Abstract
Drosophila suzukii is a common agricultural pest in numerous parts of the world, costing more than $500 million annually in crop loss in the United States alone. Understanding the genetic and physiological mechanisms underlying its remarkable adaptability has been a major focus for the agricultural industry as well as evolutionary biologists. The microbiome, the community of microbes associated with host organisms, can play a pivotal role in local adaptation by improving host resilience to environmental stress and providing access to new sources of nutrition. Here, we test the hypothesis that the colonization of non-native regions is associated with the incorporation of regionally-specific microbial taxa. We compare the microbiome profiles of wild-caught D. suzukii across five global sites, Asia, Europe, the United Kingdom, North America, and Hawai‘i. We also compare microbial communities of D. suzukii found in Hawai‘i to another local invasive species, D. immigrans, and native Hawaiian drosophilids. Our results reveal that wild-caught D. suzukii from Asia, Europe, the United Kingdom, North America, and the Hawaiian Islands exhibit distinct microbial compositions indicating that the environment is a stronger driver of microbiome composition than species identity. Seven bacterial families were conserved between all wild D. suzukii populations. Within Hawai‘i, non-native D. suzukii bacterial communities differed from those of native Hawaiian Drosophila species as well as non-native D. immigrans. By contrast, fungal microbiome profiles between the Hawaiian Drosophila and two invasive species closely resemble each other. In sum, all populations of D. suzukii in this study contain a subset of conserved bacterial families but also incorporate local bacterial taxa. This strategy may contribute to the rapid range expansion of D. suzukii and enhance its ability to exploit new dietary sources.
Introduction
The spotted wing Drosophila, Drosophila suzukii, is considered a globally invasive pest, having spread from its native range in East Asia (; ) to disparate locations in North America (), Europe (), South American (; ), North African countries (), and Asia (; ). D. suzukii’s preference to oviposit in soft-flesh fruits has resulted in significant yield losses of fruit crops including cherries, grapes, and plums (). The success of D. suzukii in expanding its range is partly attributed to its high adaptability to novel habitats and ecological niches (; ). Within Hawai‘i, the species is found across the islands of Kaua‘i, O‘ahu, Moloka‘i, Maui, and Hawai‘i Island (; ; ) in lower elevation agricultural parks as well as high elevation native forest reserves. D. suzukii is capable of thriving in elevations over 2000 m, and at mean annual temperatures of less than 12 °C (, ; ), near the lowest temperatures considered viable for activity in this genus (). In addition, D. suzukii has been observed feeding on a variety of native and non-native fruits (; ). Previous genetic analyses of D. suzukii populations from Asia (), Hawai‘i (), the continental United States (), Europe, and South America () identified genetic divergences that may facilitate successful environmental adaptation. The microbiome has also been hypothesized as a major driver of local evolution allowing organisms to exploit new ecological niches by enhancing host physiology and behavior (). Indeed, the ability to consume novel foods in a newly colonized area has been proposed as a key factor for successful invasion (). D. suzukii uses microbes to aid metabolism and survival in their preferred high-sugar and low-protein fruit hosts (; ) and may use naturally occurring microbes on a new host plant to extract essential nutrients (). Local microbes may also aid in the tolerance of temperatures near the extreme of their ranges (; ; ).
To address the possibility that the colonization of new ecological niches by D. suzukii is associated with changes in microbiome composition, we compared bacterial profiles of wild D. suzukii populations from the native ranges in China and Japan to populations from non-native ranges in Europe, the United Kingdom (UK), North America, and Hawai‘i () and lab-reared D. suzukii from the United States (US) (; ; ). To assess how closely D. suzukii microbiomes resembles that of other native and invasive species found in similar habitats, we compared Hawaiian D. suzukii bacterial and fungal profiles to another cosmopolitan drosophilid found in Hawai‘i, D. immigrans, as well as to native Hawaiian picture-wing Drosophila.
Materials and methods
Sample collection of drosophilids in the Hawaiian Islands
D. suzukii, D. immigrans, and endemic Hawaiian drosophilidae were collected from the islands of Moloka‘i, Lana‘i, and Hawai‘i Island using sponges baited with mushrooms, banana, and yeast. Samples were immediately placed into 95% ethanol, transported on ice packs, and stored at -80 °C in the laboratory until processing. Metadata associated with samples collected in Hawai‘i are provided in Supplementary Tables S1, S2.
Library preparation and sequencing of Hawaiian dosophilidae
Details of DNA extraction and library preparation are as previously described (). Briefly, surface-sterilized flies were homogenized using a bead mill homogenizer (Bead Ruptor Elite, Omnic, Inc; GA, USA) and DNA extracted with PowerMag Bead Solution kit (Qiagen; MD, USA) according to manufacturer’s instructions. The 16S rRNA gene was amplified with primers to the V4 region (515F: GTGYCAGCMGCCGCGGTAA; 806R: GGACTACNVGGGTWTCTAAT) (). Fungal diversity was characterized using primers to the internal transcribed spacer (ITS1f: CTTGGTCATTTAGAGGAAGTAA; ITS2: GCTGCGTTCTTCATCGATGC) (). The primers contain a 12-base pair Golay-indexed code for demultiplexing. The PCRs were performed with the KAPA3G Plant kit (Sigma Aldrich, MO, USA) using the following parameters: 95 °C for 3 min, followed by 35 cycles of 95 °C for 20 seconds, 50 °C for 15 seconds, 72 °C for 30 seconds, and a final extension for 72 °C for 3 min. The PCR products were cleaned and normalized with the Just-a-plate kit (Charm Biotech, MO, USA). High throughput sequencing (HTS) was performed with MiSeq and 250 bp paired-end kits (Illumina, Inc., CA, USA).
