ORIGINAL RESEARCH article

Front. Cell Dev. Biol., 11 June 2021

Sec. Molecular and Cellular Oncology

Volume 9 - 2021 | https://doi.org/10.3389/fcell.2021.671211

Identification of ZNF26 as a Prognostic Biomarker in Colorectal Cancer by an Integrated Bioinformatic Analysis

  • JL

    Jiaxin Liu 1

  • YL

    Yimin Li 1

  • YG

    Yaqi Gan 1

  • QX

    Qing Xiao 1

  • RT

    Ruotong Tian 2

  • GS

    Guang Shu 2

  • GY

    Gang Yin 1,3*

  • 1. Department of Pathology, Xiangya Hospital, School of Basic Medical Sciences, Central South University, Changsha, China

  • 2. School of Basic Medical Sciences, Central South University, Changsha, China

  • 3. China-Africa Research Center of Infectious Diseases, School of Basic Medical Sciences, Central South University, Changsha, China

Abstract

The dysregulation of transcriptional factors (TFs) leads to malignant growth and the development of colorectal cancer (CRC). Herein, we sought to identify the transcription factors relevant to the prognosis of colorectal cancer patients. We found 526 differentially expressed TFs using the TCGA database of colorectal cancer patients (n = 544) for the differential analysis of TFs (n = 1,665) with 210 upregulated genes as well as 316 downregulated genes. Subsequently, GO analysis and KEGG pathway analysis were performed for these differential genes for investigating their pathways and function. At the same time, we established a genetic risk scoring model for predicting the overall survival (OS) by using the mRNA expression levels of these differentially regulated TFs, and defined the CRC into low and high-risk categories which showed significant survival differences. The genetic risk scoring model included four high-risk genes (HSF4, HEYL, SIX2, and ZNF26) and two low-risk genes (ETS2 and SALL1), and validated the OS in two GEO databases (p = 0.0023 for the GSE17536, p = 0.0193 for the GSE29623). To analyze the genetic and epigenetic changes of these six risk-related TFs, a unified bioinformatics analysis was conducted. Among them, ZNF26 is progressive in CRC and its high expression is linked with a poor diagnosis as well. Knockdown of ZNF26 inhibits the proliferative capacity of CRC cells. Moreover, the positive association between ZNF26 and cyclins (CDK2, CCNE2, CDK6, CHEK1) was also identified. Therefore, as a novel biomarker, ZNF26 may be a promising candidate in the diagnosis and prognostic evaluation of colorectal cancer.

Introduction

Colorectal cancer is the third most common cancer form in the world, accounting for nearly 600,000 deaths per year (Ferlay et al., 2010; Jemal et al., 2011). Colorectal cancer develops as a result of the accumulation of genetic and epigenetic changes over time (Pritchard and Grady, 2011). It has been one of the most common causes of cancer-related deaths due to a low survival rate, notably in patients in the last stages (Zhang et al., 2017). Therefore, to improve tumor therapy and patient survival, new diagnostic, prognostic, and therapeutic biomarkers must be investigated and employed (Song et al., 2018). Routine clinical pathology risks and various prognostic aspects including age, tumor status, grade, and CEA levels determine the CRC treatment strategies and their clinical outcomes (Hsing et al., 1998; He et al., 2018).

Transcription factors are a class of proteins that bind to unique sequences upstream of a target gene’s 5′ end, which is commonly referred to as a promoter region (Beato and Eisfeld, 1997; Sikder and Kodadek, 2005). Hence, these transcription factors can obstruct or strengthen the expression of genes and assure the expression of target genes at the definite times (Eckersley-Maslin et al., 2018). Gene transcription, which regulates all cellular functions, can be controlled by epigenetic modifications. Furthermore, epigenetic modification can also occur on the gene loci encoding certain transcription factors (TFs), thus making them a new regulator of cellular functions and biological processes (Wu et al., 2016). In a normal state, basic biological activities, which include differentiation, development, and metabolism also involve the promoter-specific transcription factors (Brown and Goldstein, 1997; Kang and Malhotra, 2015). Deregulation of such transcriptional factors has been linked to the formation of cancer and its deadly progression (Cao et al., 2018).

This study aimed to learn more about the biology of TFs in CRC. Up to this level, the expression of TF, already contained in the Animal TFDB database in colorectal cancer, was analyzed. Through the GO and KEGG pathways analyses, we investigated the pathways and functions in which differentially expressed TFs may be involved. At the same time, a set of CRC-specific TFs was identified in which the TF prognostic features were obtained. By analyzing various public data sets, we claimed that a further analysis of the expression and sequence changes of these differentially regulated TFs with different regulations may help to alter the expressions in CRC. Additionally, ZNF26 belongs to the zinc finger protein family, and we discovered that its high expression is linked to a poor prognosis. Moreover, ZNF26 is positively associated with cyclins (CDK2, CCNE2, CDK6, and CHEK1).

Materials and Methods

TCGA Data Set Selection and Data Processing

The GDC Data Portal1 was used to collect miRNAs, mRNA data, and related clinical information from CRC patients in the TCGA project. After that, R-studio software 3.5.3 was used for examining the data for 525 tumor tissue samples and 44 normal tissue samples (Clinical information of four patients was missing). According to the pathologic stage, the number of tumor tissues in stages I, II, III, and IV were 93, 206, 148, and 78, respectively. Using the “edgeR package” of p-value < 0.05 and | log2FC| > 0.5 as a guideline for screening DEGs and DEMs, mRNAs (DEGs) and miRNAs (DEMs) were found to be differentially expressed. The volcano plot and heat map showed the expression patterns between the cancer and normal samples. The study followed the TCGA guidelines.

