, and Dordet-Frisoni, E. Bacterial conjugation protocol for ruminant mycoplasmas. Bio Protoc. (2021) 11:e3893. doi: 10.21769/BioProtoc.3893,

PubMed Abstract | Crossref Full Text | Google Scholar

22. Baranowski, E, Dordet-Frisoni, E, Sagne, E, Hygonenq, MC, Pretre, G, Claverol, S, et al. The integrative conjugative element (ICE) of Mycoplasma agalactiae: key elements involved in horizontal dissemination and influence of coresident ICEs. MBio. (2018) 9:e00873-18. doi: 10.1128/mBio.00873-18,

PubMed Abstract | Crossref Full Text | Google Scholar

23. Dordet Frisoni, E, Marenda, MS, Sagne, E, Nouvel, LX, Guerillot, R, Glaser, P, et al. ICEA of Mycoplasma agalactiae: a new family of self-transmissible integrative elements that confers conjugative properties to the recipient strain. Mol Microbiol. (2013) 89:1226–39.

Google Scholar

24. Kinnear, A, McAllister, TA, Zaheer, R, Waldner, M, Ruzzini, AC, Andres-Lasheras, S, et al. Investigation of macrolide resistance genotypes in Mycoplasma bovis isolates from Canadian feedlot cattle. Pathogens. (2020) 9:622

Google Scholar

25. Community TG. The galaxy platform for accessible, reproducible, and collaborative data analyses: 2024 update. Nucleic Acids Res. (2024) 52:W83–94.

Google Scholar

26. Andrews, S. FastQC. (2015). Available online at: https://qubeshub.org/resources/fastqc (Accessed April 23, 2025).

Google Scholar

27. Bolger, AM, Lohse, M, and Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. (2014) 30:2114–20.

Google Scholar

28. Seemann, T. (2016). Shovill. Available online at: https://github.com/tseemann/shovill (Accessed January 10, 2025).

Google Scholar

29. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. (2014) 30:2068–9. doi: 10.1093/bioinformatics/btu153,

PubMed Abstract | Crossref Full Text | Google Scholar

30. Triebel, S, Sachse, K, Weber, M, Heller, M, Diezel, C, Holzer, M, et al. De novo genome assembly resolving repetitive structures enables genomic analysis of 35 European Mycoplasmopsis bovis strains. BMC Genomics. (2023) 24:548. doi: 10.1186/s12864-023-09618-5,

PubMed Abstract | Crossref Full Text | Google Scholar

31. Garcia-Galan, A, Baranowski, E, Hygonenq, MC, Walch, M, Croville, G, Citti, C, et al. Genome mosaicism in field strains of Mycoplasma bovis as footprints of in-host horizontal chromosomal transfer. Appl Environ Microbiol. (2022) 88:e0166121. doi: 10.1128/AEM.01661-21,

PubMed Abstract | Crossref Full Text | Google Scholar

32. Ambroset, C, Peticca, A, Tricot, A, and Tardy, F. Genomic features of Mycoplasma bovis subtypes currently circulating in France. BMC Genomics. (2022) 23:603. doi: 10.1186/s12864-022-08818-9,

PubMed Abstract | Crossref Full Text | Google Scholar

33. Andres-Lasheras, S, Zaheer, R, Ha, R, Lee, C, Jelinski, M, and McAllister, TA. A direct qPCR screening approach to improve the efficiency of Mycoplasma bovis isolation in the frame of a broad surveillance study. J Microbiol Methods. (2020) 169:105805

Google Scholar

34. Pfaffl, MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. (2001) 29:e45. doi: 10.1093/nar/29.9.e45,

PubMed Abstract | Crossref Full Text | Google Scholar

35. Ayling, RD, Rosales, RS, Barden, G, and Gosney, FL. Changes in antimicrobial susceptibility of Mycoplasma bovis isolates from Great Britain. Vet Rec. (2014) 175:486. doi: 10.1136/vr.102303,

PubMed Abstract | Crossref Full Text | Google Scholar

36. Siguier, P, Gourbeyre, E, Varani, A, Ton-Hoang, B, and Chandler, M. MDNA3-0030-2014.Everyman's guide to bacterial insertion sequences. Microbiol Spectr. (2015) 3. doi: 10.1128/microbiolspec.mdna3-0030-2014

Crossref Full Text | Google Scholar

37. Siguier, P, Gourbeyre, E, and Chandler, M. Bacterial insertion sequences: their genomic impact and diversity. FEMS Microbiol Rev. (2014) 38:865–91. doi: 10.1111/1574-6976.12067,

PubMed Abstract | Crossref Full Text | Google Scholar

38. Tempel, S, Bedo, J, and Talla, E. From a large-scale genomic analysis of insertion sequences to insights into their regulatory roles in prokaryotes. BMC Genomics. (2022) 23:451. doi: 10.1186/s12864-022-08678-3,

PubMed Abstract | Crossref Full Text | Google Scholar

39. Amram, E, Borovok, I, Nachum-Biala, Y, Ayling, R, Lerner, U, Harrus, S, et al. High prevalence of diverse insertion sequences within the rRNA operons of Mycoplasma bovis. Appl Environ Microbiol. (2016) 82:6386–94.