Data processing of 16S rRNA amplicons for multi-region comparisons
Taxonomic analyses of D. suzukii, D. immigrans, and native Hawaiian Drosophila microbiomes were assessed from next-generation amplicon sequencing of regions in the 16S rRNA gene using DADA2 v1.16 (). All analyses were conducted using R version 4.4.2 (). Four publicly accessible projects deposited on the NCBI Sequence Read Archive (SRA, https://www.ncbi.nlm.nih.gov/sra) and in-house data derived from D. suzukii, D. immigrans, and native Hawaiian Drosophila collected in Hawai‘i by the authors of this study were used in the analysis for a total of five independent sources of sequencing data (Supplementary Table S3). FASTQ files deposited onto the SRA were retrieved using fasterqdump command, part of the NCBI SRA Toolkit. SRA projects included in this study are PRJEB50289 (), PRJNA347319 (), PRJNA412893, and PRJNA719706 (). All raw sequence reads were demultiplexed before analysis.
All sequence data were generated from paired-end Illumina sequencing strategy, however there was no consensus in the primer sets used for all projects. Additionally, two of the SRA projects (PRJNA347319 and PRJNA719706) reported paired-end read strategy but only one spot contained read information from the SRA database; thus, only one file per sample was extracted. Visualization of the quality profile plots of these data revealed that the SRA data contained merged forward and reverse reads, referred to herein as extended fragments. Due to the unique nature of each dataset used in this study, each project was handled separately for pre-processing. A custom R script was used to search for the presence of sequencing primers in the reads. Sequencing primers were reported for all but SRA projects PRJNA412893, and in this case the primers used were inferred using the custom script to search for common 16S rRNA sequencing primers until the primer sites were identified. Locations of the primer sites in the forward and reverse reads were used to define the trimming (trimLeft) and the quality plots were used to define the truncation (truncLen) filtering parameters in DADA2. A default max EE setting of 2 was used for both forward and reverse reads, but one project required raising the threshold to recover enough sequence reads passing the filter. For extended fragments, as suggested by the DADA2 creator on github, the error rates were inflated by 3 to account for the heterogeneity between the merged subsegments using the command inflateErr. Project-specific details including primers, and pre-processing parameters are given in Supplementary Table S4.
After filtering, trimming and estimating error rates, paired-end reads were merged following the standard DADA2 workflow. Only merged reads or extended fragments (i.e., previously merged reads) were used for downstream analysis. The merged reads (and extended fragments) for 16S rRNA gene sequences from all five projects were used to create a sequence table, remove chimeras and assign taxonomy (excluding mitochondria and chloroplasts) using the SILVA SSU Ref NR database version 138.1 (; ). The number of reads tracked through the processing pipeline for each D. suzukii sample is given in Supplementary Table S5. Taxonomy assignments for 16S rRNA reads were based on amplicon sequence variant (ASV) data (100% similarity). Each sample was rarefied with a subsampling depth of 5,000 ASVs.
Data processing of ITS amplicons from Hawai‘i drosophilidae samples
Post-processing of HTS data (filtering, trimming, and clustering) for Hawai‘i samples (native Hawaiian flies, D. immigrans, D. suzukii) was performed using the “MetaFlow|mics” Fungal ITS pipeline for fungi which uses the DADA2 workflow (; ). ASV clustering was performed at the 97% similarity threshold. Taxonomy assignments for ITS reads were performed with NCBI BLAST, UNITE (), and MycoBank () using a >95% sequence similarity cutoff.
Statistical analysis
To quantify alpha-diversity, we used Chao1 and Shannon index. To assess beta-diversity, we used Bray-Curtis dissimilarity and performed ordination analyses with non-metric multidimensional scaling (NMDS). Analysis of Similarity (ANOSIM) and permutational multivariate analysis of variance (PERMANOVA) tests were applied to test for significant differences in community composition. Analyses were performed after clustering at the family or genus level and using R version 4.4.1, and the phyloseq package (). Venn diagrams were generated using complete sample sets for each population and based on the top ten families for each population (https://bioinformatics.psb.ugent.be/webtools/Venn/).
Results
Comparison of bacterial microbiomes of D. suzukii across native and invasive ranges and lab-maintained populations
To perform a multi-region comparison of D. suzukii microbiomes, we analyzed the bacterial communities of samples collected from China, Japan, North America, Europe, the UK and Hawai‘i. In terms of alpha-diversity, populations from the native range tended to have higher compositional richness and evenness compared to Europe, UK, and Hawai‘i when grouped by family (Figure 1A, Table 1). In addition, almost all populations of D. suzukii exhibit distinct compositional profiles (ANOSIM p = 0.001, R = 0.61; Figure 1B, Table 2). However, one exception to this general pattern is that D. suzukii from the native ranges of China and Japan and the non-native range of Europe exhibited similar compositions (PERMANOVA p = 0.075; Table 2). Flies collected in Hawai‘i, regardless of species, clustered together in the NMDS ordination plot (Figure 1B) although D. suzukii from Hawai‘i differed significantly in compositional profile from other Hawaiian populations (PERMANOVA, p = 0.001; Table 2). Only two bacterial families were unique to flies collected in their native range of China and Japan (Flavobacteriaceae and Weeksellaceae), suggesting that this cosmopolitan species associates with microbes beyond those that are specific to its region of origin. Seven bacterial families were common to all wild-caught D. suzukii, potentially serving as a core microbial community: Acetobacteraceae, Anaplasmatacea, Erwiniaceae, Halomonadaceae, Pseudomonadacae, Sphingobacteriaceae, and Yersiniaceae (Figures 1C, D). At the genus level, only the endosymbiont Wolbachia was common to lab and wild flies (Supplementary Figure S2, Supplementary Table S6).