GEO Database Validation and Survival Analysis

Two distinct data sets were acquired from the directory of the GEO (GSE17536, GSE29623)2 for validating the prognostic potential of genetic risk score. Three microarray expression profile datasets, GSE32323, GSE39582, and GSE74602, were also downloaded from the GEO database to validate the differentially expressed TFs.

The GSE17536 was submitted by Smith et al. (2010) and included 177 CRC patients. The GSE29623 was submitted by Chen et al. (2012) and included 65 CRC patients. The GSE32323, including 17 combos of carcinogenic and non-carcinogenic tissues from CRC subjects, was submitted by Khamas et al. (2012). The GSE39582 was submitted by Marisa et al. (2013) and included 566 CRC patients and 19 non-tumoral colorectal mucosa tissues. The GSE74602 was submitted by Pek et al. (2017) and included 30 CRC patients and 30 normal tissues.

Cataloging of Transcriptional Factors

The Animal Transcription Factor DataBase (AnimalTFDB, 3) is a resource directed to come up with the most far-reaching and precise knowledge of transcription factors (Hu et al., 2019). A total of 1,665 transcription factors were downloaded from AnimalTFDB.

Functional Enrichment Analysis

To investigated the prognostic function of the differentially expressed TFs, the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were carried out. Enrichment analyses for the DEGs were studied in the “clusterProfiler” package of R software (Green et al., 1988). Certain processes like biological process, cellular component, and molecular function have been wrapped by the results of the GO analysis. The standards used in the analysis were Gene Ontology terms and Kyoto Encyclopedia of Genes and Genomes pathways with a P-value < 0.05.

Genetic Risk Score Model Construction

For more research and development of a genetic risk score, we chose the differentially regulated TFs first. To assess the connection between the expression of the differentially regulated TFs and their comprehensive durability, a univariate Cox proportional hazards regression analysis was carried out. The top ten important prognosis-related genes from the univariate Cox regression analysis were then considered candidate variables, and they were further investigated using a stepwise multivariate Cox proportional hazards regression analysis to predict each individual’s risk score (Lee et al., 2019).

Copy Number Variation

The percentage of samples in which a particular RBP was amplified or deleted was calculated using the data from cBioPortal4.

Methylation Data Analysis

Analysis of the level of methylation derived from the TCG database (Illumina Human Methylation 450 platform) was carried out via the linkedomics website5. The prediction of the CpG island of the ZNF26 promoter was carried out with MethPrimer6.

Prediction of Gene Targets of Deregulated microRNAs in CRC

StarBase7 was used for prognosticating the gene targets of miRNAs.

miRNA-miRNA, Protein-Protein Interactions Network Prediction

The miRNA−mRNA relationship, protein-protein interaction network was predicted using the CytoscapeVersion3.5.3 software.

Patients and Samples

The CRC tissues and adjacent normal tissues were obtained from Xiangya Hospital of Central South University. This study was approved by the ethics committee of Xiangya Hospital. The patients were informed, and signed an informed consent form.

Cell Lines and Cell Culture

The normal human colon mucosal epithelial cell line NCM460 and human colorectal cell lines HCT116, SW480, and SW620 used in this study were purchased from the American Type Culture Collection (ATCC; 8). The colorectal cell lines HCT8, Caco2, and RKO were kindly provided by Professor Wancai Yang (Key Laboratory of Precision Oncology of Shandong Higher Education, Institute of Precision Medicine, Jining Medical University). The NCM460, SW480, Caco2, HCT116, HCT8, SW620, and RKO cells were maintained in RPMI-1640 (Biological industries) with 10% FBS. All cells were cultured at 37°C with 5% CO2.

Cell Transfection

Small interfering RNA (siRNA) targeting ZNF26 was purchased from RiboBio (Guangzhou, China). The sequence of ZNF26 siRNA is: ZNF26 si#1: GAAGTCTCCATTCGTTGTA, ZNF26 si#2: CTAGGAAGGCATCACTTCA. siRNA was transfected with jetPRIME DNA and siRNA transfection reagent (PolyPlus-transfection). Cells were harvested 48 h after transfection, and the knockdown efficiency was tested by quantitative reverse transcription polymerase chain reaction (qRT-PCR).

RNA Extraction and Quantitative Reverse Transcription Polymerase Chain Reaction

Trizol reagent (Vazyme) was used for extracting the total RNA. Go Script reverse transcription system (Promega) was used for performing reverse transcription PCR. On the ABI Prism 700 thermal cycler, real-time qPCR was performed using GoTaq qPCR Master Mix (Promega). The following is the primer sequence: ZNF26 (forward primer: TCAGGTCACAGCTCATTGTCCATC; reserved pr imer: CCACATTCGCTGCATTCATACGG); CDK2 (forward pri mer: TGCCCTTTCACTGCCTATGG; reserved primer: GAGG AAAGCCAAGACCCACA); CCNE2 (forward primer: GCCGA GCGGTAGCTGGTC; reserved primer: GGGCTGCTG CTTAGCTTGTAAA); CDK6 (forward primer: ACGTGGT CAGGTTGTTT; reserved primer: TTTATGGTTTCAGTG GG); CHEK1 (forward primer: TCATCCATTTCTAACA AATTCACTT; reserved primer: TGGGCTATCAATGGAA GAAAA); GAPDH (forward primer: CTGGGCTAC ACTGAGCACC; reserved primer: AAGTGGTCGTT GAGGGCAATG). GAPDH was used as an internal control.