Google Scholar

40. Lysnyansky, I, Calcutt, MJ, Ben-Barak, I, Ron, Y, Levisohn, S, Methe, BA, et al. Molecular characterization of newly identified IS3, IS4 and IS30 insertion sequence-like elements in Mycoplasma bovis and their possible roles in genome plasticity. FEMS Microbiol Lett. (2009) 294:172–82. doi: 10.1111/j.1574-6968.2009.01562.x,

PubMed Abstract | Crossref Full Text | Google Scholar

41. Delavat, F, Miyazaki, R, Carraro, N, Pradervand, N, and van der Meer, JR. The hidden life of integrative and conjugative elements. FEMS Microbiol Rev. (2017) 41:512–37. doi: 10.1093/femsre/fux0008,

PubMed Abstract | Crossref Full Text | Google Scholar

42. Saini, V, McClure, JT, Leger, D, Dufour, S, Sheldon, AG, Scholl, DT, et al. Antimicrobial use on Canadian dairy farms. J Dairy Sci. (2012) 95:1209–21. doi: 10.3168/jds.2011-4527,

PubMed Abstract | Crossref Full Text | Google Scholar

43. Waldner, CL, Parker, S, Gow, S, Wilson, DJ, and Campbell, JR. Antimicrobial usage in western Canadian cow-calf herds. Can Vet J. (2019) 60:255–67.

Google Scholar

44. Headd, B, and Bradford, SA. Physicochemical factors that favor conjugation of an antibiotic resistant plasmid in non-growing bacterial cultures in the absence and presence of antibiotics. Front Microbiol. (2018) 9:2122

Google Scholar

45. Cummins, EP, Selfridge, AC, Sporn, PH, Sznajder, JI, and Taylor, CT. Carbon dioxide-sensing in organisms and its implications for human disease. Cell Mol Life Sci. (2014) 71:831–45.

Google Scholar

46. Nicholas, R, and Baker, S. Mycoplasma protocols. Totowa, NJ: Humana Press Inc (1998).

Google Scholar

47. CLSI document M100. Performance standards for antimicrobial susceptibility testing. Totowa, NJ: Wayne, PA: Clinical Laboratory Standards Insititue (2025).

Google Scholar

48. Nicholas, R, Ayling, R, and Mc Auliffe, L. Mycoplasma diseases of ruminants. United Kingdom: CAB International (2008).

Google Scholar

49. Munoz, G, and Sotomayor, P. Conditions for growing Mycoplasma canadense and Mycoplasma verecundum in a serum-free medium. Appl Environ Microbiol. (1990) 56:2259–61. doi: 10.1128/aem.56.7.2259-2261.1990,

PubMed Abstract | Crossref Full Text | Google Scholar

50. Burgos, R, Garcia-Ramallo, E, Shaw, D, Lluch-Senar, M, and Serrano, L. Development of a serum-free medium to aid large-scale production of Mycoplasma-based therapies. Microbiol Spectr. (2023) 11:e0485922. doi: 10.1128/spectrum.04859-22

Crossref Full Text | Google Scholar

Glossary

AMR - antimicrobial resistance

ARG - antimicrobial resistance gene

BR - biological replicate

BRD - bovine respiratory disease

BUSCO - Benchmarking Universal Single-Copy Orthologs

CDS - Coding DNA Sequence

CFU - colony forming unit

cMICE - circular mycoplasma integrative and conjugative element

cPCR - conventional PCR

CT - chromosomal transfer

DNPS - deep nasopharyngeal swab sample

FBS - fetal bovine serum

gDNA - genomic DNA

GEN - gentamicin

HGT - horizontal gene transfer

H-MICE - hominis-type MICE

ICE - integrative and conjugative element

IME - integrative and mobilizable element

IR - inverted repeat

MGE - mobile genetic element

MICE - mycoplasma integrative and conjugative element

MJC - Murray Jelinski collection

pDNA - plasmid DNA

pMT85 - plasmid pMT85

PURO - puromycin

qPCR - quantitative PCR

S-MICE - spiroplasma-type MICE

STC - same truck cluster

TET - tetracycline

TMC - Tim McAllister collection

Tn - transposon

vICE - vestigial ICE.