Figure 1
Table 1
| Group 11 | Group 2 | Alpha-diversity2 | |
|---|---|---|---|
| Chao1 | Shannon | ||
| Europe | China + Japan | 0.152 | 0.002 |
| Hawai‘i | China + Japan | 0.941 | 0.021 |
| Hawai‘i | Europe | 0.153 | 0.456 |
| UK | China + Japan | 0.447 | 0.021 |
| UK | Europe | 0.152 | 0.045 |
| UK | Hawai‘i | 0.367 | 0.003 |
| US_wild | China + Japan | 0.014 | 0.095 |
| US_wild | Europe | 0.423 | 0.021 |
| US_wild | Hawai‘i | 0.003 | 0.172 |
| US_wild | UK | 0.001 | 0.250 |
| US_wild | US_lab | 0.001 | 0.001 |
| US_lab | China + Japan | 0.001 | 0.001 |
| US_lab | Europe | 0.001 | 0.005 |
| US_lab | Hawai‘i | 0.001 | 0.001 |
| US_lab | UK | 0.001 | 0.001 |
P-value outcomes of pairwise alpha-diversity comparisons at the family level amongst D. suzukii multi-regional populations shown in Figure 1A.
1Europe sites consist of Italy, France, Slovenia, Switzerland, and Spain; US_wild sites consist of New York and California; US_lab sites consist of New York and California.
2Outcomes from Wilcoxon Rank Sum tests; p-values < 0.05 in bold.
Table 2
| Group 11 | Group 2 | Beta-diversity2 |
|---|---|---|
| Europe | China + Japan | 0.075 |
| Hawai‘i | China + Japan | 0.013 |
| Hawai‘i | Europe | 0.002 |
| UK | China + Japan | 0.001 |
| UK | Europe | 0.001 |
| UK | Hawai‘i | 0.002 |
| US_wild | China + Japan | 0.001 |
| US_wild | Europe | 0.010 |
| US_wild | Hawai‘i | 0.001 |
| US_wild | UK | 0.001 |
| US_wild | US_lab | 0.001 |
| US_lab | China + Japan | 0.001 |
| US_lab | Europe | 0.001 |
| US_lab | Hawai‘i | 0.001 |
| US_lab | UK | 0.001 |
| HI_immigrans | China + Japan | 0.001 |
| HI_immigrans | Europe | 0.001 |
| HI_immigrans | US_wild | 0.001 |
| HI_immigrans | UK | 0.001 |
| HI_immigrans | HI_native | 0.080 |
| HI_immigrans | Hawai‘i | 0.001 |
| HI_immigrans | US_lab | 0.001 |
| HI_native | China + Japan | 0.001 |
| HI_native | Europe | 0.001 |
| HI_native | US_wild | 0.001 |
| HI_native | UK | 0.001 |
| HI_native | Hawai‘i | 0.001 |
| HI_native | US_lab | 0.001 |
P-value outcomes of pairwise beta-diversity comparisons at the family level amongst D. suzukii multi-regional populations and Hawai‘i native and non-native flies shown in Figure 1B.
1Europe: Italy, France, Slovenia, Switzerland, and Spain; US_wild sites: New York and California; US_lab sites: New York and California; HI_immigrans: D. immgrans caught in Hawai‘i; HI_native: native Hawaiian Drosophilia.
2Outcomes from PERMANOVA; p-values < 0.05 in bold.
The bacterial community richness of lab populations was significantly lower compared to each of the wild populations, consistent with previous studies (; ) (Figure 1A, Table 1). Lab flies from US, China, and Italy contained distinct communities of bacteria, with each profile correlating with geographical location (ANOSIM p = 0.001 R = 0.78; Supplementary Figure S1, Supplementary Table S7). However, there were only modest differences in terms of alpha-diversity (Supplementary Table S7).
Bacterial and fungal gut microbiome comparison of native Hawaiian Drosophila, D. immigrans in Hawai‘i, and D. suzukii in Hawai‘i
We predicted that D. suzukii colonization of new ecological niches may rely on the incorporation of local microbes. To test this possibility, we compared the bacterial and fungal profiles of D. suzukii to another invasive species established in Hawai‘i, D. immigrans, as well as to native Hawaiian Drosophila found at the same sites. In terms of community richness (Chao1), both invasive species exhibited significantly lower bacterial alpha-diversity compared to native flies (Figure 2A, Table 3). However, for fungal profiles, no significant differences in alpha-diversity were found between the three populations (Figure 2D, Table 3). Additionally, D. suzukii contained distinct bacterial communities compared to either D. immigrans or native Hawaiian flies at both family (ANOSIM p = 0.003, R = 0.18; Figure 2G) and genus levels (ANOSIM p = 0.012, R = 0.15; Supplementary Figure S2, Supplementary Table S6). Five families were found in D. suzukii that were not common to other Hawaiian populations. Of these, Rhizobiaceae was also not detected in D. suzukii from other regions and may reflect enrichment from the local environment. At the genus level, Citrobacter and Zymobacter appear to be enriched only in D. suzukii found in Hawai‘i and no other Hawaiian populations or regions (Supplementary Figure S2). Four bacterial families were common to invasive and native species in Hawai‘i whereas a single family is found in both invasive species, Moraxellaceae (Figure 2G). The presence of the Moraxellaxeae family in both Hawai‘i D. immigrans and D. suzukii as well as D. suzukii populations outside of its native range may indicate a conserved ecological association with invasive drosophilids.