Cell Proliferation Assay

The cells (3,000/well) were cultured in a 96-well plate for 24 h, and the cell proliferation ability was investigated using the Cell Counting Kit 8 (CCK-8). For the colony formation assay, a 12-well plate containing 200–300 infected RKO cells was used. After 10–14 days of incubation, the cells were fixed with 4% paraformaldehyde, stained with crystal violet, photographed, and then counted. The EdU (RiboBio, Guangzhou, China) assay was performed according to the standard protocol. All experiments were repeated at least three times.

Cell Cycle Analysis

After 48 h of specific interference with ZNF26 in RKO cells with two siRNAs, the cells were collected and resuspended in 1 × PBS. The cells were then fixed in 70% ethanol overnight. The next day, after washing with PBS solution and centrifugation, the cells were stained with propidium iodide (PI) and analyzed by the FACSCalibur system (BD Biosciences, San Jose, California, United States).

Statistical Analysis

We used R Studio (R version 3.5.2) for the statistical analysis. For univariate and multivariate analysis, SPSS version 20.0 was used. Graph Pad Prism 8.0 version for Windows was used to carry out the Kaplan Meier survival analysis. P < 0.05 was considered statistically significant.

Results

Integrated Genomic Analysis Reveals Genetic and Epigenetic Changes in TFs in Colorectal Cancer

We obtained 1,665 transcription factors from Animal TFDB to elucidate different aspects of TF biology in CRC. To recognize the transcription factors that are modified in CRC due to the genetic and epigenetic effects, we performed an integrated bioinformatics analysis (Figure 1). Using these methods, we identified that TFs are differentially expressed in CRC. COX regression analysis was also performed to further investigate the relationship between the TFs and prognosis, namely, TFs were associated with CRC transformation and progression.

FIGURE 1

Identification of the Differentially Regulated TFs and Functional Annotation

The Animal Transcription Factor DataBase (AnimalTFDB, see text footnote 3) is a resource aimed to have the most far-reaching and authentic knowledge for TFs (Hu et al., 2019). For further analysis, a total of 1,665 human TFs were identified from the AnimalTFDB. The “limma” package of the R software was used to evaluate the gene expression profiling of the TCGA samples, which included 568 CRC samples and 44 normal samples (Ritchie et al., 2015). A total of 525 TFs were differentially regulated between the normal tissues and CRC tissues. The volcano plot of each gene expression profile data has been shown in Figure 2A. A total of 210 progressive and 316 retrogressive DEGs were recognized in the CRC samples in contrast with the normal samples (Figure 2B).

FIGURE 2

We carried out the GO function and KEGG pathway to further investigate these differentially expressed TFs. The “cluster Profiler” package of the R software was used to examine the enrichment analyses for the upregulated and downregulated DEGs (Green et al., 1988).

In the biological process group, the progressive genes are principally intensified in regionalization, pattern specification procedure, embryonic organ development, anterior/posterior pattern specification as well as appendage development. As for the enrichment of retrogressive genes, steroid hormone intervenes with the signaling pathway, cell fate commitment, cellular feedback to steroid hormone stimulus, embryonic organ development, as well as embryonic organ development have been exhibited.

In another sort of analysis focusing on the GO cell components, upregulated transcription factors were mainly enriched in the transcription factors, nuclear transcription factor network, RNA polymerase II transcription factor network, heterochromatin, and nuclear chromatin, while the downregulated TFs are enriched in the transcription factor complex, nuclear chromatin, nuclear transcription factor network, RNA polymerase II transcription factor complex, and fibrillar center.

Besides, in the GO cell function analysis, upregulated TFs are significantly enriched in the transcription factor activity, DNA-binding transcriptional repressor activity, DNA-binding transcriptional activator activity, proximal promoter DNA-binding transcription repressor activity, and proximal promoter DNA-binding transcription activator activity. Meanwhile, downregulated TFs are enriched in the DNA-binding transcriptional activator activity, transcription factor activity, proximal promoter DNA-binding transcription, DNA-binding transcription repressor activity, and DNA-binding transcription repressor activity (Figures 2C,D). These significantly enriched GO terms can aid in having a better understanding on the roles of these differentially regulated TFs in the initiation and progression of CRC.

At the same time, the KEGG pathway analysis was carried out on the up- and downregulated TFs. Upregulated TFs have enriched in herpes simplex virus type 1 infection, transcriptional misregulation in cancer, TGF-β signaling pathway, maturity onset diabetes of the young, and Cellular senescence, while downregulated TFs are enriched in herpes simplex virus type 1 infection, transcriptional misregulation in cancer, maturity onset diabetes of the young, parathyroid hormone synthesis, secretion, and action, Th17 cell differentiation (Figures 2E,F).

