Acquisition of resistance to ceftazidime-avibactam during infection treatment in Pseudomonas aeruginosa through D179Y mutation in one of two blaKPC-2 gene copies without losing carbapenem resistance

Introduction

Pseudomonas aeruginosa is one of the most frequent causative agents of healthcare-associated infections and poses a major concern due to its outstanding ability to develop resistance to antimicrobial agents (Botelho et al., 2019). Carbapenemases are the most important acquired resistance in P. aeruginosa because it confers resistance to all beta-lactams and because some of them are encoded in mobile genetic elements that facilitate their dissemination. The most frequent carbapenemase in P. aeruginosa worldwide is VIM (Karlowsky et al., 2018; Karlowsky et al., 2019; Kiwei et al., 2021). In a recent report including more than 400 beta-lactam resistant P. aeruginosa isolates in Europe, 37% were VIM positive, followed by NDM and IMP (Torrens et al., 2022). In contrast to the worldwide distributed class B beta-lactamase-producing P. aeruginosa, KPC-producing P. aeruginosa (KPC-PA) has been mostly reported in American countries like Argentina (Pasterán et al., 2012; Ramírez et al., 2013), Brazil (Luna et al., 2012), Trinidad y Tobago (Akpaka et al., 2009), United States (Poirel et al., 2010), Chile (Enberg et al., 2020; Costa et al., 2021) Colombia (Villegas et al., 2007; Rada et al., 2021) and also in China (Kiwei et al., 2021). A recent Chilean study showed that among 61 carbapenemase-producing P. aeruginosa isolates, 54% harbored KPC, and the remaining 46% produced VIM (Costa et al., 2021).

Ceftazidime-avibactam (CAZ/AVI) is a novel antimicrobial combination that gathers ceftazidime, a well-known cephalosporin, with avibactam, a beta-lactamase inhibitor highly active against class A carbapenemases such as KPC. Notably, while avibactam also inhibits class C and some D enzymes, it does not exhibit activity against class B carbapenemases (Ehmann et al., 2012), Currently, CAZ/AVI is one of the main antibiotic alternatives used to treat infections by KPC-producing bacteria, including KPC-PA (Temkin et al., 2017) and KPC-producing Enterobacterales (Shields et al., 2017a). Unfortunately, CAZ/AVI resistance in P. aeruginosa is not uncommon, with reported resistance rates of 10-16% among isolates of carbapenem-resistant P. aeruginosa not harboring class B beta-lactamases (Kazmierczak et al., 2018; Karlowsky et al., 2018; Karlowsky et al., 2019). Globally, CAZ/AVI resistance occurs through several mechanisms: changes in the omega-loop of the KPC or AmpC enzymes; porin mutations; increased copy number and/or expression of bla_KPC genes; and increased expression of efflux pumps (Botelho et al., 2019; Coppi et al., 2020). D179Y substitution in the omega-loop of KPC-2 (designated KPC-33 variant) has been associated with CAZ/AVI resistance in Enterobacterales (Wang et al., 2020). While the specific mechanism of CAZ/AVI resistance conferred by the D179Y mutation has not been completely characterized, some studies suggest it may be related to hydrogen bonds stabilizing the interaction of the enzymatic active site with CAZ, decreasing its affinity to AVI (Winkler et al., 2015; Barnes et al., 2017). Other studies have reported that D179Y alters the acylation of KPC, decreasing the inactivation constant of AVI by ~70,000-fold (Compain and Arthur, 2017). Indeed, experiments with purified KPC-33 demonstrated a 20-fold increase in the concentration of AVI needed to inhibit 50% of CAZ hydrolysis. Also, KPC-33 exhibited a 10-fold higher efficiency hydrolyzing CAZ as compared to wild-type (WT) KPC-2 (Tsivkovski and Lomovskaya, 2020). Interestingly, the D179Y substitution restores the susceptibility to carbapenems in Enterobacterales, known as the “see-saw” effect (Shields et al., 2017a; Haidar et al., 2017; Shields et al., 2017b). In contrast to Enterobacterales, CAZ/AVI resistance in P. aeruginosa has been mostly associated with point mutations in chromosomal genes coding for AmpC and OXA-539 beta-lactamases (Fraile-Ribot et al., 2017; Wang et al., 2020). In addition, several changes in chromosomal genes have been reported in CAZ/AVI resistant clinical isolates of P. aeruginosa: ftsI, nalD, dnaK, ctpA, together with increased expression of MexAB-OprM efflux pump system (Castanheira et al., 2019). Herein, we report the in vivo emergence of high-level CAZ/AVI resistance in a clinical isolate of KPC-PA bearing two copies of bla_KPC, one of which developed the D179Y substitution. Interestingly, the development of CAZ-AVI resistance did not result in concomitant carbapenem susceptibility. The finding of KPC-33 was detected through a multi-step hybrid assembly pipeline using long and short-read whole-genome sequencing (WGS) platforms.

Materials and methods

Patient and isolates

This work was approved by the Ethical Committee of Pontificia Universidad Católica de Chile. Isolates were obtained from a 77-year-old male patient admitted in February 2019 due to a dissecting abdominal aortic aneurysm. Two days after surgical repair, a urine culture performed due to tachycardia and abdominal pain, yielded a KPC-PA (isolate PA-1). The isolate was susceptible to amikacin, colistin and CAZ/AVI. Therapy with colistin plus CAZ/AVI was started immediately. After 16 days of therapy, fever and clinical worsening occurred and the patient developed respiratory failure and shock, requiring vasoactive support and mechanical ventilation. A culture from an endotracheal aspirate obtained at that moment yielded a CAZ/AVI resistant KPC-PA isolate (isolate PA-2). Therefore CAZ/AVI was replaced by a combination of colistin plus amikacin. The patient developed renal impairment with hypernatremia and hypokalemia that were managed with hypotonic fluids and intravenous loads, respectively. Finally, the patient exhibited a good clinical response after 48 days of colistin therapy, with disappearance of the fever and decreasing inflammatory parameters, and was discharged after 127 days of hospitalization.

Antimicrobial susceptibility testing

Antimicrobial susceptibility was determined through the agar dilution method as per Clinical Laboratory Standards Institute (CLSI) recommendations (CLSI, 2019). Susceptibility to CAZ/AVI, ceftolozane/tazobactam and aztreonam were determined using the broth microdilution method using SensiTitre Antimicrobial Susceptibility Testing System according to manufacturer`s instructions (Thermo Fisher Scientific, United States). Susceptibility categorization was performed using the breakpoints proposed by the CLSI guidelines (CLSI, 2019).

Carbapenemase detection

Isolates were initially assessed for carbapenemase activity through Carba-NP testing as per CLSI recommendations (CLSI, 2019). The presence of KPC, OXA-48, IMP, VIM and NDM was determined using the immunochromatographic test NG-CARBA 5 (NG-BIOTECH^®, France). Further, molecular confirmation was performed using PCR targeting carbapenemase genes bla_KPC, bla_OXA-48, bla_NDM, bla_IMP, bla_IMI, bla_GES and bla_VIM, as previously described (Wozniak et al., 2012). DNA from carbapenemase-producing clinical isolates previously characterized in our laboratory was used as positive controls (Wozniak et al., 2012).

Analysis of outer membrane proteins

SDS-PAGE analyses of the insoluble outer-membrane fraction were performed as described (Wozniak et al., 2012). Briefly, 2mL of overnight culture were centrifuged, resuspended in 10mM Tris HCl pH8, sonicated for 2min and centrifuged at 7,000g for 5min. The supernatant obtained was centrifuged at 13,000g for 45min, and the pellet was resuspended in 10mM Tris-HCl pH8 with 2% Triton X-100 and incubated at 37°C for 30min. The suspension was centrifuged at 13,000g for 45min and the pellet containing outer membrane proteins was resuspended in 100mM Tris-HCl pH8 with 2% SDS. A volume containing 50µg of protein was incubated at 98°C for 5min and analyzed in a 12.5% polyacrylamide gel at 100V. Gels were stained overnight in 0.1% Coomassie blue and washed with 1% acetic acid. Susceptible P. aeruginosa ATCC 27853 was included as control.

Whole genome sequencing analysis

Isolates PA-1 and PA-2 were sequenced using both short-read and long-read WGS. For short-read sequencing, a 350 bp insert DNA library was prepared using Illumina DNA Prep Kit (formerly Nextera Flex), using the Hackflex protocol (Gaio et al., 2022). Sequencing was performed in an Illumina Platform PE150, at the University of Technology Sydney’s Bioscience Laboratory (Sydney, Australia). The Q30 obtained was > 90% for both isolates. De novo assembly was performed using SPADES version 3.7 package (Bankevich et al., 2012). Genomic annotation of the recovered draft genomes was performed with Prokka tool 1.11 (Seemann, 2014). Final visualization was made using Geneious™. For long-read sequencing, an Oxford Nanopore platform was used. A Ligation Library was prepared and sequenced on a GridION device at the Garvan Institute of Medical Research (Sydney, Australia).

Short-read and long-read sequences were assembled using two different hybrid assembly approaches: Unicylcler and Trycycler (Wick et al., 2017; Wick et al., 2021). Of note, Unicycler uses a short-read-first approach and Trycycler uses a long-read-first approach. For Trycycler assembly, a set of 12 assemblies made with three different assemblers, using different random subsets as input, were generated. The three assemblers used were Flye (Kolmogorov et al., 2019), Miniasm (Heng Li, 2016) and Raven (Vaser and Šikić, 2021). The clustering of assemblies was evaluated manually in a phylogenetic tree, and after confirming that the three assemblies were concordant in the plasmids and chromosomes generated, a consensus sequence was generated. The resistome characterization, genome annotation, and visualization of the hybrid assemblies were performed using the Comprehensive Antibiotic Resistance Database (CARD) Resistance Gene Identifier (RGI) v1.0.0 (McArthur et al., 2013), Prokka v1.11 (Seemann, 2014) and CGView Builder v1.0.0 (Grant and Stothard, 2008).

Raw sequence data were deposited in BioProject No. PRJNA839103 in the Sequence Read Archive of the National Center for Biotechnology Information with BioSample accession numbers SAMN28535839, SAMN28535840 for PA-1 and PA-2 respectively. Final assembly of chromosomes were deposited in Genbank with accession numbers CP097709 and CP097710, for PA-1 and PA-2 respectively. Final assembly of plasmids were deposited in Genbank with accession numbers CP097845 and CP097844 for pPA-1 and pPA-2 respectively.

Confirmation of KPC D179Y substitution

To confirm the KPC D179Y substitution, a forward primer that included the nucleotide change G532T at the 3’ end was designed. The same primer with the WT nucleotide was also designed. The primers used were: WT-F: GCGCGCGGCGATGAGGTATC; Mut-F: GCGCGCGGCGATGAGGTATA; Rev: CTTGCCGCTCGGTGATAATC. Two PCR reactions were done for each isolate: one with primers WT-F and WT-Rev, and the other one with primers Mut-F and Mut-Rev; both PCR reactions produced a 640 bp amplicon. It was expected that PCR with primers Mut-F and Mut-Rev produced a 640 bp amplicon for PA-2, and no amplicon for PA-1. PCR with primers WT-F and WT-Rev was expected to produce a 640 bp amplicon for both isolates.

Results

Phenotypic and genotypic characterization of the isolates

A summary of the susceptibility profile of PA-1 and PA-2 is presented in Table 1. Briefly, PA-1 exhibited resistance to all tested antimicrobials tested except for colistin, amikacin, and CAZ/AVI with minimum inhibitory concentrations (MIC) of ≤2, ≤8 and 4 μg/mL, respectively. PA-2 exhibited the same susceptibility profile of PA-1, except for CAZ/AVI, which resulted in a MIC of >256 μg/mL (Table 1). Both isolates exhibited carbapenemase activity as indicated by a positive Carba-NP test. Immunochromatographic detection of carbapenemases showed that both isolates produced a KPC enzyme, which was later confirmed through PCR targeting the bla_KPC gene (data not shown). Since altered production of the OprD porin may also affect CAZ/AVI activity, the porin profile was analyzed through SDS-PAGE of the insoluble outer membrane fraction. As shown in Figure 1, the band corresponding to OprD was absent in both clinical isolates as compared to the susceptible control. Therefore, an OprD-mediated resistance to CAZ/AVI in PA-2 was unlikely.

TABLE 1

Table 1 Antimicrobial susceptibility profile of P. aeruginosa isolates.

FIGURE 1

Figure 1 SDS-PAGE analysis of outer membrane protein extraction of isolates PA-1 and PA-2. Weight (kDa) of the Molecular Weight Standard (Std MW) bands used in protein electrophoresis is indicated next to the bands. P. aeruginosa ATCC 27853 was used as a control isolate. OprD was located based in its molecular weight of 48,4 kDa and according to previous reports (Rodríguez-Beltrán et al., 2015).

Short-read and long-read WGS analyses

Our genomic in-silico MLST analysis revealed both isolates belonged to ST654 and they harbored a bla_KPC-2 gene embedded in a typical Tn4401b transposon. Mutations in several chromosomally-encoded genes frequently associated with CAZ/AVI resistance were analyzed^; no differences were found between both isolates. However, several mutations in genes associated with CAZ/AVI resistance were present in both isolates respect to WT strain PAO-1 (Table 2). An 8 bp deletion at nucleotide 235 was observed in mexT, which resulted in a frameshift from amino acid 80. In addition, mexZ had a 2 bp deletion at positions 550 and 551, which produced a frameshift from amino acid 184. Both changes in MexT and MexZ were predicted to result in a loss of protein function according to PROVEAN analysis (Choi et al., 2012). Other changes observed in chromosomal genes were predicted to produce minor or no changes in protein function according to PROVEAN analysis (Table 2). Both PA-1 and PA-2 had the same allele of the endogenous ampC gene (PDC-3), WT alleles of mexAB-oprM operon, the same polymorphisms in transcriptional regulators MexT, MexD, MexZ, NalC and NalD, and the same variant of OprD porin. Despite OprD porin had a deletion of two amino acids and 29 amino acid substitutions respect to PAO-1 strain, these alterations were neutral according to PROVEAN analysis. This OprD protein variant was reported as functional (Suresh et al., 2020). According to these data, no evident differences were found between both isolates that could explain CAZ/AVI resistance in PA-2.

TABLE 2

Table 2 Sequence analysis of PA-1 and PA-2 acquired resistance genes and chromosomal genes associated with CAZ/AVI resistance compared to PAO-1 control strain.

To obtain a more detailed genomic analysis, hybrid assemblies were performed using short and long-read data for each isolate. Using Unicycler (short-read-first approach), isolate PA-1 generated two circular scaffolds of 7,046,950 bp and 54,030 bp long, and isolate PA-2 generated two linear scaffolds of 6,969,342 bp and 71,243 bp, and a circular scaffold of 40,443 bp. Scaffolds of 54,030 bp (PA-1) and 40,443 bp (PA-2) corresponded to plasmids based on the presence of plasmid replication control genes and were named pPA-1 and pPA-2, respectively. Plasmid pPA-1 harbored two copies of the bla_KPC gene, each one contained in a Tn4401b transposon separated by 8,687 bp, whereas plasmid pPA-2 had only one copy of the Tn4401b transposon containing bla_KPC-2 according to Unicycler assembly. In contrast, using Trycycler (long-read-first approach) both isolates generated the same two circular scaffolds of 7,048,060 bp and 54,030 bp long. The Trycycler assembly showed both plasmids, pPA-1 and pPA-2 carried two copies of bla_KPC, both of which were harbored in a Tn4401b transposon structure. Interestingly, while both copies in PA-1 were WT bla_KPC-2, in isolate PA-2 one of the copies was a WT bla_KPC-2 gene and the other copy had a G532T base change that produced D179Y substitution in the omega-loop of KPC-2 and was therefore a bla_KPC-33 allele. To further corroborate this point mutation, the short reads of PA-1 and PA-2 were mapped against both bla_KPC alleles. No reads of PA-1 aligned with the bla_KPC-33 sequence. In contrast, analysis of PA-2 showed a balanced mapping of reads aligning with bla_KPC-2 and bla_KPC-33, respectively (Figure 2). A pair-wise alignment between the chromosomes of PA-1 and PA-2 demonstrated they were identical except for four 1-bp insertions/deletions and five 1-bp substitutions (99.99% identity) (Figure 3). Pair-wise alignment of plasmids pPA-1 and pPA-2 showed they were identical, except for nucleotide change in position G532T of the bla_KPC gene, which resulted in the D179Y amino acid substitution (Figure 3).

FIGURE 2

Figure 2 Short reads of PA-1 (A, B) and PA-2 (C, D) mapped against bla_KPC-2 (A, C) and bla_KPC-33 sequences (B, D). Position 532 is indicated in a vertical rectangle, and it has “G” in bla_KPC-2 and “A” in bla_KPC-33..

FIGURE 3

Figure 3 Chromosomes of isolates PA-1 (A) and PA-2 (B) and plasmids pPA-1 and pPA-2 C. Red arrowheads in A and B represent genes that are associated with antimicrobial resistance. The resistome of plasmids pPA-1 and pPA-2 C is composed only by two bla_KPC-2 genes in pPA-1 and both bla_KPC-2 and bla_KPC-33 genes in pPA-2. Grey bars represent coding sequences (CDS) whose gene names are shown for annotated genes or not shown for hypothetical proteins (hp). Transposase genes: associated with transposition events; hin_1, hin_2, dinG, soj: genes associated with DNA processing and repair; xerC: gene associated with plasmid replication control.

Confirmation of the co-existence of bla_KPC-2 and bla_KPC-33 alleles in PA-2 by PCR

The single nucleotide substitution of bla_KPC-33 with respect bla_KPC-2 was further confirmed by PCR using primers specific to each of the alleles. To do so, we designed two identical forward primers with a single nucleotide difference between them in the 3`end, which corresponded to the G532T change associated to the bla<sub>KPC-33</sub> allele. This nucleotide variation prevented the complete 3`end annealing of the primer against WT bla_KPC-2. PCR with primers directed to bla_KPC-2 amplified a 640 bp fragment as expected in both isolates PA-1 and PA-2, while primers directed to bla_KPC-33 only amplified the 640 bp fragment in PA-2 (Figure 4). Therefore, the presence of bla_KPC-33 was confirmed only in isolate PA-2.

FIGURE 4

Figure 4 Agarose gel electrophoresis of PCR products obtained in the amplification of PA-1 and PA-2 DNA using primers for amplification of bla_KPC-2 (left) and bla_KPC-33 (right). Both primer pairs amplify a fragment of 640 bp. Band sizes (bp) of the Molecular Weight Standard (Ld 100 bp) are indicated next to the bands.

Discussion

In the present work, we characterized a KPC-PA clinical isolate that developed CAZ/AVI resistance in vivo through D179Y mutation in one of two bla_KPC-2 genes that were harbored in a plasmid. Isolate PA-2 had >64-fold increase in CAZ/AVI MIC with respect to PA-1, but did not exhibit a decrease in carbapenem resistance (“see-saw” effect) as observed in Enterobacterales (Shields et al., 2017a; Shields et al., 2017b; Tsivkovski and Lomovskaya, 2020). The presence of both KPC-2 and KPC-33 is most likely responsible for the absence of the “see-saw” effect. This “all in one” resistant phenotype includes resistance to CAZ/AVI and to carbapenems, since the cost associated with the acquisition of bla_KPC-33 alone is offset by bla_KPC-2. In a previous work from our group, we described a D179Y mutation in the bla_KPC-2 gene of a clinical isolate of P. aeruginosa, but CAZ/AVI resistance was not addressed that time (Wozniak et al., 2019). This KPC-PA isolate had a negative immunochromatographic test, therefore, it is unlikely that it had an additional WT bla_KPC-2 copy. However, this isolate was resistant to meropenem and imipenem, therefore no “see-saw” effect was observed. According to these findings, the “see-saw” effect may be observable in Enterobacterales, but not necessarily in P. aeruginosa. This could be explained because Enterobacterales are much more dependent on carbapenemase function than P. aeruginosa, which has a variety of additional mechanisms for carbapenem resistance, e.g., efflux pump overexpression, porin alteration, AmpC and OXA enzymes alterations, among others (Botelho et al., 2019). In fact, several mutations in chromosomal genes associated with CAZ/AVI resistance were observed in both PA-1 and PA-2. Notably, isolate PA-1 was susceptible to CAZ/AVI, despite having these alterations. Most of the mutations observed have been previously reported in CAZ/AVI resistant isolates. NalC is a repressor of the positive regulator of MexAB-OprM and G71E mutation was described in aztreonam resistant isolates (Braz et al., 2016). NalD is a repressor of MexAB-OprM operon, and the mutation observed in this work has been observed in CAZ/AVI resistant P. aeruginosa (Castanheira et al., 2019). MexT is a transcriptional regulator that activates the expression of MexEF-OprN multidrug efflux system. The mutation observed in MexT has been reported in multi-drug resistant P. aeruginosa with decreased expression of OprD porin (Epp et al., 2001). MexZ is a repressor of the MexXY operon and alterations in mexZ have been described in CAZ/AVI resistant P. aeruginosa isolates (Castanheira et al., 2019). Mutation T105A in AmpC (PDC-3 allele) confers reduced susceptibility to imipenem, ceftazidime, and cefepime (Rodríguez-Martínez et al., 2009). Our results suggest that these mutations may not confer CAZ/AVI resistance alone, but they may contribute to overall resistance.

Hybrid assembly using short and long-read data is an excellent approach to predict putative plasmids, resistance genes, and beta-lactamase gene variants (Khezri et al., 2021). The G532T mutation in bla_KPC gene responsible for D179Y substitution, was observable only in the hybrid assembly obtained with Trycycler; it was not observable in the short-read assembly, nor in the hybrid assembly made with Unicycler. The short reads (350 bp long) are unable to cover both KPC-Tn4401 copies (28,699 bp) present in plasmids pPA-1 and pPA-2, and Unicycler considered both bla_KPC-2 and bla_KPC-33 alleles as a single gene. In contrast, long reads (with an average length of 40,000 bp) can cover both KPC-Tn4401 copies. However, Trycycler requires manual intervention from the user, it is more time-consuming and therefore is more challenging for high-throughput assembly. In a previous report a short-read WGS analysis of a CAZ/AVI resistant clinical isolate of KPC-producing K. pneumoniae determined that 46% of bla_KPC reads were bla_KPC-33 and 54% were bla_KPC-2 (Gaibani et al., 2020). A similar short-read WGS analysis of a clinical isolate of K. pneumoniae that developed high-level CAZ/AVI resistance after antibiotic treatment showed that 28% of the reads covering bla_KPC gene were bla_KPC-2 and 72% were bla_KPC-33 (Sun et al., 2021). Both articles mentioned above concluded that these isolates consisted of a mixed population containing both CAZ/AVI-resistant and CAZ-AVI-susceptible bacteria, which is commonly interpreted as heteroresistance. Our results show that interpretation of short-read data must be done with caution because this strategy not always allows discrimination between mixed populations and gene duplication with subsequent mutation. These findings underscore the actual value of long-read WGS methods and hybrid assembly combining short and long-read data.

The plasmids described in this work, pPA-1 and pPA-2, were similar to pPA2047 a 43,660 bp plasmid from P. aeruginosa recently reported in Argentina (>65% identity) (Cejas et al., 2022), and to pPae-13, a plasmid that was recently reported in a KPC-PA clinical isolate in the same Institutional Hospital as the present work (>60% identity) (Wozniak et al., 2021). It is possible that replicative transposition of bla_KPC-containing Tn4401b transposon in pPae-13 plasmid had produced pPA-1, and pPA-2 subsequently evolved through point mutation.

Development of high-level CAZ/AVI resistance upon CAZ/VI treatment greatly compromises the usefulness of this antibiotic combination for the treatment of KPC-PA infections, being colistin the most plausible option, with the subsequent associated renal impairment, like the one described in the present case. The lack of better therapeutic options together with the genetic characteristics of KPC-PA, i.e., location of bla_KPC genes in Tn4401b transposon, carriage by the high-risk clone ST654, make this finding highly concerning, particularly in regions where KPC-PA is frequent.

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/genbank/, CP097709 https://www.ncbi.nlm.nih.gov/genbank/, CP097710 https://www.ncbi.nlm.nih.gov/, SAMN28535839 https://www.ncbi.nlm.nih.gov/, SAMN28535840.

Ethics statement

The information about human patients were reviewed and approved by the Institutional Review Board of the Ethics and Biosafety Committee of Pontificia Universidad Católica de Chile.

Author contributions

AW, PG and BB conceived the idea and designed the experiments. JO-P, MA-R and JMu supervised the work. VQ, AW and BB performed the experiments in the study. BB, JMa, MA-R and AW performed bioinformatic analysis. PG, AW, BB, and MA-R wrote the paper. All authors read and approved the final manuscript.

Funding

This work was supported by research funds from SENTRY (Antimicrobial Resistance Surveillance Program), the Red de Salud UC-Christus and the Department of Clinical Laboratories at the School of Medicine of Pontificia Universidad Católica de Chile. Funding for whole-genome sequencing was obtained through the Key Technology Partnership Program from the University of Technology Sydney. This work was partially funded by the Agencia Nacional de Investigation y Desarrollo (FONDECYT regular award #1211947; JMu), and the Millennium Science Initiative, Millennium Initiative for Collaborative Research on Bacterial Resistance, Government of Chile (award number NCN17_081; JMM)

Acknowledgments

We thank the staff of the Microbiology Laboratory of the Red de Salud UC-CHRISTUS for their help in the technical aspects of this work. We also thank the Millennium Science Initiative of the Ministry of Economy, Development and Tourism, Government of Chile. We would like to express our gratefulness to the “Pseudomonas group”, a collaborative team including researchers from various Chilean Universities: Pontificia Universidad Católica de Chile, Pontificia Universidad Católica de Valparaíso, Universidad de Concepción; Universidad del Desarrollo.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The handling editor AO-C declared a past collaboration with the authors AW, PG, MA-R, JM, JO-P.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

Akpaka, P., Swanston, W., Ihemere, H., Correa, A., Torres, J., Tafur, J., et al. (2009). Emergence of KPC-producing pseudomonas aeruginosa in Trinidad and Tobago. J. Clin. Microbiol. 47 (8), 2670–2671. doi: 10.1128/JCM.00362-09

PubMed Abstract | CrossRef Full Text | Google Scholar

Bankevich, A., Nurk, S., Antipov, D., Gurevich, A. A., Dvorkin, M., Kulikov, A. S., et al. (2012). SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 19, 455–477. doi: 10.1089/cmb.2012.0021

PubMed Abstract | CrossRef Full Text | Google Scholar

Barnes, M. D., Winkler, M. L., Taracila, M. A., Page, M. G., Desarbre, E., Kreiswirth, B. N., et al. (2017). Klebsiella pneumoniae carbapenemase-2 (KPC-2), substitutions at ambler position Asp179, and resistance to ceftazidime-avibactam: unique antibiotic-resistant phenotypes emerge from beta-lactamase protein engineering. mBio 8, e00528-17. doi: 10.1128/mBio.00528-17

PubMed Abstract | CrossRef Full Text | Google Scholar

Botelho, J., Grosso, F., Peixe, L. (2019). Antibiotic resistance in pseudomonas aeruginosa - mechanisms, epidemiology and evolution. Drug Resist. Update 44, 100640. doi: 10.1016/j.drup.2019.07.002

CrossRef Full Text | Google Scholar

Braz, V. S., Furlan, J. P., Fernandes, A. F., Stehling, E. G. (2016). Mutations in NalC induce MexAB-OprM overexpression resulting in high level of aztreonam resistance in environmental isolates of pseudomonas aeruginosa. FEMS Microbiol. Lett. 363 (16), fnw166. doi: 10.3390/microorganisms9122560

PubMed Abstract | CrossRef Full Text | Google Scholar

Castanheira, M., Doyle, T. B., Smith, C. J., Mendes, R. E., Sader, H. S. (2019). Combination of MexAB-OprM overexpression and mutations in efflux regulators, PBPs and chaperone proteins is responsible for ceftazidime/avibactam resistance in pseudomonas aeruginosa clinical isolates from US hospitals. J. Antimicrob. Chemother. 74 (9), 2588–2595. doi: 10.1093/jac/dkz243

PubMed Abstract | CrossRef Full Text | Google Scholar

Cejas, D., Elena, A., González-Espinosa, F., Pallecchi, L., Vay, C., Rossolini, G. M., et al. (2022). Characterization of blaKPC-2 harboring plasmids recovered from pseudomonas aeruginosa ST654 and ST235 high-risk clones. J. Glob. Antimicrob. Res. 29, 310–312. doi: 10.1016/j.jgar.2022.04.017

CrossRef Full Text | Google Scholar

Choi, Y., Sims, G. E., Murphy, S., Miller, J. R., Chan, A. P. (2012). Predicting the functional effect of amino acid substitutions and indels. PLoS One 7 (10), e46688. doi: 10.1371/journal.pone.0046688

PubMed Abstract | CrossRef Full Text | Google Scholar

Clinical and Laboratory Standards Institute (2019). Performance standards for antimicrobial susceptibility testing: Twenty-ninth edition: M100 (Wayne, PA, USA: CLSI).

Google Scholar

Compain, F., Arthur, M. (2017). Impaired inhibition by avibactam and resistance to the ceftazidime-avibactam combination due to the D179Y substitution in the KPC-2 β-lactamase. Antimicrob. Agents Chemother. 61 (7), e00451-17. doi: 10.1128/AAC.00451-17

PubMed Abstract | CrossRef Full Text | Google Scholar

Coppi, M., Di Pilato, V., Monaco, F., Giani, T., Conaldi, P. G., Rossolini, G. M. (2020). Ceftazidime-avibactam resistance associated with increased blaKPC-3 gene copy number mediated by pKpQIL plasmid derivatives in sequence type 258 klebsiella pneumoniae. Antimicrob. Agents Chemother. 64 (4), e01816-19. doi: 10.1128/AAC.01816-19

PubMed Abstract | CrossRef Full Text | Google Scholar

Costa, J. S. T. D., Lima, C. A., Vera-Leiva, A., San Martin, M. I., Bello-Toledo, H., Domínguez-Yévenes, M., et al. (2021). Carbapenemases produced by carbapenem-resistant pseudomonas aeruginosa isolated from hospitals in Chile. Rev. Chil. Infectol. 38 (1), 81–87. doi: 10.4067/S0716-10182021000100081

CrossRef Full Text | Google Scholar

Ehmann, D. E., Jahić, H., Ross, P. L., Gu, R. F., Hu, J., Kern, G., et al. (2012). Avibactam is a covalent, reversible, non-β-lactam β-lactamase inhibitor. Proc. Natl. Acad. Sci. U.S.A. 109 (29), 11663–11668. doi: 10.1073/pnas.1205073109

PubMed Abstract | CrossRef Full Text | Google Scholar

Enberg, M. E., Puente, M., Wozniak, A., Castillo, C., Villagra, N., Labarca, J. (2020). Carbapenemases in pseudomonas aeruginosa with decreased susceptibility to carbapenems after a decade: from VIM to KPC. Rev. Chil. Infectol. 37 (4), 389–394. doi: 10.4067/S0716-10182020000400389

CrossRef Full Text | Google Scholar

Epp, S. F., Köhler, T., Plésiat, P., Michéa-Hamzehpour, M., Frey, J., Pechère, J. C., et al. (2001). C-terminal region of pseudomonas aeruginosa outer membrane porin OprD modulates susceptibility to meropenem. Antimicrob. Agents Chemother. 45 (6), 1780–1787. doi: 10.1128/AAC.45.6.1780-1787.2001

PubMed Abstract | CrossRef Full Text | Google Scholar

Fraile-Ribot, P. A., Mulet, X., Cabot, G., del Barrio-Tofinão, E., Juan, C., Peírez, J. L., et al. (2017). In vivo emergence of resistance to novel cephalosporin–β-lactamase inhibitor combinations through the duplication of amino acid D149 from OXA-2 β-lactamase (OXA-539) in sequence type 235 pseudomonas aeruginosa. Antimicrob. Agents Chemother. 61, e01117-17. doi: 10.1128/AAC.01117-17

PubMed Abstract | CrossRef Full Text | Google Scholar

Gaibani, P., Re, M. C., Campoli, C., Viale, P. L., Ambretti, S. (2020). Bloodstream infection caused by KPC-producing klebsiella pneumoniae resistant to ceftazidime/avibactam: epidemiology and genomic characterization. Clin. Microbiol. Infect. 26 (4), 516.e1–516.e4. doi: 10.1016/j.cmi.2019.11.011

CrossRef Full Text | Google Scholar

Gaio, D., Anantanawat, K., To, J., Liu, M., Monahan, L., Darling, A. E. (2022). Hackflex: low-cost, high-throughput, illumina nextera flex library construction. Microb. Genom. 8 (1), 744. doi: 10.1099/mgen.0.000744

CrossRef Full Text | Google Scholar

Grant, J. R., Stothard, P. (2008). The CGView server: a comparative genomics tool for circular genomes. Nucleic Acids Res. 36 (Web Server issue), W181–W184. doi: 10.1093/nar/gkn179

PubMed Abstract | CrossRef Full Text | Google Scholar

Haidar, G., Clancy, C. J., Shields, R. K., Hao, B., Cheng, S., Nguyen, M. H. (2017). Mutations in blaKPC-3 that confer ceftazidime-avibactam resistance encode novel KPC-3 variants that function as extended-spectrum beta- lactamases. Antimicrob. Agents Chemother. 61, e02534-16. doi: 10.1128/AAC.02534-16

PubMed Abstract | CrossRef Full Text | Google Scholar

Heng, Li (2016). Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences. Bioinformatics 32 (14), 2103–2110. doi: 10.1093/bioinformatics/btw152

PubMed Abstract | CrossRef Full Text | Google Scholar

Karlowsky, J. A., Kazmierczak, K. M., Bouchillon, S. K., de Jonge, B. L. M., Stone, G. G., Sahm, D. F. (2018). In vitro activity of ceftazidime-avibactam against clinical isolates of enterobacteriaceae and pseudomonas aeruginosa collected in Asia-pacific countries: Results from the INFORM global surveillance program 2012 to 2015. Antimicrob. Agents Chemother. 62 (7), e2517–e2569. doi: 10.1128/AAC.02569-17

CrossRef Full Text | Google Scholar

Karlowsky, J. A., Kazmierczak, K. M., Bouchillon SK de Jonge, B. L. M., Stone, G. G., Sahm, D. F. (2019). In vitro activity of ceftazidime-avibactam against clinical isolates of enterobacteriaceae and pseudomonas aeruginosa collected in Latin American countries: Results from the INFORM global surveillance program 2012 to 2015. Antimicrob. Agents Chemother. 63 (4), e1814–e1818. doi: 10.1128/AAC.01814-18

CrossRef Full Text | Google Scholar

Kazmierczak, K. M., de Jonge, B., Stone, G. G., Sahm, D. F. (2018). In vitro activity of Ceftazidime/Avibactam against isolates of pseudomonas aeruginosa collected in European countries: INFORM global surveillance 2012-15. J. Antimicrob. Chemother. 73 (10), 2777–2781. doi: 10.1093/jac/dky267

PubMed Abstract | CrossRef Full Text | Google Scholar

Khezri, A., Avershina, E., Ahmad, R. (2021). Hybrid assembly provides improved resolution of plasmids, antimicrobial resistance genes, and virulence factors in escherichia coli and klebsiella pneumoniae clinical isolates. Microorganisms 9, 2560. doi: 10.3390/microorganisms9122560

PubMed Abstract | CrossRef Full Text | Google Scholar

Kiwei, Z., Chen, J., Shen, H., Chen, Z., Yang, Q.-w., Zhu, J., et al. (2021). Emergence of ceftazidime- and avibactam-resistant klebsiella pneumoniae carbapenemase-producing pseudomonas aeruginosa in China. mSystems 6 (6), e00787-21. doi: 10.1128/mSystems.00787-21

CrossRef Full Text | Google Scholar

Kolmogorov, M., Yuan, J., Lin, Y., Pevzner, P. (2019). Assembly of long, error-prone reads using repeat graphs. Nat. Biotechnol. 37, 540–546. doi: 10.1038/s41587-019-0072-8

PubMed Abstract | CrossRef Full Text | Google Scholar

Luna, P., Rodrigues, L., Borges, A., Lopes A and Vieira, M. (2012). First report of KPC-producing pseudomonas aeruginosa in Brazil. Antimicrob. Agents Chemother. 56 (9), 4990. doi: 10.1128/AAC.00699-12

PubMed Abstract | CrossRef Full Text | Google Scholar

McArthur, A. G., Waglechner, N., Nizam, F., Yan, A., Azad, M. A., Baylay, A. J., et al. (2013). The comprehensive antibiotic resistance database. Antimicrob Agents Chemother 57 (7), 3348–57. doi: 10.1128/AAC.00419-13

PubMed Abstract | CrossRef Full Text | Google Scholar

Pasterán, F., Faccone, D., Gomez, S., De Bunder, S., Spinelli, F., Rapoport, M., et al. (2012). Detection of an international multiresistant clone belonging to sequence type 654 involved in the dissemination of KPC-producing pseudomonas aeruginosa in Argentina. J. Antimicrob. Chemother. 67 (5), 1291–1293. doi: 10.1093/jac/dks032

PubMed Abstract | CrossRef Full Text | Google Scholar

Poirel, L., Nordmann, P., Lagrutta, E., Cleary T and Muñoz-Price, L. (2010). Emergence of KPC-producing pseudomonas aeruginosa in the united states. Antimicrob. Agents Chemother. 54, 3072. doi: 10.1128/AAC.00513-10

PubMed Abstract | CrossRef Full Text | Google Scholar

Rada, A. M., de la Cadena, E., Agudelo, C. A., Pallares, C., Restrepo, E., Correa, A., et al. (2021). Genetic diversity of multidrug-resistant pseudomonas aeruginosa isolates carrying blaVIM-2 and blaKPC-2 genes that spread on different genetic environment in Colombia. Front. Microbiol. 12, 663020. doi: 10.3389/fmicb.2021.663020

PubMed Abstract | CrossRef Full Text | Google Scholar

Ramírez, D. G., Nicola, F., Zarate, S., Relloso, S., Smayevsky, J., Arduino, S. (2013). Emergence of pseudomonas aeruginosa with KPC-type carbapenemase in a teaching hospital: an 8-year study. J. Med. Microbiol. 62 (10), 1565–1570. doi: 10.1099/jmm.0.059923-0

PubMed Abstract | CrossRef Full Text | Google Scholar

Rodríguez-Beltrán, J., Cabot, G., Valencia, E. Y., Costas, C., Bou, G., Oliver, A., et al. (2015). N-acetylcysteine selectively antagonizes the activity of imipenem in pseudomonas aeruginosa by an OprD-mediated mechanism. Antimicrob. Agents Chemother. 59 (6), 3246–3251. doi: 10.1128/AAC.00017-15

PubMed Abstract | CrossRef Full Text | Google Scholar

Rodríguez-Martínez, J. M., Poirel, L., Nordmann, P. (2009). Extended-spectrum cephalosporinases in pseudomonas aeruginosa. Antimicrob. Agents Chemother. 53 (5), 1766–1771. doi: 10.1128/AAC.01410-08

PubMed Abstract | CrossRef Full Text | Google Scholar

Seemann, T. (2014). Prokka: rapid prokaryotic genome annotation. Bioinformatics 30, 2068–2069. doi: 10.1093/bioinformatics/btu153

PubMed Abstract | CrossRef Full Text | Google Scholar

Shields, R. K., Nguyen, M. H., Press, E. G., Chen, L., Kreiswirth, B. N., Clancy, C. J. (2017a). Emergence of ceftazidime-avibactam resistance and restoration of car- bapenem susceptibility in klebsiella pneumoniae carbapenemase- producing K pneumoniae: a case report and review of literature. Open Forum Infect. Dis. 4, ofx101. doi: 10.1093/ofid/ofx101

PubMed Abstract | CrossRef Full Text | Google Scholar

Shields, R. K., Nguyen, M. H., Press, E. G., Chen, L., Kreiswirth, B. N., Clancy, C. J. (2017b). In vitro selection of meropenem resistance among ceftazidime- avibactam-resistant, meropenem-susceptible klebsiella pneumoniae iso- lates with variant KPC-3 carbapenemases. Antimicrob. Agents Chemother. 61, e00079-17. doi: 10.1128/AAC.00079-17

PubMed Abstract | CrossRef Full Text | Google Scholar

Sun, L., Li, H., Wang, Q., Liu, Y., Cao, B. (2021). Increased gene expression and copy number of mutated blaKPC lead to high-level ceftazidime/avibactam resistance in klebsiella pneumoniae. BMC Microbiol. 21 (1), 230. doi: 10.1093/femsle/fnw166

PubMed Abstract | CrossRef Full Text | Google Scholar

Suresh, M., Skariyachan, S., Narayanan, N., Pullampara Rajamma, J., Panickassery Ramakrishnan, M. K. (2020). Mutational variation analysis of oprD porin gene in multidrug-resistant clinical isolates of pseudomonas aeruginosa. Microb. Drug Resist. 26 (8), 869–879. doi: 10.1089/mdr.2019.0147

PubMed Abstract | CrossRef Full Text | Google Scholar

Temkin, E., Torre-Cisneros, J., Beovic, B., Benito, N., Giannella, M., Gilarranz, R., et al. (2017). Ceftazidime-avibactam as salvage therapy for infections caused by carbapenem resistant organisms. Antimicrob. Agents Chemother. 61, e01964-16. doi: 10.1128/AAC.01964-16

PubMed Abstract | CrossRef Full Text | Google Scholar

Torrens, G., van der Schalk, T. E., Cortes-Lara, S., Timbermont, L., Del Barrio-Tofiño, E., Xavier, B. B., et al. (2022). Susceptibility profiles and resistance genomics of pseudomonas aeruginosa isolates from European ICUs participating in the ASPIRE-ICU trial. J. Antimicrob. Chemother. 22, dkac122. doi: 10.1093/jac/dkac122

CrossRef Full Text | Google Scholar

Tsivkovski, R., Lomovskaya, O. (2020). Potency of vaborbactam is less affected than that of avibactam in strains producing KPC-2 mutations that confer resistance to ceftazidime-avibactam. Antimicrob. Agents Chemother. 64, e01936-19. doi: 10.1128/AAC.01936-19

PubMed Abstract | CrossRef Full Text | Google Scholar

Vaser, R., Šikić, M. (2021). Time- and memory-efficient genome assembly with raven. Nat. Comput. Sci. 1, 332–336. doi: 10.1038/s43588-021-00073-4

CrossRef Full Text | Google Scholar

Villegas, M., Lolans, K., Correa, A., Kattan, J., Lopez, J., Quinn, J., et al. (2007). First identification of pseudomonas aeruginosa isolates producing a KPC-type carbapenem-hydrolyzing β -lactamase. Antimicrob. Agents Chemother. 51 (4), 1553–1555. doi: 10.1128/AAC.01405-06

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, Y., Wang, J., Wang, R., Cai, Y. (2020). Resistance to ceftazidime-avibactam and underlying mechanisms. J. Glob. Antimicrob. Resist. 22, 18–27. doi: 10.1016/j.jgar.2019.12.009

PubMed Abstract | CrossRef Full Text | Google Scholar

Wick, R., Judd, L., Cerdeira, L., Hawkey, J., Méric, G., Vezina, B., et al. (2021). Trycycler: consensus long-read assemblies for bacterial genomes. Genome Biol. 22, 266. doi: 10.1186/s13059-021-02483-z

PubMed Abstract | CrossRef Full Text | Google Scholar

Wick, R. R., Judd, L. M., Gorrie, C. L., Holt, K. E. (2017). Unicycler: resolving bacterial genome assemblies from short and long sequencing reads. PloS Comput. Biol. 13 (6), e1005595. doi: 10.1371/journal.pcbi.1005595

PubMed Abstract | CrossRef Full Text | Google Scholar

Winkler, M. L., Papp-Wallace, K. M., Bonomo, R. A. (2015). Activity of ceftazidime/avibactam against isogenic strains of escherichia coli containing KPC and SHV β-lactamases with single amino acid substitutions in the Ω-loop. J. Antimicrob. Chemother. 70 (8), 2279–2286. doi: 10.1093/jac/dkv094

PubMed Abstract | CrossRef Full Text | Google Scholar

Wozniak, A., Figueroa, C., Moya-Flores, F., Guggiana, P., Castillo, C., Rivas, L., et al. (2021). A multispecies outbreak of carbapenem-resistant bacteria harboring the blaKPC gene in a non-classical transposon element. BMC Microbiol. 21 (1), 107. doi: 10.1186/s12866-021-02169-3

PubMed Abstract | CrossRef Full Text | Google Scholar

Wozniak, A., Paillavil, B., Legarraga, P., Zumarán, C., Prado, S., García, P. (2019). Evaluation of a rapid immunochromatographic test for detection of KPC in clinical isolates of enterobacteriaceae and pseudomonas species. Diagn. Microbiol. Infect. Dis. 95 (2), 131–133. doi: 10.1016/j.diagmicrobio.2019.05.009

PubMed Abstract | CrossRef Full Text | Google Scholar

Wozniak, A., Villagra, N. A., Undabarrena, A., Gallardo, N., Keller, N., Moraga, M., et al. (2012). Porin alterations present in non-carbapenemase-producing enterobacteriaceae with high and intermediate levels of carbapenem resistance in Chile. J. Med. Microbiol. 61, 1270–1279. doi: 10.1099/jmm.0.045799-0

PubMed Abstract | CrossRef Full Text | Google Scholar