Figure 2
Table 3
| Target gene | Group 1 | Group 2 | Alpha-diversity1 | Beta-diversity2 | |
|---|---|---|---|---|---|
| Chao1 | Shannon | ||||
| 16S rRNA | D. immigrans | Hawaiian Drosophila | 0.001 | 0.250 | 0.072 |
| D. suzukii | Hawaiian Drosophila | 0.008 | 0.113 | 0.001 | |
| D. suzukii | D. immigrans | 0.858 | 0.250 | 0.001 | |
| ITS | D. immigrans | Hawaiian Drosophila | 0.686 | 0.791 | 0.093 |
| D. suzukii | Hawaiian Drosophila | 0.210 | 0.680 | 0.057 | |
| D. suzukii | D. immigrans | 0.339 | 0.680 | 0.145 | |
P-value outcomes of pairwise alpha- and beta-diversity comparisons of family-level bacterial (top) and fungal (bottom) community profiles from Hawai‘i populations shown in Figure 2.
1Outcomes from Wilcoxon Rank Sum tests; bold values indicate statistical significance at the p < 0.05 level.
2Outcomes from PERMANOVA; bold values indicate statistical significance at the p < 0.05 level.
With respect to the fungal microbiome, native Hawaiian flies and both invasive populations exhibited similar profiles in terms of taxonomic composition (ANOSIM p = 0.01, R = 0.117) and alpha-diversity (Figure 2). Native and invasive species share five fungal families. As with bacteria, three fungal families appear unique to D. suzukii: Cordycipitaceae, likely a Diptera pathogen (), Bulleribasidiaceae, which in its yeast state is used by D. suzukii as a food source (), and Chrysozymaceae, a yeast previously identified from ghost moth gut (Thitarodes sp.) ().
Discussion
Microbes sourced from the local environment play myriad roles in host physiology including nutrient scavenging (; ), toxin inactivation (; ), stress resilience (; ; ), lipid metabolism, and sleep regulation (). Given the broad range and global invasion of D. suzukii, we hypothesized that local microbial associations might accompany colonization and regional establishment. Specifically, we predicted that microbiomes of D. suzukii from different sites would contain different communities and more closely resemble those of local drosophilids. Alternatively, successful colonization could be aided by a core microbiome that is maintained regardless of host location. Our analysis of D. suzukii microbiomes collected from three continents and two islands provides evidence for both of these scenarios. While these results identify compositional trends rather than functional roles, they establish a valuable foundation for future experiments to test how microbiome variation influences colonization and host physiology.
Multi-region trends and local influences on the D. suzukii bacterial microbiome
Wild populations from each of the major sites exhibited distinct compositional differences, indicating geographically structured variation in microbiome composition. However, three of the seven families present in all wild D. suzukii, Acetobacteraceae, Erwiniaceae, and Pseudomonadaceae, were also found in a recent survey of wild D. suzukii populations from Oregon (USA) and Missouri (USA) (), consistent with the possibility that taxa from these families form stable, mutualistic associations with D. suzukii. Two of the D. suzukii-associated bacterial families have species members with sugar production and cellulose degradation activities, and may facilitate D. suzukii’s ability to use multiple host fruits (; ; ; ). Both Acetobacteraceae and Lactobacillaceae are considered facultative members of the D. melanogaster microbiome that promote host growth and participate in nutritional mutualism (; ). The Erwiniaceae family is also found in another widespread invasive insect, ambrosia beetles, for which it provides nutritional support and antibiotic protection (). The incorporation of bacterial taxa that offer enhanced metabolic capabilities is a common strategy observed in multiple invasive host species. Understanding the functional contributions of these microbes to D. suzukii adaptation may identify novel strategies for population control ().
Comparing the microbiomes of invasive species to native Hawaiian species
Although D. suzukii in Hawai‘i share features of their microbial profile with populations from other regions, their microbiome composition more closely resembles that of other Hawaiian drosophilids. This outcome indicates that D. suzukii populations may both retain a subset of widespread bacterial families regardless of area of occurrence, yet enrich for other groups of local bacteria when colonizing a new habitat. For example, the Rhizobiaceae family, which appears to be enriched only in Hawai‘i D. suzukii, belong to the Bacteroidetes phyla, members of which are capable of degrading simple and complex polysaccharidess (; ). At the level of genus, two taxa appear to be enriched in Hawai‘i D. suzukii: Zymobacter and Citrobacte, both of which are known to confer beneficial properties to host insects. Zymobacter facilitates sugar fermentation and is relatively abundant in field-collected mosquitoes and stingless bees (; ). In addition, Citrobacter provides resistances to insecticide and enhances development in black soldier flies (; ). Incorporation of microbes that potentially enhance metabolic capabilities may allow D. suzukii to expand its ecological niche. These associations may reflect conserved adaptation strategies in addition to widespread and consistent opportunistic colonization. Future studies of native vs. invasive flies from other sites are needed to determine whether this is a general strategy. Additionally, measurements of host range and adaptation paired with experimental manipulation of the microbiome will directly address the hypothesis that local microbe incorporation is a necessary step for successful colonization.
D. immigrans is considered a member of the guild of cosmopolitan Drosophila species, found worldwide (). Notably, the microbiome of D. immigrans, first reported in Hawai‘i in 1948 (), more closely resembles that of endemic Hawaiian flies than D. suzukii, a species that arrived only in 1980 (). The extended establishment time of D. immigrans in Hawai‘i compared to D. suzukii may have allowed the former to assimilate more of the local microbes. The mycobiome communities of invasive vs. native flies in the Hawaiian Island also exhibit similar compositional profiles. Given that flies obtain much of their microbiome through diet and environment interactions rather than vertical transmission (), the general overlap in fungal composition may reflect shared habitats among the native and invasive drosophilids in Hawai‘i (; ; ).