Genetic Risk Score Model Construction

From the prognostic perspective, we further studied the differentially regulated TFs in CRC in the TCGA-CRC training dataset. The top 10 significant prognostic genes, ETS2, LBX2, HSF4, SALL1, SIX4, HEYL, POU6F1, SIX2, ZNF26, and TLX2, were sought out by a univariate Cox regression (p < 0.001) (Table 1). To further select the TFs with the highest prognostic value, a multivariate Cox regression analysis was performed for investigating its impact, and six hub TFs were selected for establishing a risk model for CRC patients, including EST2, HSF4, SALL1, HEYL, SIX2, and ZNF26. The hazard ratios of the four genes, HSF4, HEYL, SIX2, and ZNF26, were positive, which show their negative match with the prognosis. For ETS2 and SALL1, however, the ratios were negative, indicating that they might be positively related to the prognosis (Figure 3). The following genetic risk score model was used to calculate the risk score of each patient:

TABLE 1

GeneHazard Ratio (HR)95% CI of HRP-value
ETS20.6084(0.4785–0.7735)0
LBX21.9164(1.3474–2.7256)0.0003
HSF41.4551(1.1822–1.7910)0.0004
SALL10.6147(0.4689–0.8057)0.0004
SIX41.4924(1.1824–1.8838)0.0008
HEYL1.5239(1.1825–1.9638)0.0011
POU6F11.8114(1.2650–2.594)0.0012
SIX21.3201(1.1159–1.5618)0.0012
ZNF261.8475(1.2652–2.698)0.0015
TLX21.9828(1.2931–3.0403)0.0017

Top 10 notable prognostic genes disclosed by univariate Cox proportional hazards regression.

ETS2, ETS proto-oncogene 2; LBX2, adybird homeobox 2; HSF4, heat shock transcription factor 4; SALL1, spalt like transcription factor 1; SIX4, SIX homeobox 4; HEYL, hes related family bHLH transcription factor with YRPW motif like; POU6F1, POU class 6 homeobox 1; SIX2, SIX homeobox 2; ZNF26, zinc finger protein 26; TLX2, T cell leukemia homeobox 2.

FIGURE 3

Based on the median risk score, the CRC patients with risk scores higher than the median were defined as a high-risk group, and risk scores lower than the median were defined as a low-risk group in the TCGA-CRC training dataset. The Kaplan-Meier curve showed that the patients in the high-risk group had a worse prognosis compared to those in the low-risk group (P < 0.001) (Figure 4A). To verify whether the six TFs model exhibited a similar predictive value in the other CRC cohorts, a similar formula was used to generate the risk score of each patient in the two OS validation datasets (GSE17536 and GSE29623). The results showed significant prognostic values were p = 0.0023 (Figure 4B) and p = 0.0193 (Figure 4C), respectively. The AUC of the 1 year, 3 years, and 5 years ROC curves were 0.74, 0.74, and 0.7, respectively, which advocated that our risk model was accurate in the forecasting of survival in the testing data set (Figure 4D). The assigning of risk score, survival status, and the interpretation of six genes were also predicted for each patient (Figures 4E–G).

FIGURE 4

To further confirm the prognostic role of the genetic risk score mode in CRC patients, we performed the univariate and multivariate survival analysis. Univariate analysis identified eight prognostic factors: ages (≥60 vs. <60), T (T3–T4 vs. Tis–T2), N (N1–2 vs. N0), M (M1–2 vs. M0), Stage (III–IV vs. I–II), Kras mutation (mut vs. wt), CEA level (≥5 vs. <5 μg/ml), and Risk (high risk vs. low risk). Multivariate survival analysis further uncovered that age (p = 0.002), M stage (p = 0.044), TNM stage (0.017), CEA level (0.044), and the genetic risk score (<0.001) were separately prognostic of OS (Table 2).

TABLE 2

Risk factorsUnivariate investigation
Multivariate investigation
Hazard Ratio (95% CI)P-valueHazard Ratio (95% CI)P-value
Gender (male vs. female)0.913 (0.625–1.333)0.636
Age (≥60 vs. <60)1.681 (1.068–2.467)0.025*3.441 (1.576–7.515)0.002**
T (T3–T4 vs. Tis–T2)2.248 (1.170–4.319)0.015*1.378 (0.475–3.995)0.555
N (N1–2 vs. N0)2.811 (1.899–4.160)<0.001***0.306 (0.083–1.130)0.076
M (M1–2 vs. M0)4.529 (2.974–6.897)<0.001***2.224 (1.021–4.845)0.044*
Stage (III–IV vs. I–II)2.991 (1.981–4.514)<0.001***6.434 (1.398–29.616)0.017*
Kras mutation (mut vs. wt)1.951 (1.252–3.040)0.003**1.249 (0.521–2.993)0.618
CEA level (≥5 vs. <5 μg/ml)2.773 (1.646–4.672)<0.001***1.900 (1.018–3.545)0.044*
Risk (high risk vs. low risk)5.201 (3.170–8.533)<0.001***4.637 (2.222–9.680)< 0.001***

Univariate and multivariate investigation of clinic pathologic aspects for its comprehensive survival in Colorectal Cancer patients.

CI, confidential interval, *p < 0.05; **p < 0.01; ***p < 0.00.

Mechanism of Abnormal Expression of TFs in CRC

To further investigate the reason why these six TFs are expressed differently in CRC, we analyzed three possibilities, for instance: copy number variation, methylation, and mircoRNA. First, we analyzed the copy number variation from the TCGA database through the cBioPortal9. As for these six genes, the variation of copy number among CRC patients was not remarkable (Supplementary Material 1A). Meanwhile, analysis of the TCGA database using the linkedomics website (see text footnote 5) revealed that the expression of ETS2, SIX2, ZNF26, and HEYL were negatively correlated with DNA methylation (Figure 5A), while expression of the SALL1 and HSF4 were not (Supplementary Material 1B).

FIGURE 5

Since miRNAs play a role in RNA silencing or degradation and gene expression regulation after transcription by base-pairing with complementary sequences within mRNA molecules and then regulating gene expression, we conducted the following research. First, we found that 321 microRNAs were upregulated and 312 were downregulated through the TCGA database for miRNA in CRC (Supplementary Material 1C). Then, the differentially expressed miRNAs contribute to predicting the targeting relationship with six TFs by using the starBase (see text footnote 7). As shown in Figure 5B, the network of miRNA and six TFs interactions were visualized in Cytoscape. The downregulated miRNAs in CRC are associated with the four upregulated transcription factors, namely, HSF4, HEYL, SIX2, and ZNF26. The upregulated miRNAs in CRC are associated with the downregulated transcription factors, namely, SALL1 and ETS2.

ZNF26 Is Linked With the Poor Outcomes of CRC Patients

After a validation and survival analysis on these six genes in GSE29623 and GSE17536, only ZNF26 with a high expression was found to be associated with the poor prognosis in patients (Figures 6A,B). The results showed that, in the TCGA database, ZNF26 was linked with the poor prognosis of patients (Figure 6C). To study the expression of ZNF26 in CRC tissues in detail, ZNF26 was found to be progressive in CRC through the TCGA database and GEO database analysis (GSE32323, GSE39582, and GSE74602) (Figure 6D). Next, we further verified the expression level of ZNF26 in CRC tissue samples by qRT-PCR. The results showed that, compared with adjacent normal intestinal mucosa tissues, the mRNA level of ZNF26 was significantly upregulated in CRC tissue (Figure 6E).

FIGURE 6

ZNF26 Is Positively Correlated With Cell Cycle-Related Proteins (CDK2, CCNE2, CDK6, and CHEK1)

To figure out the mechanism of ZNF26 function in CRC, GO analysis and KEGG analysis were performed on ZNF26 positively/negatively correlated (| R| > 0.3) genes.

Gene Ontology analysis revealed that the genes that are positively associated with ZNF26 were mainly enriched in the detection of the chemical stimulus involved in sensory perception, DNA conformation change, and chromosomal region, while the genes that are negatively associated with ZNF26 were mainly enriched in neutrophil-mediated immunity, neutrophil activation, and cell adhesion molecule binding (Supplementary Materials 2A,B).

Besides, through the KEGG pathway analysis, the genes that are positively associated with ZNF26 are enriched in Herpes simplex virus 1 infection, Olfactory transduction, and Ubiquitin mediated proteolysis, while the negatively related genes are enriched in Thermogenesis, Huntington’s disease, and Alzheimer’s disease (Supplementary Materials 2C,D).

The abnormality of the cell cycle played a major role in the pathogenesis of CRC (Gan et al., 2018). The mRNA expression of ZNF26 in colorectal cancer cell lines was detected by qRT-PCR (Figure 7A). We found that ZNF26 was highly expressed in the CRC cell lines, as compared with normal intestinal epithelial cells NCM460. Then, we used ZNF26 siRNA for specific silencing, and qRT-PCR to detect the transfection efficiency (Figure 7B). We explored the cell proliferation ability through CCK8 (Figure 7C) and cell plate cloning (Figure 7D). The analysis showed that knocking down ZNF26 significantly inhibited the proliferation and colony formation of RKO cells. The EdU experiment also confirmed the proliferation-promoting effect of ZNF26 in the CRC cell lines (Figure 7E). Overall, these findings provide evidence that knocking down ZNF26 can inhibit the proliferation of CRC cells. To evaluate the possible role of ZNF26 in the regulation of the cell cycle (Figure 7F), we analyzed the phase distribution of the cell cycle by a flow cytometric analysis. It was observed that the knockdown of ZNF26 efficiently brought about an increase in cell percentage in the G1 phase, and a decrease in cell percentage in the S phase.

FIGURE 7

Moreover, the TCGA database showed that ZNF26 was positively correlated with the cell cycle-related genes (Supplementary Material 2E). We also evaluated the cell cycle-related genes by the STRING online database and Cytoscape software for selecting the most effective ones (Supplementary Material 2F). In addition, the correlation between the Top4 gene and ZNF26 analyzed by the GEPIA database indicated that ZNF26 was positively correlated with CDK2, CCNE2, CDK6, and CHEK1 (Supplementary Material 2G). At the same time, after knocking down ZNF26 in the RKO cell line, the expression of these four genes was detected by qRT-PCR. The results showed that the knockdown of ZNF26 can significantly downregulate the expression of CDK2, CCNE2, CDK6, and CHEK1 (Figure 7G).

Discussion

Colorectal cancer is the third most common cancer in the world and the fourth highest cancer mortality (Torre et al., 2015; Connell et al., 2017). Despite the advances in CRC therapy through medical technology, surgical techniques, and chemotherapy, there has been no effective diagnostic method to monitor the tumor progression or recurrence (Issa and Noureddine, 2017; Yang et al., 2019). Recent studies demonstrated that TFs play a vital role in the spread of cancer, and transcription factor dysregulation can lead to malignant growth and the development of cancer (Daly, 2017; Songdej and Rao, 2017; Cao et al., 2018). However, few studies have focused on the characteristics of TFs in CRC. In this study, the expression of TFs and their significant role in the growth and progression of CRC were described, and a genetic risk scoring model was established.