Overall, our findings reveal both geographic differentiation and partial overlap in D. suzukii microbiomes across continents and the Hawaiian Islands. These patterns are consistent with a core microbiome retained across regions and with enrichment of locally prevalent microbes. These results also suggest that plasticity in the D. suzukii microbiome may facilitate this species’ rapid colonization of novel ecological niches. Similar to a previous study of invasive Siganus fish in the Mediterranean Sea (), we identified a shift in microbiome composition when comparing D. suzukii from the native range in Asia to invaded ranges. Whether compositional change provides adaptive advantages (e.g., expanding dietary resources) remains an open question. Further functional exploration of how microbes contribute to host physiology and local adaptation through, for example, common garden transplant experiments with native vs. invasive hosts may lead to the development of new microbiome methods for population control. Incorporating microbiome manipulations and metagenomic analyses into invasion ecology could also clarify whether microbes act as opportunistic colonizers or facilitators of ecological expansion.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/, PRJNA1270093 https://www.ncbi.nlm.nih.gov/, PRJEB50289 https://www.ncbi.nlm.nih.gov/, PRJNA412893 https://www.ncbi.nlm.nih.gov/, PRJNA347319 https://www.ncbi.nlm.nih.gov/, PRJNA719706.
Ethics statement
The manuscript presents research on animals that do not require ethical approval for their study.
Author contributions
MM: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Writing – original draft, Writing – review & editing. AB: Conceptualization, Data curation, Formal Analysis, Methodology, Writing – original draft, Writing – review & editing. DP: Conceptualization, Resources, Writing – original draft, Writing – review & editing. JY: Conceptualization, Funding acquisition, Investigation, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing.
Funding
The author(s) declare that financial support was received for the research and/or publication of this article. This work was funded by the National Science Foundation Grant No. 2025669 (MM, JY) and National Institutes of Health Grant No. P20GM125508 (MM, AB, JY). Samples for high throughput sequencing were processed by the UHM Microbial Genomics and Analytical Laboratory core (supported by NIH NIGMS P20GM125508 and P20GM139753).
Acknowledgments
We are grateful to the following individuals for assisting with field work: Keahi Bustamente, Will Haines, Dennis Hokama, Kevin & Linda Jenkins, Kelli Konicek, Karl Magnacca, David Medeiros, Ann Nguyen, and Michelle Smith. Additionally, we thank the following agencies for permitting us to conduct this research: Division of Forestry and Wildlife (State of Hawai‘i and local offices of L‘anai and Hawai‘i Island), The Nature Conservatory on Moloka‘i, Hawai‘i Volcanoes National Park, Hawai‘i Experimental Tropical Forest, and Pūlama Lāna‘i. Access to field sites was authorized under I2456 (Big Island 2019) and HAVO-2021-SCI-0013 (Hawai‘i Volcanoes National Park). We thank Andrea Jani for helpful discussions on statistical analysis.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fevo.2025.1696606/full#supplementary-material
References
1
AdrionJ. R.KousathanasA.PascualM.BurrackH. J.HaddadN. M.BerglandA. O.et al. (2014). Drosophila suzukii: the genetic footprint of a recent, worldwide invasion. Mol. Biol. Evol.31, 3148–3163. doi: 10.1093/molbev/msu246
2
AndreazzaF.BernardiD.dos SantosR. S. S.GarciaF. R. M.OliveiraE. E.BottonM.et al. (2017). Drosophila suzukii in Southern Neotropical region: current status and future perspectives. Neotropical Entomology46, 591–605. doi: 10.1007/s13744-017-0554-7
3
ArisdakessianC.ClevelandS. B.BelcaidM. (2020). “ MetaFlow|mics: Scalable and reproducible nextflow pipelines for the analysis of microbiome marker data,” in Practice and Experience in Advanced Research Computing (PEARC ‘20). (New York, NY, USA: Association for Computing Machinery).
4
BhandariR.WongA.-N.LeeJ. C.BoydA.ShelbyK.RingbauerJ.Jr.et al. (2025). Microbiome composition and co-occurrence dynamics in wild Drosophila suzukii are influenced by host crop, fly sex, and sampling location. Microbiol. Spectr.13, e0260824. doi: 10.1128/spectrum.02608-24
5
BingX.GerlachJ.LoebG.BuchonN. (2018). Nutrient-dependent impact of microbes on Drosophila suzukii development. mBio9, e02199-17. doi: 10.1128/mBio.02199-17
6
BoldaM. P.GoodhueR.ZalomF. (2010). Spotted wing drosophila: potential economic impact of a newly established pest. Giannini Foundation Agric. Econ13, 5–8.
7
CalabriaG.MácaJ.BächliG.SerraL.PascualM. (2012). First records of the potential pest species Drosophila suzukii (Diptera: Drosophilidae) in Europe. J. Appl. Entomology136, 139–147. doi: 10.1111/j.1439-0418.2010.01583.x
8
CallahanB. J.McMurdieP. J.RosenM. J.HanA. W.JohnsonA. J.HolmesS. P. (2016). DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods13, 581–583. doi: 10.1038/nmeth.3869
9
Cambronero-HeinrichsJ. C.BattistiA.BiedermannP. H. W.CavalettoG.Castro-GutierrezV.FavaroL.et al. (2023). Erwiniaceae bacteria play defensive and nutritional roles in two widespread ambrosia beetles. FEMS Microbiol. Ecol.99, fiad144. doi: 10.1093/femsec/fiad144
10
ChandlerJ. A.LangJ. M.BhatnagarS.EisenJ. A.KoppA. (2011). Bacterial communities of diverse Drosophila species: ecological context of a host-microbe model system. PLoS Genet.7, e1002272. doi: 10.1371/journal.pgen.1002272
11
ChengD.GuoZ.RieglerM.XiZ.LiangG.XuY. (2017). Gut symbiont enhances insecticide resistance in a significant pest, the oriental fruit fly Bactrocera dorsalis (Hendel). Microbiome5, 13. doi: 10.1186/s40168-017-0236-z
12
ChevalierC.StojanovićO.Colin DidierJ.Suarez-ZamoranoN.TaralloV.Veyrat-DurebexC.et al. (2015). Gut microbiota orchestrates energy homeostasis during cold. Cell163, 1360–1374. doi: 10.1016/j.cell.2015.11.004
13
CiniA.IoriattiC.AnforaG. (2012). A review of the invasion of Drosophila suzukii in Europe and a draft research agenda for integrated pest management. Bull. Insectol.65, 149–160.
14
CurbeloK.PriceD. K.KochJ. B. (2022). Brief assessment of Drosophila suzukii (Diptera: Drosophilidae) abundance in forest and non-forested habitats across an altitude gradient on Mauna Loa, Hawai‘i. Pac Sci.75, 513–524. doi: 10.2984/75.4.4
15
DepráM.PoppeJ. L.SchmitzH. J.De ToniD. C.ValenteV. L. S. (2014). The first records of the invasive pest Drosophila suzukii in the South American continent. J. Pest Sci.87, 379–383. doi: 10.1007/s10340-014-0591-5
16
DouglasA. E. (2019). Simple animal models for microbiome research. Nat. Rev. Microbiol.17, 764–775. doi: 10.1038/s41579-019-0242-1
17
EscalasA.AuguetJ. C.AvouacA.BelmakerJ.DailianisT.KiflawiM.et al. (2022). Shift and homogenization of gut microbiome during invasion in marine fishes. Anim. Microbiome4, 37. doi: 10.1186/s42523-022-00181-0
18
FengS.DeGreyS. P.GuédotC.SchovilleS. D.PoolJ. E. (2024). Genomic diversity illuminates the environmental adaptation of Drosophila suzukii. Genome Biol. Evol.16, evae195. doi: 10.1093/gbe/evae195
19
FountainM. T.BennettJ.Cobo-MedinaM.Conde RuizR.DeakinG.DelgadoA.et al. (2018). Alimentary microbes of winter-form Drosophila suzukii. Insect Mol. Biol.27, 383–392. doi: 10.1111/imb.12377
20
GaoH. H.ZhaoS.WangR. J.QinD. Y.ChenP.ZhangA. S.et al. (2023). Gut bacterium promotes host fitness in special ecological niche by affecting sugar metabolism in Drosophila suzukii. Insect Sci.30, 1713–1733. doi: 10.1111/1744-7917.13189
21
HallM. A.BrettellL. E.LiuH.NackoS.Spooner-HartR.RieglerM.et al. (2020). Temporal changes in the microbiome of stingless bee foragers following colony relocation. FEMS Microbiol. Ecol.97, fiaa236. doi: 10.1093/femsec/fiaa236
22
HambyK. A.BecherP. G. (2016). Current knowledge of interactions between Drosophila suzukii and microbes, and their potential utility for pest management. J. Pest Sci.89, 621–630. doi: 10.1007/s10340-016-0768-1
23
HauserM. (2011). A historic account of the invasion of Drosophila suzukii (Matsumura) (Diptera: Drosophilidae) in the continental United States, with remarks on their identification. Pest Manag Sci.67, 1352–1357. doi: 10.1002/ps.2265
24
HegdeS.KhanipovK.AlbayrakL.GolovkoG.PimenovaM.SaldañaM. A.et al. (2018). Microbiome Interaction Networks and Community Structure From Laboratory-Reared and Field-Collected Aedes aEgypti, Aedes albopictus, and Culex quinquefasciatus Mosquito Vectors. Front. Microbiol.9. doi: 10.3389/fmicb.2018.02160
25
HouwenhuyseS.StoksR.MukherjeeS.DecaesteckerE. (2021). Locally adapted gut microbiomes mediate host stress tolerance. ISME J.15, 2401–2414. doi: 10.1038/s41396-021-00940-y
26
Jiménez-PadillaY.EsanE. O.FloateK. D.SinclairB. J. (2020). Persistence of diet effects on the microbiota of Drosophila suzukii (Diptera: Drosophilidae). Can. Entomol152, 516–531. doi: 10.4039/tce.2020.37
27
KaneshiroK. Y. (1983). Drosophila (Sophophora) suzukii (Matsumura). Proc. Hawaiian Entomol Soc.24, 179.
28
KanzawaT. (1939). Studies on Drosophila suzukii Mats. Kofu, Yamanashi Agric. Exp. Sta. 49. Rev App Ent. 29, 622.
29
KochJ. B.DupuisJ. R.JardelezaM.-K.OuedraogoN.GeibS. M.FollettP. A.et al. (2020). Population genomic and phenotype diversity of invasive Drosophila suzukii in Hawai‘i. Biol. Invasions22, 1753–1770. doi: 10.1007/s10530-020-02217-5
30
KohlK. D.WeissR. B.CoxJ.DaleC.DearingM. D. (2014). Gut microbes of mammalian herbivores facilitate intake of plant toxins. Ecol. Lett.17, 1238–1246. doi: 10.1111/ele.12329
31
KoštálV.KorbelováJ.ŠtětinaT.PoupardinR.ColinetH.ZahradníčkováH.et al. (2016). Physiological basis for low-temperature survival and storage of quiescent larvae of the fruit fly Drosophila melanogaster. Sci. Rep.6, 32346. doi: 10.1038/srep32346
32
KwadhaC. A.OkwaroL. A.KlemanI.RehermannG.RevadiS.NdlelaS.et al. (2021). Detection of the spotted wing drosophila, Drosophila suzukii, in continental sub-Saharan Africa. J. Pest Sci.94, 251–259. doi: 10.1007/s10340-021-01330-1
33
LeblancL.O'GradyP.RubinoffD.MontgomeryS. (2009). New immigrant drosophilidae in Hawaii, and a checklist of the established immigrant species. Proc. Hawaiian Entomol Soc.41, 121–127.
34
LinQ.ZhaiY.ChenH.QinD.ZhengL.GaoH. (2021). Analyses of the gut bacteriomes of four important Drosophila pests. Can. Entomologist153, 757–773. doi: 10.4039/tce.2021.45
35
LittleC. M.ChapmanT. W.HillierN. K. (2020). Plasticity is key to success of Drosophila suzukii (Diptera: Drosophilidae) invasion. J. Insect Sci.20, 5. doi: 10.1093/jisesa/ieaa034
36
LiuG.ZhengX.LongH.RaoZ.CaoL.HanR. (2021). Gut bacterial and fungal communities of the wild and laboratory-reared thitarodes larvae, host of the Chinese medicinal fungus Ophiocordyceps sinensis on Tibetan Plateau. Insects12, 5. doi: 10.3390/insects12040327
37
López-HernándezM. G.Rincón-RosalesR.Rincón-MolinaC. I.Manzano-GómezL. A.Gen-JiménezA.Maldonado-GómezJ. C.et al. (2025). Diversity and functional potential of gut bacteria associated with the insect Arsenura armida (Lepidoptera: Saturniidae). Insects16, 711. doi: 10.3390/insects16070711
38
LuoX.FangG.ChenK.SongY.LuT.Tomberlin JefferyK.et al. (2023). A gut commensal bacterium promotes black soldier fly larval growth and development partly via modulation of intestinal protein metabolism. mBio14, e01174–e01123. doi: 10.1128/mbio.01174-23
39
MagnaccaK. N.FooteD.O'GradyP. M. (2008). A review of the endemic Hawaiian Drosophilidae and their host plants. Zootaxa1728, 1–58. doi: 10.11646/zootaxa.1728.1.1
40
MainlandG. B. (1949). Note on new drosophilids. Proc. Hawaiian Entomol Soc.13, 326–327.
41
Martinez-SañudoI.SimonatoM.SquartiniA.MoriN.MarriL.MazzonL. (2018). Metagenomic analysis reveals changes of the Drosophila suzukii microbiota in the newly colonized regions. Insect Sci.25, 833–846. doi: 10.1111/1744-7917.12458
42
McMurdieP. J.HolmesS. (2013). phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PloS One8, e61217. doi: 10.1371/journal.pone.0061217
43
MedeirosM. J.SchovilleS.PriceD.YewJ. Y. (2025). Abiotic factors are the primary determinants of endemic Hawaiian Drosophila microbiome assembly. bioRxiv. doi: 10.1101/2025.05.06.652154
44
MedeirosM. J.SeoL.MaciasA.PriceD. K.YewJ. Y. (2024). Bacterial and fungal components of the microbiome have distinct roles in Hawaiian Drosophila reproduction. ISME Comm4, ycae134. doi: 10.1093/ismeco/ycae134
45
MérelV.GibertP.BuchI.Rodriguez RadaV.EstoupA.GautierM.et al. (2021). The worldwide invasion of Drosophila suzukii is accompanied by a large increase of transposable element load and a small number of putatively adaptive insertions. Mol. Biol. Evol.38, 4252–4267. doi: 10.1093/molbev/msab155
46
MuellerU. G.MikheyevA. S.HongE.SenR.WarrenD. L.SolomonS. E.et al. (2011). Evolution of cold-tolerant fungal symbionts permits winter fungiculture by leafcutter ants at the northern frontier of a tropical ant–fungus symbiosis. Proc. Natl. Acad. Sci. U.S.A.108, 4053. doi: 10.1073/pnas.1015806108
47
Naranjo-LázaroJ. M.Mellín-RosasM. A.González-PadillaV. D.Sánchez-GonzálezJ. A.Moreno-CarrilloG.Arredondo-BernalH. C. (2014). Susceptibility of Drosophila suzukii matsumura (Diptera: Drosophilidae) to entomophatogenic fungi. Southwestern Entomologist39, 201–203. doi: 10.3958/059.039.0119
48
NetrusovA. I.LiyaskinaE. V.KurgaevaI. V.LiyaskinaA. U.YangG.RevinV. V. (2023). Exopolysaccharides producing bacteria: A review. Microorganisms11, 1541. doi: 10.3390/microorganisms11061541
49
NilssonR. H.LarssonK. H.TaylorA. F. S.Bengtsson-PalmeJ.JeppesenT. S.SchigelD.et al. (2019). The UNITE database for molecular identification of fungi: handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res.47, D259–d264. doi: 10.1093/nar/gky1022
50
NunneyL. (1996). The colonization of organges by the cosmopolitan Drosophila. Oecologia108, 552–561. doi: 10.1007/bf00333733
51
NwezeJ. E.ŠustrV.BruneA.AngelR. (2024). Functional similarity, despite taxonomical divergence in the millipede gut microbiota, points to a common trophic strategy. Microbiome12, 16. doi: 10.1186/s40168-023-01731-7
52
PaisI. S.ValenteR. S.SporniakM.TeixeiraL. (2018). Drosophila melanogaster establishes a species-specific mutualistic interaction with stable gut-colonizing bacteria. PloS Biol.16, e2005710. doi: 10.1371/journal.pbio.2005710
53
ParadaA. E.NeedhamD. M.FuhrmanJ. A. (2016). Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ. Microbiol.18, 1403–1414. doi: 10.1111/1462-2920.13023
54
PoyetM.Le RouxV.GibertP.MeirlandA.PrévostG.EslinP.et al. (2015). The wide potential trophic niche of the Asiatic fruit fly Drosophila suzukii: the key of its invasion success in temperate Europe? PloS One10, e0142785. doi: 10.1371/journal.pone.0142785
55
PriceD. K.WestK.Cevallos-ZeaM.CahanS. H.NunezJ. C. B.LongmanE. K.et al. (2025). Microbiome composition shapes temperature tolerance in a Hawaiian picture-winged Drosophila. J. Exp. Biol. 228, 1–14. doi: 10.1242/jeb.250973
56
QuastC.PruesseE.YilmazP.GerkenJ.SchweerT.YarzaP.et al. (2013). The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res.41, D590–D596. doi: 10.1093/nar/gks1219
57
R Core Team (2022). R: A language and environment for statistical computing (Vienna, Austria: R.F.f.S. Computing).
58
RobertV.VuD.AmorA. B.van de WieleN.BrouwerC.JabasB.et al. (2013). MycoBank gearing up for new horizons. IMA Fungus4, 371–379. doi: 10.5598/imafungus.2013.04.02.16
59
Sánchez-RamosI.FernándezC. E.González-NúñezM. (2019a). Comparative analysis of thermal performance models describing the effect of temperature on the preimaginal development of Drosophila suzukii. J. Pest Sci.92, 523–541. doi: 10.1007/s10340-018-1030-9
60
Sánchez-RamosI.Gómez-CasadoE.FernándezC. E.González-NúñezM. (2019b). Reproductive potential and population increase of Drosophila suzukii at constant temperatures. Entomologia Generalis39, 103–115. doi: 10.1127/entomologia/2019/0794
61
ShikJ. Z.DussutourA. (2020). Nutritional dimensions of invasive success. Trends Ecol. Evol.35, 691–703. doi: 10.1016/j.tree.2020.03.009
62
ShuR.HahnD. A.JurkevitchE.LiburdO. E.YuvalB.WongA. C.-N. (2021). Sex-dependent effects of the microbiome on foraging and locomotion in Drosophila suzukii. Front. Microbiol.12. doi: 10.3389/fmicb.2021.656406
63
StaubachF.BainesJ. F.KunzelS.BikE. M.PetrovD. A. (2013). Host species and environmental effects on bacterial communities associated with Drosophila in the laboratory and in the natural environment. PLoS One8, e70749. doi: 10.1371/journal.pone.0070749
64
StorelliG.DefayeA.ErkosarB.HolsP.RoyetJ.LeulierF. (2011). Lactobacillus plantarum promotes Drosophila systemic growth by modulating hormonasignals through TOR-dependent nutrient sensing. Cell Metab.14, 403–414. doi: 10.1016/j.cmet.2011.07.012
65
TaitG.MermerS.StocktonD.LeeJ.AvosaniS.AbrieuxA.et al. (2021). Drosophila suzukii (Diptera: Drosophilidae): A decade of research towards a sustainable integrated pest management program. J. Econ Entomol114, 1950–1974. doi: 10.1093/jee/toab158
66
TefitM. A.BudimanT.DupriestA.YewJ. Y. (2023). Environmental microbes promote phenotypic plasticity in reproduction and sleep behaviour. Mol. Ecol.32, 5186–5200. doi: 10.1111/mec.17095
67
Vera-Ponce de LeónA.JahnesB. C.DuanJ.Camuy-VélezL. A.SabreeZ. L. (2020). Cultivable, host-specific bacteroidetes symbionts exhibit diverse polysaccharolytic strategies. Appl. Environ. Microbiol.86, e00091-20. doi: 10.1128/aem.00091-20
68
WhiteT. J.BrunsT.LeeS.TaylorJ. W. (1990). “ Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics,” in PCR protocols: a guide to methods and applications. Eds. InnisM. A.GelfandD. H.SninskyJ. J.WhiteT. J. ( Academic Press, Inc, New York, NY), 315–322.
69
WünscheJ.SchmidJ. (2023). Acetobacteraceae as exopolysaccharide producers: Current state of knowledge and further perspectives. Front. Bioeng Biotechnol.11. doi: 10.3389/fbioe.2023.1166618
70
YamadaR.DeshpandeS. A.BruceK. D.MakE. M.JaW. W. (2015). Microbes promote amino acid harvest to rescue undernutrition in Drosophila. Cell Rep.10, 865–872. doi: 10.1016/j.celrep.2015.01.018
71
YilmazP.ParfreyL. W.YarzaP.GerkenJ.PruesseE.QuastC.et al. (2014). The SILVA and “All-species Living Tree Project (LTP)” taxonomic frameworks. Nucleic Acids Res.42, D643–D648. doi: 10.1093/nar/gkt1209
72
ZhangS.SongF.WangJ.LiX.ZhangY.ZhouW.et al. (2024). Gut microbiota facilitate adaptation of invasive moths to new host plants. ISME J.18, wrae031. doi: 10.1093/ismejo/wrae031
Summary
Keywords
Drosophila immigrans, Hawaiian Drosophila, mycobiome, fungal microbiome, microbial diversity
Citation
Medeiros MJ, Burger AD, Price DK and Yew JY (2025) Microbiome composition of Drosophila suzukii varies across geographical regions. Front. Ecol. Evol. 13:1696606. doi: 10.3389/fevo.2025.1696606
Received
01 September 2025
Revised
10 November 2025
Accepted
17 November 2025
Published
04 December 2025
Volume
13 - 2025
Edited by
John Abraham, University of Cape Coast, Ghana
Reviewed by
Aaron Arthur Comeault, Bangor University, United Kingdom
Claudia Lange, Manaaki Whenua Landcare Research, New Zealand
Updates
Copyright
© 2025 Medeiros, Burger, Price and Yew.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Joanne Y. Yew, jyew@hawaii.edu
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.