In our analysis, we found 526 differentially regulated TFs in the CRC samples; of which, 40% were upregulated. Both the progressive and retrogressive TFs were explored in the Gene Ontology term enrichment analysis and Koyoto Encyclopedia of Genes and Genomes pathway analysis to provide a practical explanation. GO and KEGG analyses also showed that 526 differentially regulated TFs were significantly enriched in various cancer-related functions and pathways. These findings can aid our understanding of how transcription factors promote/suppress CRC.

We identified six prognostic-related transcription factors using the 526 differentially expressed TFs described above for the COX regression analysis. The genetic risk scoring model’s predictive ability was confirmed by the significant differences between the survival curves of the high-risk and low-risk groups shown in the genetic risk scoring model. Building on the GSE29623 and GSE17536 data sets, our genetic risk scoring model was validated to be versatile. ROC curve analysis also revealed that the differentially expressed genes could be an excellent early prediction on survival prognosis.

The combination of the mRNA expressions of HSF4, HEYL, SIX2, ZNF26, ETS2, and SALL was the basis of the genetic risk scoring model. SALL1, HSF4, SIX2, ETS2, and HEYL have been reported in tumors. For instance, SALL1 acted as a novel biomarker for the prognosis of early-stage head and neck cancer (Misawa et al., 2018). HSF4 could be used as a prognostic marker in CRC (Yang et al., 2017), while SIX2 might be a diagnostic and prognostic biomarker in Wilms’ tumor (Song et al., 2015). Also, the high expression of ETS2 predicted a poor prognosis in severe myeloid leukemia (Fu et al., 2017). Among them, ZNF26, SALL1, HEYL, and SIX2 have not yet been reported in CRC. Therefore, due to the identification and verification of the prognostic factors that can improve the treatment (Zhang et al., 2018b), we wonder to find out the underlying mechanisms of abnormally expressed TFs in CRC. Out of this, we have explored multiple reasons for the abnormal expression of TFs in CRC, including gene-level (Daly, 2017), methylation level (Bonder et al., 2017), and miRNA-mediated regulation (Zhang et al., 2018a). In cases where changes into TFs (including mutations) are known to cause cancer and other diseases, we analyzed the possible mutation sites of these TFs in CRC and found that the six TFs mutations (including deletions and amplifications) are not obvious. Changes in gene methylation may have a critical impact on gene expression (Bhargava et al., 2017). In our study, we found that ETS2, SIX2, ZNF26, HEYL were negatively correlated with DNA methylation. We used the six prognostic-related TFs to establish a common regulatory network with miRNAs in CRC where the expression of miRNAs was analyzed.

Based on GSE29623, GSE17536, GSE32323, GSE39582, and GSE74602, validating the expression and survival analysis of these six TFs proceeded. It was shown that ZNF26 was progressive in CRC, and its excessive interpretation foreboded the deficient prediction. The huge transcription factor family in the human genome is the zinc finger protein family; of which, ZNF26 is a prominent member (Jen and Wang, 2016). New studies show that the abnormal expression of ZNF proteins come up with tumorigenesis in different tumors, such as CRC (Yang et al., 2008), lung cancer (Lo et al., 2012), and ovarian cancer (Aslan et al., 2015). Currently, there are few studies on ZNF26, especially in tumors, which have not been reported yet. In this study, we confirmed that the expression level of ZNF26 in CRC tissues and cells is significantly upregulated, and knocking down ZNF26 can effectively inhibit cell proliferation. With biological prediction, it was shown that ZNF26 is positively correlated with cyclins (CDK2, CCNE2, CDK6, and CHEK1). More studies are needed to investigate the potential of the CRC-related TFs, especially ZNF26, for diagnosis, prognosis, and targeted therapy.

In conclusion, our research developed a TFs signature through a series of bioinformatics analyses, which proved to be an accurate independent prognosticator in CRC. Concurrently, we comprehensively view the six abnormally regulated TFs in CRC and mechanisms which may result in this abnormal regulation. Moreover, the elevated expression of ZNF26 has been demonstrated in CRC indicating a poor prognosis of patients. Hence, we tested the hypothesis that, as a novel biomarker, ZNF26 might be potentially valuable in the diagnosis and prognostic evaluation for colorectal cancer.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Author contributions

JL and YL designed the research studies and analyzed the data. JL wrote the manuscript. YG, QX, RT, and GS contributed to check the figures and manuscript. GY supervised the project. All authors read and approved the final manuscript.

Funding

This study was conducted with the support of the National Key R&D Program of China, Stem Cell and Translational Research (Grant No. 2016YFA0102000) and the National Natural Science Foundation of China (NSFC) (Grant No. 81572900).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2021.671211/full#supplementary-material

References

  • 1

    AslanB.MonroigP.HsuM. C.PenaG. A.Rodriguez-AguayoC.Gonzalez-VillasanaV.et al (2015). The ZNF304-integrin axis protects against anoikis in cancer.Nat. Commun.6:7351.

  • 2

    BeatoM.EisfeldK. (1997). Transcription factor access to chromatin.Nucleic Acids Res.2535593563. 10.1093/nar/25.18.3559

  • 3

    BhargavaS.PatilV.MahalingamK.SomasundaramK. (2017). Elucidation of the genetic and epigenetic landscape alterations in RNA binding proteins in glioblastoma.Oncotarget81665016668. 10.18632/oncotarget.14287

  • 4

    BonderM. J.LuijkR.ZhernakovaD. V.MoedM.DeelenP.VermaatM.et al (2017). Disease variants alter transcription factor levels and methylation of their binding sites.Nat. Genet.49131138.

  • 5

    BrownM. S.GoldsteinJ. L. (1997). The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor.Cell89331340. 10.1016/s0092-8674(00)80213-5

  • 6

    CaoJ.WangX.DaiT.WuY.ZhangM.CaoR.et al (2018). Twist promotes tumor metastasis in basal-like breast cancer by transcriptionally upregulating ROR1.Theranostics827392751. 10.7150/thno.21477

  • 7

    ChenD. T.HernandezJ. M.ShibataD.MccarthyS. M.HumphriesL. A.ClarkW.et al (2012). Complementary strand microRNAs mediate acquisition of metastatic potential in colonic adenocarcinoma.J. Gastrointest. Surg.16905912; discussion 912–903.

  • 8

    ConnellL. C.MotaJ. M.BraghiroliM. I.HoffP. M. (2017). the rising incidence of younger patients with colorectal cancer: questions about screening, biology, and treatment.Curr. Treat. Options Oncol.18:23.

  • 9

    DalyM. E. (2017). Transcription factor defects causing platelet disorders.Blood Rev.31110. 10.1016/j.blre.2016.07.002

  • 10

    Eckersley-MaslinM. A.Alda-CatalinasC.ReikW. (2018). Dynamics of the epigenetic landscape during the maternal-to-zygotic transition.Nat. Rev. Mol. Cell Biol.19436450. 10.1038/s41580-018-0008-z

  • 11

    FerlayJ.ShinH. R.BrayF.FormanD.MathersC.ParkinD. M. (2010). Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008.Int. J. Cancer12728932917. 10.1002/ijc.25516

  • 12

    FuL.FuH.WuQ.PangY.XuK.ZhouL.et al (2017). High expression of ETS2 predicts poor prognosis in acute myeloid leukemia and may guide treatment decisions.J. Transl. Med.15:159.

  • 13

    GanY.LiY.LiT.ShuG.YinG. (2018). CCNA2 acts as a novel biomarker in regulating the growth and apoptosis of colorectal cancer.Cancer Manag. Res.1051135124. 10.2147/cmar.s176833

  • 14

    GreenR.EsparzaI.SchreiberR. (1988). Iron inhibits the nonspecific tumoricidal activity of macrophages. A possible contributory mechanism for neoplasia in hemochromatosis.Ann. N. Y. Acad. Sci.526301309. 10.1111/j.1749-6632.1988.tb55514.x

  • 15

    HeX.WuK.OginoS.GiovannucciE. L.ChanA. T.SongM. (2018). Association between risk factors for colorectal cancer and risk of serrated polyps and conventional adenomas.Gastroenterology155355373.e18.

  • 16

    HsingA. W.MclaughlinJ. K.ChowW. H.SchumanL. M.Co ChienH. T.GridleyG.et al (1998). Risk factors for colorectal cancer in a prospective study among U.S. white men.Int. J. Cancer77549553. 10.1002/(sici)1097-0215(19980812)77:4<549::aid-ijc13>3.0.co;2-1

  • 17

    HuH.MiaoY. R.JiaL. H.YuQ. Y.ZhangQ.GuoA. Y. (2019). AnimalTFDB 3.0: a comprehensive resource for annotation and prediction of animal transcription factors.Nucleic Acids Res.47D33D38.

  • 18

    IssaI. A.NoureddineM. (2017). Colorectal cancer screening: an updated review of the available options.World J. Gastroenterol.2350865096. 10.3748/wjg.v23.i28.5086

  • 19

    JemalA.BrayF.CenterM. M.FerlayJ.WardE.FormanD. (2011). Global cancer statistics.CA Cancer J. Clin.616990.

  • 20

    JenJ.WangY. C. (2016). Zinc finger proteins in cancer progression.J. Biomed. Sci.23:53.

  • 21

    KangJ.MalhotraN. (2015). Transcription factor networks directing the development, function, and evolution of innate lymphoid effectors.Annu. Rev. Immunol.33505538. 10.1146/annurev-immunol-032414-112025

  • 22

    KhamasA.IshikawaT.ShimokawaK.MogushiK.IidaS.IshiguroM.et al (2012). Screening for epigenetically masked genes in colorectal cancer Using 5-Aza-2’-deoxycytidine, microarray and gene expression profile.Cancer Genomics Proteomics96775.

  • 23

    LeeJ. H.JungS.ParkW. S.ChoeE. K.KimE.ShinR.et al (2019). Prognostic nomogram of hypoxia-related genes predicting overall survival of colorectal cancer-Analysis of TCGA database.Sci. Rep.9:1803.

  • 24

    LoF. Y.ChangJ. W.ChangI. S.ChenY. J.HsuH. S.HuangS. F.et al (2012). The database of chromosome imbalance regions and genes resided in lung cancer from Asian and Caucasian identified by array-comparative genomic hybridization.BMC Cancer12:235. 10.1186/1471-2407-12-235

  • 25

    MarisaL.De ReyniesA.DuvalA.SelvesJ.GaubM. P.VescovoL.et al (2013). Gene expression classification of colon cancer into molecular subtypes: characterization, validation, and prognostic value.PLoS Med.10:e1001453. 10.1371/journal.pmed.1001453

  • 26

    MisawaK.MisawaY.ImaiA.MochizukiD.EndoS.MimaM.et al (2018). Epigenetic modification of SALL1 as a novel biomarker for the prognosis of early stage head and neck cancer.J. Cancer9941949. 10.7150/jca.23527

  • 27

    PekM.YatimS.ChenY.LiJ.GongM.JiangX.et al (2017). Oncogenic KRAS-associated gene signature defines co-targeting of CDK4/6 and MEK as a viable therapeutic strategy in colorectal cancer.Oncogene3649754986. 10.1038/onc.2017.120

  • 28

    PritchardC. C.GradyW. M. (2011). Colorectal cancer molecular biology moves into clinical practice.Gut60116129. 10.1136/gut.2009.206250

  • 29

    RitchieM. E.PhipsonB.WuD.HuY.LawC. W.ShiW.et al (2015). limma powers differential expression analyses for RNA-sequencing and microarray studies.Nucleic Acids Res.43:e47. 10.1093/nar/gkv007

  • 30

    SikderD.KodadekT. (2005). Genomic studies of transcription factor-DNA interactions.Curr. Opin. Chem. Biol.93845. 10.1016/j.cbpa.2004.12.008

  • 31

    SmithJ. J.DeaneN. G.WuF.MerchantN. B.ZhangB.JiangA.et al (2010). Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer.Gastroenterology138958968. 10.1053/j.gastro.2009.11.005

  • 32

    SongD.YueL.WuG.MaS.GuoL.YangH.et al (2015). Assessment of promoter methylation and expression of SIX2 as a diagnostic and prognostic biomarker in Wilms’ tumor.Tumour Biol.3675917598. 10.1007/s13277-015-3456-5

  • 33

    SongS.LiD.YangC.YanP.BaiY.ZhangY.et al (2018). Overexpression of NELFCD promotes colorectal cancer cells proliferation, migration, and invasion.Onco. Targets Ther.1187418750. 10.2147/ott.s186266

  • 34

    SongdejN.RaoA. K. (2017). Hematopoietic transcription factor mutations: important players in inherited platelet defects.Blood12928732881. 10.1182/blood-2016-11-709881

  • 35

    TorreL. A.BrayF.SiegelR. L.FerlayJ.Lortet-TieulentJ.JemalA. (2015). Global cancer statistics, 2012.CA Cancer J. Clin.6587108. 10.3322/caac.21262

  • 36

    WuH.ZhaoM.YoshimuraA.ChangC.LuQ. (2016). Critical link between epigenetics and transcription factors in the induction of autoimmunity: a comprehensive review.Clin. Rev. Allergy Immunol.50333344. 10.1007/s12016-016-8534-y

  • 37

    YangL.HamiltonS. R.SoodA.KuwaiT.EllisL.SanguinoA.et al (2008). The previously undescribed ZKSCAN3 (ZNF306) is a novel “driver” of colorectal cancer progression.Cancer Res.6843214330. 10.1158/0008-5472.can-08-0407

  • 38

    YangX.XuZ. J.ChenX.ZengS. S.QianL.WeiJ.et al (2019). Clinical value of preoperative methylated septin 9 in Chinese colorectal cancer patients.World J. Gastroenterol.2520992109. 10.3748/wjg.v25.i17.2099

  • 39

    YangY.JinL.ZhangJ.WangJ.ZhaoX.WuG.et al (2017). High HSF4 expression is an independent indicator of poor overall survival and recurrence free survival in patients with primary colorectal cancer.IUBMB Life69956961. 10.1002/iub.1692

  • 40

    ZhangJ.ChengZ.MaY.HeC.LuY.ZhaoY.et al (2017). Effectiveness of screening modalities in colorectal cancer: a network meta-analysis.Clin. Colorectal Cancer16252263. 10.1016/j.clcc.2017.03.018

  • 41

    ZhangZ.QianW.WangS.JiD.WangQ.LiJ.et al (2018a). Analysis of lncrna-associated ceRNA network reveals potential lncRNA biomarkers in human colon adenocarcinoma.Cell Physiol. Biochem.4917781791. 10.1159/000493623

  • 42

    ZhangZ.TanX.LuoJ.CuiB.LeiS.SiZ.et al (2018b). GNA13 promotes tumor growth and angiogenesis by upregulating CXC chemokines via the NF-kappaB signaling pathway in colorectal cancer cells.Cancer Med.756115620. 10.1002/cam4.1783

Summary

Keywords

GEO, TCGA, CRC, prognosis, transcription factors, ZNF26

Citation

Liu J, Li Y, Gan Y, Xiao Q, Tian R, Shu G and Yin G (2021) Identification of ZNF26 as a Prognostic Biomarker in Colorectal Cancer by an Integrated Bioinformatic Analysis. Front. Cell Dev. Biol. 9:671211. doi: 10.3389/fcell.2021.671211

Received

23 February 2021

Accepted

11 May 2021

Published

11 June 2021

Volume

9 - 2021

Edited by

César López-Camarillo, Universidad Autónoma de la Ciudad de México, Mexico

Reviewed by

Fernanda Marconi Roversi, State University of Campinas, Brazil; Mariana Lazarini, Federal University of São Paulo, Brazil

Updates

Copyright

*Correspondence: Gang Yin,

This article was submitted to Molecular and Cellular Oncology, a section of the journal Frontiers in Cell and Developmental Biology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics