Abstract
Identifying their food sources provides insights into mosquito foraging behaviors and directly impacts the epidemiology of mosquito-borne pathogens such as dengue, Zika, and chikungunya. Understanding these feeding patterns becomes even more relevant in ecosystems like the Atlantic Forest, where biodiversity is rich and complex. The present study was conducted in Atlantic Forest remnants of the Guapiaçu Ecological Reserve (REGUA) and the Sítio Recanto Preservar, both located in the state of Rio de Janeiro, Brazil. We aimed to identify the food sources of mosquitoes present in these areas, contributing to a better understanding of ecological and epidemiological dynamics. Molecular techniques, such as Sanger DNA sequencing of cytochrome b (Cytb), allows for precise identification of food sources, which is fundamental for designing control and monitoring strategies for mosquito populations. A total of 1,714 mosquitoes were captured, of which only 145 females (6.98%) were engorged. The results revealed a clear tendency for the captured mosquito species to feed predominantly on humans. Additionally, we emphasize the need to continuously improve techniques to identify food sources, aiming to better understand interactions between mosquitoes and their environment. This information is crucial for developing effective policies and strategies to control vector-borne pathogens.
Introduction
Identifying the food sources of mosquitoes allows researchers to investigate their feeding patterns and preferences for different food sources. This aids in understanding their life history and the factors that may influence their search and choice of vertebrate hosts. Additionally, it reveals the impact of these habits on their survival and reproductive success (Lyimo and Ferguson, 2009; Takken and Verhulst, 2013). Understanding the feeding habits of hematophagous mosquitoes is essential to determine their role as vectors in the maintenance and transmission of pathogens among vertebrates (). Furthermore, it provides better insight into their ecological in-teractions and coevolutionary processes (Kent, 2009).
The availability of hosts in an area is one of the factors influencing mosquito blood feeding (). The Atlantic Forest biome is home to approximately 850 species of birds, 370 amphibians, 200 reptiles, 270 mammals, and 350 fishes, contributing to the maintenance of culicid populations. Originally, the Atlantic Forest covered more than 1.3 million km² across 17 states in Brazil, and was present along much of the country’s coast. However, due to human occupation and activities in the region, as expansion of agriculture with the planting of guava trees, pepper plants, ornamental grass, horse breeding and residential development only about 29% of its original coverage remains today (Ministério do Meio Ambiente, 2025). Deforestation reduces local biodiversity, causing mosquitoes, including vectors of pathogenic agents, to disperse and seek alternative food sources.
Vector-borne pathogens pose an increasing threat to the global human population, with more than 700,000 people dying annually due to infection (World Health Organization, 2017). In 2022, 249 million cases of malaria were reported, resulting in 608,000 deaths (World Health Organization, 2023). The WHO reported 4.2 million dengue cases in 2019, with an estimated 3 billion people at infection risk ().
The heterogeneity of vertebrate hosts can significantly impact the transmission of pathogens by vectors, as many hosts are sources of infection for a single pathogen (Marm Kilpatrick et al., 2006). However, given the diversity of animals, some pathogens can adapt to specific hosts (Kenney and Brault, 2014). Since mosquitoes exhibit generalist or specialist feeding behaviors, this set of factors demonstrates the complexity and importance of identifying animal species that serve as reservoir hosts for various pathogens ().
The present study aimed to investigate the food sources of mosquitoes captured during the crepuscular period at Sitio Recanto Preservar in the municipality of Silva Jardim and REGUA (Guapiaçu River Ecological Reserve) in the municipality of Cachoeiras de Macacu, both remnants of the Atlantic Forest in the state of Rio de Janeiro, Brazil.
Materials and methods
Study area
Sampling was conducted at the Sítio Recanto Preservar (SRP), Silva Jardim (22°37’10.7”S 42°18’59.5”W). This sampling point is part of the Environmental Protection Area of the São João River Basin (APA Bacia Hidrográfica do Rio São João). We also collected samples at the Guapiaçu River Ecological Reserve (REGUA), Cachoeiras de Macacu (22° 27′ 10.309 S and 42° 46′ 13.011 W). Both sampling points are located in the state of Rio de Janeiro (Figure 1).
Figure 1
The Environmental Protection Area of the São João River Basin experiences high rainfall levels from November to April, with an annual average of 2,400 mm in Silva Jardim. The dry season spans from May to September (Takizawa, 1995). It is part of the ecological region of dense ombrophilous forests, which includes montane and submontane areas, as well as lowland forests (Veloso et al., 1991). Montane forest occurs at altitudes from 500 to 1500 meters, and submontane forest is present on slopes up to 500 meters between the lowlands and montane forest. Lowland forests are found in alluvial plains and are one of the most threatened landscapes in the Atlantic Forest due to fragmentation.
REGUA is a remnant of the Atlantic Forest, located in the Guanabara Bay sub-basin, with part of the reserve situated within the Três Picos State Park, which, together with the Serra dos Órgãos National Park and the Paraíso State Ecological Station, protects a large continuous area of Atlantic Forest, covering much of the Serra dos Órgãos region, one of the areas with the greatest biodiversity in the state ().
The reserve covers an area of 7,400 hectares and features dense ombrophilous forest vegetation, with the subtypes floodplain forest in gently undulating terrain, submontane in highland undulating terrain, and alluvial in flat terrain (Pires et al., 2022). The regional climate includes rainy and hot summers (October to March) and cold, dry winters (April to September), with an annual average temperature of 23°C, peaking in January and February and dipping in June. The annual average precipitation is around 2,560mm, with December and January as the wettest months and June and July as the driest (Kurtz and De Araujo, 2000; ).
The fauna includes a high species diversity, with approximately 67 species of am-phibians, 455 species of birds, 45 species of reptiles (including the broad-snouted caiman, Caiman latirostris), and 61 species of mammals (including the southern muriqui, Brachyteles arachnoides) (Viana G. et al., 2016).
Specimen capture, storage, and identification of engorged females
Captures were conducted over two consecutive days using CDC light traps, installed at a height of 2 meters and distributed randomly. The traps were exposed from 6:00 PM to 8:00 AM the following morning. Sampling at the Sítio Recanto Preservar site was conducted from February to April and August to October 2023, while captures at REGUA occurred from March 2023 to February 2024.
Two sampling points were established at REGUA (geographic coordinates (S) 22° 27’10.309 (W) 42°4613.011): Point 1 (yellow trail), located near the reserve headquarters, features a very low elevation and surrounds the entire lake, with vegetation that includes a mix of reintroduced native species; Point 2 (green trail), located at a higher elevation in the submontane zone, features dense and diverse forest with restored secondary forest terrain. Although these sampling points differ significantly in terms of elevation and possibly environmental complexity, they are both part of ecological restoration efforts and the promotion of local biodiversity.
The sampling point at Sítio Recanto Preservar is represented by an environment with a dense shrub layer, where tall trees are positioned very close to each other. This vegetation type suggests a dense forest ecosystem with a complex vertical structure that provides a range of unique conditions for local biodiversity.
The captured specimens were placed in polyethylene cages, labeled according to their origin, stored in thermal boxes, and transported alive to the field support laboratory. Subsequently, they were anesthetized by exposure to chloroform vapor and kept in a freezer (4 °C) to halt the digestive process.
Male and female specimens were separated and identified on a refrigerated table to preserve vertebrate DNA using dichotomous keys developed by Lane (1953a, b), Consoli & Lourenço-de-Oliveira (1994), Forattini (2002), and Marcondes & Alencar (2010). After identification, the specimens were stored in an ultra-freezer at -80°C for subsequent molecular analysis.
Molecular analysis
DNA extraction was performed using the TransGen Biotech kit: EasyPure Viral DNA/RNA (code#ER201–02 TransGen Biotech, Beijing, China), following the manufacturer’s protocol from the macerated head and abdomen of the mosquito, previously separated with a scalpel. Then, the material was quantified and tested for quality using a Denovix DS-11 FX spectrophotometer (Denovix Inc., Wilmington, US); only good-quality samples proceeded to the next stage.
Food sources were identified using two pairs of primers that amplify a mitochondrial DNA (mtDNA) fragment of the cytochrome B (CytB) gene (Table 1). These primers are considered universal for vertebrates and do not amplify mosquito DNA; therefore, they are useful in amplifying only the blood meal they consumed (Malmqvist et al., 2004).
Table 1
| Primer | Sequence (5’-3’) | Region | Amplicon size (pb) | References |
|---|---|---|---|---|
| L14841 Forward | AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA | 14841 | 305 | (Kocher et al., 1989) |
| H15149 Reverse | AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA | 15149 | 305 | (Kocher et al., 1989) |
| VF Forward | GAGGMCAAATATCATTCTGAGG | 15150 | 457 | (Townzen et al., 2008) |
| VR Reverse | TAGGGCVAGGACTCCTCCTAGT | 15607 | 457 | (Townzen et al., 2008) |
Sequences of the two pairs of primers used and the size of their amplicons used in the present study.
VF, vertebrate forward; VR, vertebrate reverse.
The protocol used for the L14841/H15149 primers was adapted from (). The PCR reaction was performed in a final volume of 25μL, containing 2mM of MgCl2, 2mM of dNTP, 1.0µM of each primer, 2.5x of 10x buffer, 0.4µM of Taq DNA polymerase, 5µL of DNA, and ultrapure water to complete the final solution. Amplification involved an initial step at 95°C for 5 minutes, followed by 35 cycles at 95°C for 1 minute, 50°C for 1 minute, 72°C for 1 minute, and a final extension at 72°C for 5 minutes.
The protocol used for the VF/VR primers was adapted from (). The PCR reaction was also performed in a final volume of 25μL, containing 0.5µM of each primer, 1.5mM of MgCl2, 2.5 mM of dNTPs, 2.5x of 10x buffer, 0.4µM of Taq DNA polymerase, 5µL of sample DNA, and ultrapure water to complete the final volume. Amplification involved an initial step at 95°C for 1 minute, followed by 35 cycles at 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 40 seconds, and a final extension at 72°C for 10 minutes.
After PCR, 5μL of the amplified product was subjected to 1.5% agarose gel elec-trophoresis. The gels were placed in a container with 0.05% ethidium bromide solution for 5 to 10 minutes to visualize the bands under a UV transilluminator at 260nm.
The PCR product was purified for all materials that amplified the CytB mtDNA fragment using the protocol established in the PCR Purification Kit (Cellco Biotec do Brasil Ltda., São Carlos, Brazil—cat#DPK-106L). Part of the purified material was used for sequencing, and the remainder was preserved in an ultra-freezer at -80°C as a reserve for future confirmation if necessary. After purification, the amplified samples were sent for Sanger sequencing at the RPT-01A Sequencing Platform of the Oswaldo Cruz Institute–RJ (FIOCRUZ), Rio de Janeiro, Brazil.
Sequence analysis
The sequences obtained from sequencing were processed using Geneious R11 v.11.1.5 (Biomatters Ltd., Auckland, New Zealand). The food source was identified by aligning the sequencing data with sequences deposited in the GenBank database (NCBI: National Center for Biotechnology Information —https://blast.ncbi.nlm.nih.gov/Blast.cgi) using the BLAST tool and the MUSCLE algorithm. A vertebrate was considered a food source when the sequences showed a similarity of > 95%.
Results
Sampling at the Guapiaçu Ecological Reserve (REGUA) and the Recanto Preservar site yielded a total of 1,714 mosquitoes. At Recanto Preservar, 653 specimens representing 21 species were collected, while 1,061 mosquitoes, corresponding to 31 species, were collected at REGUA (Table 2). Of the total captured mosquitoes, only 145 females (8.46%) were engorged. Subsequent molecular analysis showed that the DNA of only 55 of these engorged samples (37.93%) was successfully amplified. Blood meals could not be detected in the remaining 90 engorged females, as the tested primers did not yield any amplification.
Table 2
| Species | REGUA | SRP | Total |
|---|---|---|---|
| Aedeomyia (Ady.) squamipennis (Lynch Arribálzaga, 1878) | 4 | – | 4 |
| Aedes (Och.) scapularis (Rondani, 1848) | 7 | 184 | 191 |
| Ae. (Och.) serratus (s.l.) (Theobald, 1901) | 3 | 12 | 15 |
| Ae. (Pro.) argyrothorax (Bonne-Wepster & Bonne, 1920) | 9 | – | 9 |
| Ae. (Stg.) albopictus (Skuse, 1895) | 2 | 6 | 8 |
| Anopheles (Nys.) albitarsis Lynch-Arribálzaga, 1878 | 51 | 1 | 52 |
| Anopheles (Ker.) cruzii Dyar & Knab, 1908 | 2 | – | 2 |
| An. (Nys.) deaneorum Rosa-Freitas, 1989 | 2 | – | 2 |
| An. (Ano.) evandroi Costa Lima, 1937 | 1 | – | 1 |
| An. (Nys.) evansae (Brèthes, 1926) | 42 | 12 | 54 |
| An. (Ano.) maculipes (Theobald, 1903) | 4 | – | 4 |
| Anopheles spp. | 3 | 2 | 5 |
| Chagasia fajardi (Lutz, 1904) | 1 | – | 1 |
| Coquillettidia (Rhy.) albicosta (Chagas, 1908) | 21 | – | 21 |
| Coquillettidia (Coq.) chrysosoma (Edwards, 1915) | – | 1 | 1 |
| Cq. (Rhy.) chrysonotum (Peryassú,1922) | 3 | 6 | 9 |
| Cq. (Rhy.) fasciolata (Lynch-Arribálzaga, 1891) | 139 | 49 | 188 |
| Cq. (Rhy.) juxtamansonia (Chagas, 1907) | 12 | – | 12 |
| Cq. (Rhy.) shannoni (Lane & Antunes, 1937) | – | 6 | 6 |
| Cq. (Rhy.) venezuelensis (Theobald, 1912) | 25 | – | 25 |
| Culex spp. | 183 | – | 183 |
| Cx. (Mel.) clarki Evans, 1924 | 21 | – | 21 |
| Cx. (Cux.) spp. | 126 | 19 | 145 |
| Cx. (Mcx.) pleuristriatus Theobald, 1903 | 1 | – | 1 |
| Cx. (Mcx.) sp. | 11 | – | 11 |
| Cx. (Mel.) erraticus (Dyar & Knab, 1906) | 2 | – | 2 |
| Cx. (Mel.) pereyrai Duret, 1967 | 2 | – | 2 |
| Cx. (Mel.) spp. | 235 | 22 | 257 |
| Haemagogus (Hag.) leucocelaenus (Dyar & Shannon, 1924) | 1 | 4 | 5 |
| Limatus durhamii Theobald, 1901 | 1 | 1 | 2 |
| Mansonia (Man.) humeralis Dyar & Knab, 1916 | – | 1 | 1 |
| Mansonia (Man.) indubitans Dyar & Shannon, 1925 | 1 | – | 1 |
| Ma. (Man.) titillans (Walker, 1848) | 73 | 29 | 102 |
| Psorophora (Jan.) albipes (Theobald, 1907) | – | 121 | 121 |
| Psorophora (Jan.) ferox (Humboldt, 1819) | 5 | 169 | 174 |
| Runchomyia (Run.) reversa (Lane & Cerqueira, 1942) | 2 | – | 2 |
| Sabethes (Sab.) chloropterus (Humboldt, 1819) | 1 | – | 1 |
| Sabethes (Pey.) identicus Dyar & Knab, 1907 | – | 2 | 2 |
| Sabethes sp. | – | 2 | 2 |
| Trichoprosopon compressum Lutz, 1905 | 3 | – | 3 |
| Tri. digitatum (Rondani, 1848) | 1 | – | 1 |
| Tr. pallidiventer (Lutz, 1905) | 6 | – | 6 |
| Trichoprosopon sp. | 1 | – | 1 |
| Uranotaenia davisi Lane, 1943 | 3 | – | 3 |
| Ur. (Ura.) calosomata Dyar & Knab, 1907 | 2 | – | 2 |
| Ur. (Ura.) geometrica Theobald, 1901 | 4 | – | 4 |
| Ur. (Ura.) pulcherrima Lynch-Arribálzaga, 1891 | 8 | 4 | 12 |
| Wyeomyia (Pho.) edwardsi (Lane & Cerqueira, 1942) | 8 | – | 8 |
| Wyeomyia spp. | 29 | – | 29 |
| Total | 1061 | 653 | 1714 |
Total specimens captured at the Guapiaçu Ecological Reserve (REGUA), municipality of Cachoeiras de Macacu, and at the Recanto Preservar Farmstead (SRP), municipality of Silva Jardim, state of Rio de Janeiro, Brazil.
First, PCR was performed on the blood samples using the L14841/H15149 primers, for which only 24 samples were amplified for Cytb. Subsequently, the VF/VR primers were tested, and all 55 samples were amplified for this gene.
In the samples collected at Sítio Recanto Preservar, 653 mosquitoes were captured, of which 21 females (3.21%) were engorged. However, only eight samples (9.5%) were successfully amplified, and it was possible to identify the blood meal of four of them. The remaining four samples could not be identified.
The four samples with identified blood meals corresponded to three females of Psorophora ferox (Humboldt, 1819) and one of Aedes scapularis (Rondani, 1848) (Table 3).
Table 3
| Species | Engorged females | Food sources |
|---|---|---|
| Aedes (Ochlerotatus) scapularis (Rondani, 1848) | 5 | 1 |
| Ae. (Ochlerotatus) serratus (s.l.) (Theobald, 1901) | 1 | – |
| Anopheles (Nyssorhynchus) albitarsis (Lynch-h-Arribálzaga, 1878) | 1 | – |
| An. (Nyssorhynchus) evansae (Brèthes, 1926) | 1 | – |
| Coquillettidia (Rhynchotaenia) fasciolata (Lynch-Arribálzaga, 1891) | 1 | – |
| Mansonia (Mansonia) humeralis Dyar & Knab, 1916 | 1 | – |
| Ma. (Mansonia) titillans (Walker, 1848) | 6 | – |
| Psorophora (Janthinosoma) ferox (Humboldt, 1819) | 5 | 3 |
| Total | 21 | 4 |
Engorged species captured at the Sítio Recanto Preservar, Silva Jardim, Rio de Janeiro, Brazil.
Total values are highlighted in bold at the end of the table.
At REGUA, 124 engorged females (11.69%) were captured out of a total of 1061 mosquitoes; however, only 47 samples (37.90%) were successfully amplified. At the green trail sampling point, 80 specimens were captured, of which only seven were engorged, comprising four species. Of the 955 specimens captured on the yellow trail, 117 females were engorged, comprising 16 species. No food sources were detected for the species on the green trail, so all 47 amplified samples were from the yellow trail.
Similar to observations at Sítio Recanto Preservar, the food source could not be detected for 27 specimens, while the blood meal of 20 specimens was successfully identified. The specimens corresponded to two females of Uranotaenia geometrica Theobald, 1901, ten Coquillettidia fasciolata (Lynch-Arribálzaga, 1891), two Cq. venezuelensis (Theobald, 1912), one Aedes scapularis (Rondani, 1848), one Ae. serratus (s.l.) (Theobald, 1901), one Ae. albopictus (Skuse, 1895), one Anopheles evansae (Brèthes, 1926), one An. evandroi Costa Lima, 1937 and one Culex (Melanoconion) sp. (Table 4).
Table 4
| Species | Engorged females | Yellow trail | Green trail | Food sources |
|---|---|---|---|---|
| Aedes (Stegomyia) albopictus (Skuse, 1895) | 1 | 1 | – | 1 |
| Ae. (Protomacleaya) argyrothorax (Bonne-Wepster & Bonne, 1919) | 4 | – | 4 | – |
| Aedes (Ochlerotatus) scapularis (Rondani, 1848) | 5 | 5 | – | 1 |
| Aedes (Ochlerotatus) serratus (Theobald, 1901) | 1 | 1 | – | 1 |
| Anopheles (Anopheles) evandroi Costa Lima, 1937 | 1 | 1 | – | 1 |
| An. (Nyssorhynchus) albitarsis Lynch-Arribálzaga, 1878 | 4 | 4 | – | – |
| Anopheles (Nyssorhynchus) evansae (Brèthes, 1926) | 1 | 1 | – | 1 |
| Coquillettidia (Rhynchotaenia) albicosta (Peryassú, 1908) | 4 | 4 | – | – |
| Cq. (Rhynchotaenia) chrysonotum (Peryassú,1908) | 1 | 1 | – | – |
| Cq. (Rhynchotaenia) fasciolata (Lynch-Arribálzaga, 1891) | 38 | 38 | – | 10 |
| Cq. (Rhynchotaenia) juxtamansonia (Chagas, 1907) | 1 | 1 | – | – |
| Cq. (Rhynchotaenia) venezuelensis (Theobald, 1912) | 7 | 7 | – | 2 |
| Culex (Culex) sp. | 2 | 2 | – | – |
| Culex (Melanoconion) spp. | 18 | 18 | – | 1 |
| Mansonia (Mansonia) titillans (Walker, 1848) | 30 | 30 | – | – |
| Psorophora (Janthinosoma) ferox (Humboldt, 1819) | 1 | – | 1 | – |
| Runchomyia (Runchomyia) reversa Lane & Cerqueira, 1942 | 1 | – | 1 | – |
| Trichoprosopon digitatum (Rondani, 1848) | 1 | – | 1 | – |
| Uranotaenia (Uranotaenia) geometrica Theobald, 1901 | 2 | 2 | – | 2 |
| Ur. (Uranotaenia) pulcherrima Lynch-Arribálzaga, 1891 | 1 | 1 | – | – |
| Total | 124 | 117 | 7 | 20 |
Engorged species captured at sampling points in the Guapiaçu Ecological Reserve, Cachoeiras de Macacu, Rio de Janeiro, Brazil.
Total values are highlighted in bold at the end of the table.
The detected food sources of the 24 specimens included 18 humans, one amphibian, six birds, one canid, and one mouse. However, even with a similarity of >95% in all sequences, only the sequences of humans could be published. Two samples showed multiple meals, corresponding to Cq. venezuelensis with two sources, an amphibian and a human, and Cq. fasciolata with four sources, one specimen for mouse and bird and another for human and bird. Two identified samples corresponded only to a bird genus (Table 5).
Table 5
| Mosquito species | Locality | Quantity | Food sources | Class | |
|---|---|---|---|---|---|
| Aedes scapularis (Rondani, 1848) | Sitio Recanto Preservar | 1 | Anas acuta | ||
| Coquilletidia. fasciolata (Lynch-Arribálzaga, 1891) | REGUA | 1 | Gallus gallus | Bird | |
| 1 | Harpia harpyja | ||||
| 1 | Meleagris gallopavo | ||||
| 1 | Larus sp | ||||
| 1 | Chroicocephalus sp. | ||||
| Cq. venezuelensis (Theobald, 1912) | REGUA | 1 | Pithecopus rohdei | Amphibia | |
| Anopheles evansae (Brèthes, 1926) | REGUA | 1 | Canis lupus familiaris | Mammalia | |
| Coquilletidia. fasciolata (Lynch-Arribálzaga, 1891) | REGUA | 1 | Mus musculus | ||
| Ae. albopictus (Skuse, 1895) | REGUA | 1 | Homo sapiens | ||
| Ae. scapularis (Rondani, 1848) | 1 | ||||
| Ae. serratus (Theobald, 1901) | 1 | ||||
| Anopheles evandroi Lima, 1937 | 1 | ||||
| Cq. fasciolata (Lynch-Arribálzaga, 1891) | 6 | ||||
| Cq. venezuelensis (Theobald, 1912) | 2 | ||||
| Culex (Melanoconion) sp. | 1 | ||||
| Psorophora ferox (Humboldt, 1819) | Sitio Recanto Preservar | 3 | |||
| Uranotaenia geometrica Theobald, 1901 | REGUA | 2 | |||
Mosquito species captured at Cachoeiras de Macacu and Silva Jardim, Rio de Janeiro, Brazil, and their respective food sources.
Discussion
The present findings highlight the importance of considering not only human presence but also the behavior and feeding preferences of mosquitoes when planning vector control strategies and preventing pathogens transmitted by these insects. It is essential to emphasize the need for more research to clarify better the feeding patterns of mosquitoes and their implications for public health.
The biodiversity of the Atlantic Forest is considered of extreme biological importance; however, this richness of fauna and flora is threatened by deforestation. The greater the increase in deforested areas, the faster the rate and acceleration of biodiversity loss (). The loss of native vegetation is associated with an increase in the transmission of etiological agents of arboviruses (dengue, Zika, Chikungunya, and yellow fever). Consequently, the natural habitats of vectors and their life cycles are altered, affecting their population density. It should be added that, with the degradation of forest areas and the increasing human occupation, biological vector insects approach homes and peridomestic areas, causing transmissions (Moreno, 2021).
Besides the small sample size, we have detected in the two specimens of Ae. scapularis at different sampling points, one belonging to human and one bird which is consistent with the previous studies indicating that this species exhibits a generalist behavior, feeding on birds, canids, cattle, horses, and humans (; Mucci et al., 2015; Santos et al., 2019), which corroborates our results.
Coquillettidia fasciolata was found to feed on humans, mouse and birds. It is worth noting that some bird species can disperse over long distances, frequenting terrestrial and aquatic systems (Martín-Vélez et al., 2020). Gulls, for example, are aquatic birds that can travel hundreds of kilometers between freshwater, marine, and terrestrial habitats (Viana D. S. et al., 2016). Two bird genera found in this study correspond to two gulls. However, there is no information on the occurrence of these bird genera at REGUA (; Santos et al., 2021; ). Therefore, two possibilities arise: these birds may have migrated to the region, or there was an error in sequencing editing and analysis.
In our research, the sequences corresponding to these two genera showed >95% similarity, indicating a high level of reliability. Based on this principle, one might assume that these animals were indeed present in the study area. However (Townzen et al., 2008), emphasize that verifying the distribution of vertebrates is as important as checking the similarity of sequences, as this set of variables influences the accurate identification of the blood meal taken by the mosquitoes. Therefore, although the sequences’ similarity were within the expected range, the presence of gulls around REGUA is questionable due to the type of habitat that comprises the area and the lack of records of these animals in the location.
It is undeniable that with the advent of sequencing and the range of genomes present in current databases, studies on the blood meals of hematophagous arthropods have seen unprecedented advancement (Hopken et al., 2021; Muturi et al., 2021; ). However, these results highlight the importance of improving these tools and continuing research on the subject.
The food source of a single specimen of An. evansae was identified as a canid; however, we could not determine its blood-feeding patterns due to the low sample size. Coquillettidia venezuelensis was found to fed on two food sources: an amphibian and two humans. According to () and (), the feeding habit of Cq. venezuelensis involves mammals and birds. However, in the present study, one specimen was found to have fed on an amphibian, which had not been previously recorded.
Light traps with CO2 baits have been reported to attract females searching for hosts, so they are either not fed or are partially fed with blood (Thiemann and Reisen, 2012). In our study, few engorged mosquitoes were observed, possibly due to the capture method used, as CDC traps were employed. Female mosquitoes that have just taken a blood meal tend to rest (). Therefore, resting traps should be employed, such as entomological nets (; Melgarejo-Colmenares et al., 2022) and battery-powered aspirators (Vazquez-Prokopec et al., 2009) to achieve better results in future studies.
Mosquitoes can spread pathogens to various vertebrate hosts, causing human dis-eases due to their high vector capacity (Segura et al., 2021). In the present study, human blood meals were detected in nine species, notably Ae. albopictus, a vector of several important viruses, including dengue, yellow fever, Zika, and chikungunya (Ryan et al., 2019), and Aedes serratus (s.l.), Ae. scapularis, and Ps. ferox, vectors of the yellow fever virus (; Moreno et al., 2011). These findings suggest a tendency toward human hosts among the mosquito species captured.
This dominance is likely due to the frequent presence of residents, tourists, and researchers in these forest fragments. Additionally, it is important to consider the possibility that the recorded blood meals were not taken from team members during the capture. Mosquito species are known to travel greater distances than expected, even under unfavorable conditions, to find hosts.
Mosquitoes are known for their behavioral plasticity and adaptability to environmental conditions, mainly due to their ability to adapt to different food sources, including vertebrate blood and resources available in vegetation. However, in some situations, especially when there is a reduction in the number of vertebrate hosts, mosquito species may resort to alternative blood sources, such as humans ().
Physical and chemical factors like vision, smell, heat, and humidity, as well as behavior are directly involved in the search and orientation of a vertebrate host (; ). Anopheles gambie and Ae. aegypti, for example, when coming into contact with air laden with CO2 odors, fly upwind towards the vertebrate trail (; Hinze et al., 2021). Were observed a tendency for human blood meals in Cq. fasciolata and Ps. ferox, which, according to the literature, can fly an average of 2500 meters, which is in line with previous studies (Verdonschot and Besse-Lototskaya, 2014).
The successful identification of blood meals using PCR-based methods can present some limitations, such as the low quality and quantity of the host DNA in the mosquito’s abdomen (); preservation, transportation, and storage after collection (Mukabana et al., 2002); and DNA degradation during the conservation period before extraction (King et al., 2008). The effectiveness of food source analyses varies widely between studies (Thiemann et al., 2011; ; Santos et al., 2019). In our work, 37.93% of the samples successfully amplified host DNA.
We must consider that the Sanger sequencing system used in this research has a methodological limitation, as it can only detect the target with the highest concentration. If more than one source is present, the amplified product may show multiple peaks in the chromatogram, even with highly specific primers are used, hampering their accurate identification (; Nagaki et al., 2021; Trivellone et al., 2022; ).
Another possibility highlighted in a study by (Trivellone et al., 2022) is that short primers (<25 bp) used for Sanger sequencing, can lead to conflicting results and low specificity compared to other methods like next-generation sequencing (NGS) (Martínez-Porchas et al., 2016; Trivellone et al., 2022). In this regard the sequences from the amphibian, birds, canid, and mouse were of low quality, with less than 200 bp; therefore. they were not accepted for inclusion in the NCBI database.
Our study indicates that while molecular biology techniques hold promise, various factors can influence their outcomes. This suggests that, like collection methods, these techniques still require refinement and adjustment to enhance their sensitivity.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The research was conducted in accordance with scientific license number 44333 provided by the Ministry of the Environment (MMA), Chico Mendes Institute for Bio-diversity Conservation (ICMBio), and the Biodiversity Information and Authorization System (SISBIO). Mosquitoes were collected with the consent and cooperation of landowners, residents, and local authorities. All collection team members were vaccinated against yellow fever and were aware of the potential risks in the study areas.
Author contributions
DA: Writing – review & editing, Writing – original draft, Methodology, Conceptualization. SM: Writing – review & editing, Methodology, Writing – original draft, Conceptualization. JS: Methodology, Writing – original draft. NA: Methodology, Writing – original draft. RD: Methodology, Writing – original draft. SS: Writing – original draft, Writing – review & editing. JA: Conceptualization, Writing – review & editing, Supervision, Funding acquisition, Writing – original draft.
Funding
The author(s) declare financial support was received for the research and/or publication of this article. This work was was carried out with the support of CNPq, FAPERJ, and CAPES, as well as the Conselho Nacional de Desenvolvimento Científico e Tecnológico (Grant number: 303286/2021-0, JA) and Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (E-26/200.956/2002/2022, JA.).
Acknowledgments
We would like to thank the following individuals for their support: Nicolas and Raquel at the REGUA site; and Rose Guedes, owner of Sítio Recanto Preservar, for permitting the field collections.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
AlencarJ.MelloC. F. D.Gil-SantanaH. R.GiupponiA. P. D. L.AraújoA. N.LorosaE. S.et al. (2015). Feeding patterns of mosquitoes (Diptera: culicidae) in the atlantic forest, rio de janeiro, Brazil. J. Med. Entomol52, 783–788. doi: 10.1093/jme/tjv098
2
Almeida-GomesM.SiqueiraC. C.Borges-JúniorV. N. T.VrcibradicD.Ardenghi FusinattoL.Frederico Duarte RochaC. (2014). Herpetofauna of the Reserva Ecológica de Guapiaçu (REGUA) and Its Surrounding Areas, in the State of Rio de Janeiro, Brazil. Biota Neotrop.14, 1–15. doi: 10.1590/1676-0603007813
3
AlonsoD. P.AmorimJ. A.De OliveiraT. M. P.De SáI. L. R.PossebonF. S.De CarvalhoD. P.et al. (2023). Host feeding patterns of mansonia (Diptera, culicidae) in rural settlements near porto velho, state of rondonia, Brazil. Biomolecules13, 553. doi: 10.3390/biom13030553
4
AlvaresC. A.StapeJ. L.SentelhasP. C.De Moraes GonçalvesJ. L.SparovekG. (2013). Köppen’s climate classification map for Brazil. metz22, 711–728. doi: 10.1127/0941-2948/2013/0507
5
AvanesyanA.SuttonH.LampW. O. (2021). Choosing an effective PCR-based approach for diet analysis of insect herbivores: A systematic review. J. Econ. Entomol.114, 1035–1046. doi: 10.1093/jee/toab057
6
BalasubramanianS.Curtis-RoblesR.ChirraB.AucklandL. D.MaiA.Bocanegra-GarciaV.et al. (2022). Characterization of triatomine bloodmeal sources using direct sanger sequencing and amplicon deep sequencing methods. Sci. Rep.12, 10234. doi: 10.1038/s41598-022-14208-8
7
BarbieriE. (2008). Variação sazonal do gaivotão (Larus Dominicanus) durante o ano de 2005 no estuário de Cana-néia-Iguape-Ilha Comprida, São Paulo, Brasil. Biota Neotrop.8, 97–102. doi: 10.1590/S1676-06032008000200011
8
BrancoA. F. V. C.LimaP. V. P. S.FilhoE. S. D. M.CostaB. M. G.PereiraT. P. (2021). Avaliação da perda da biodiversidade na mata atlântica. Ciec. Florestal.31, 1885–1909. doi: 10.5902/1980509853310
9
BrugmanV. A.Hernández-TrianaL. M.EnglandM. E.MedlockJ. M.MertensP. P. C.LoganJ. G.et al. (2017). Blood-feeding patterns of native mosquitoes and insights into their potential role as pathogen vectors in the thames estuary region of the United Kingdom. Parasitol. Vectors10, 163. doi: 10.1186/s13071-017-2098-4
10
CardéR. T. (2015). Multi-cue integration: how female mosquitoes locate a human host. Curr. Biol.25, R793–R795. doi: 10.1016/j.cub.2015.07.057
11
CardosoJ. D. C.De AlmeidaM. A. B.Dos SantosE.Da FonsecaD. F.SallumM. A. M.NollC. A.et al. (2010). Yellow fever virus in haemagogus leucocelaenus and aedes serratus mosquitoes, southern Brazil, 2008. Emerg. Infect. Dis.16, 1918–1924. doi: 10.3201/eid1612.100608
12
ChupilH.FarahR. F.MaranhoA.BarbosaC. B.LeonardiS.CabralJ.et al. (2024). Insights into the ecology and conservation of coastal Brazil seabirds based on band returns. Mar. Ornithol.52, 37–44. doi: 10.5038/2074-1235.52.1.1557
13
Coutinho-AbreuI. V.RiffellJ. A.AkbariO. S. (2022). Human attractive cues and mosquito host-seeking behavior. Trends Parasitol.38, 246–264. doi: 10.1016/j.pt.2021.09.012
14
De CarvalhoG. C.Dos Santos MalafronteR.Miti IzumisawaC.Souza TeixeiraR.NatalL.MarrelliM. T. (2014). Blood meal sources of mosquitoes captured in municipal parks in são paulo, Brazil. J. Vect. Ecol.39, 146–152. doi: 10.1111/j.1948-7134.2014.12081.x
15
DekkerT.CardéR. T. (2011). Moment-to-moment flight manoeuvres of the female yellow fever mosquito (Aedes aEgypti L.) in response to plumes of carbon dioxide and human skin odour. Exp. Biol.214, 3480–3494. doi: 10.1242/jeb.055186
16
DiasF. B. S.PaulaA. S. D.BelisárioC. J.LorenzoM. G.BezerraC. M.HarryM.et al. (2011). Influence of the palm tree species on the variability of rhodnius nasutus stål, 1859 (Hemiptera, reduviidae, triatominae). Infect. Genet. Evol.11, 869–877. doi: 10.1016/j.meegid.2011.02.008
17
DuvallL. B. (2019). Mosquito host-seeking regulation: targets for behavioral control. Trends Parasitol.35, 704–714. doi: 10.1016/j.pt.2019.06.010
18
FarajiA.EgiziA.FonsecaD. M.UnluI.CrepeauT.HealyS. P.et al. (2014). Comparative host feeding patterns of the asian tiger mosquito, aedes albopictus, in urban and suburban northeastern USA and implications for disease transmission. PloS Negl. Trop. Dis.8, e3037. doi: 10.1371/journal.pntd.0003037
19
ForattiniO. P.GomesA. D. C.NatalD.KakitaniI.MarucciD. (1989). Preferências alimentares e domiciliação de mosquitos Culicidae no Vale do Ribeira, São Paulo, Brasil, com especial referência a Aedes scapularis e a Culex (Melanoconion). Rev. Saúde Pública23, 9–19. doi: 10.1590/S0034-89101989000100003
20
FranciscoC. M.Da SilvaW. F. (2019). Fatores Que Influenciam No Repasto Sanguíneo de Mosquitos de Importância Médica: Um Levantamento Bibliográfico. Visa em Debate7, 60. doi: 10.22239/2317-269x.01254
21
GangulaR.ThirupathiL.ParupatiR.SreevedaK.GattojuS. (2023). Ensemble machine learning based prediction of dengue disease with performance and accuracy elevation patterns. Materials Today: Proc.80, 3458–3463. doi: 10.1016/j.matpr.2021.07.270
22
Gómez-DíazE.FiguerolaJ. (2010). New perspectives in tracing vector-borne interaction networks. Trends Parasitol.26, 470–476. doi: 10.1016/j.pt.2010.06.007
23
GyawaliN.Taylor-RobinsonA. W.BradburyR. S.HugginsD. W.HugoL. E.LowryK.et al. (2019). Identification of the source of blood meals in mosquitoes collected from north-eastern Australia. Parasitol. Vectors.12, 198. doi: 10.1186/s13071-019-3455-2
24
HaydonD. T.CleavelandS.TaylorL. H.LaurensonM. K. (2002). Identifying reservoirs of infection: A conceptual and practi-cal challenge. Emerg. Infect. Dis.8, 1468–1473. doi: 10.3201/eid0812.010317
25
Hernández-TrianaL. M.BrugmanV. A.ProsserS. W. J.WelandC.NikolovaN.ThorneL.et al. (2017). Molecular approaches for blood meal analysis and species identification of mosquitoes (Insecta: diptera: culicidae) in rural locations in southern england, United Kingdom. Zootaxa52, 4250. doi: 10.11646/zootaxa.4250.1.5
26
HinzeA.LantzJ.HillS. R.IgnellR. (2021). Mosquito host seeking in 3D using a versatile climate-controlled wind tunnel system. Front. Behav. Neurosci.15. doi: 10.3389/fnbeh.2021.643693
27
HopkenM. W.Reyes-TorresL. J.ScavoN.PiaggioA. J.AbdoZ.TaylorD.et al. (2021). Temporal and spatial blood feeding patterns of urban mosquitoes in the san juan metropolitan area, Puerto Rico. Insects.12, 129. doi: 10.3390/insects12020129
28
KenneyJ. L.BraultA. C. (2014). The role of environmental, virological and vector interactions in dictating biological transmis-sion of arthropod-borne viruses by mosquitoes. Adv. Virus Res. 89, 39–83.
29
KentR. J. (2009). Molecular methods for arthropod bloodmeal identification and applications to ecological and vector-borne disease studies. Mol. Ecol. Resour.9, 4–18. doi: 10.1111/j.1755-0998.2008.02469.x
30
KingR. A.ReadD. S.TraugottM.SymondsonW. O. C. (2008). INVITED REVIEW: molecular analysis of predation: A review of best practice for DNA-based approaches. Mol. Ecol.17, 947–963. doi: 10.1111/j.1365-294X.2007.03613.x
31
KocherT. D.ThomasW. K.MeyerA.EdwardsS. V.PääboS.VillablancaF. X.et al. (1989). Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. U.S.A.86, 6196–6200. doi: 10.1073/pnas.86.16.6196
32
KurtzB. C.De AraujoD. S. D. (2000). Composição florística e estrutura do componente arbóreo de um trecho de Mata Atlântica na Estação Ecológica Estadual do Paraíso, Cachoeiras de Macacu, Rio de Janeiro, Brasil. Rodriguésia51, 69–112. doi: 10.1590/2175-7860200051787903
33
LyimoI. N.FergusonH. M. (2009). Ecological and evolutionary determinants of host species choice in mosquito vectors. Trends Parasitol.25, 189–196. doi: 10.1016/j.pt.2009.01.005
34
MalmqvistB.StraseviciusD.HellgrenO.AdlerP. H.BenschS. (2004). Vertebrate host specificity of wild–caught blackflies revealed by mitochondrial DNA in blood. Proc. R. Soc Lond. B.271. doi: 10.1098/rsbl.2003.0120
35
Marm KilpatrickA.DaszakP.JonesM. J.MarraP. P.KramerL. D. (2006). Host heterogeneity dominates west nile virus transmission. Proc. R. Soc B.273, 2327–2333. doi: 10.1098/rspb.2006.3575
36
Martínez-PorchasM.Villalpando-CancholaE.Vargas-AlboresF. (2016). Significant loss of sensitivity and specificity in the taxonomic classification occurs when short 16S rRNA gene sequences are used. Heliyon2, e00170. doi: 10.1016/j.heliyon.2016.e00170
37
Martín-VélezV.MohringB.Van LeeuwenC. H. A.Shamoun-BaranesJ.ThaxterC. B.BaertJ. M.et al. (2020). Functional connectivity network between terrestrial and aquatic habitats by a generalist waterbird, and implications for biovectoring. Sci. Total Environ.705, 135886. doi: 10.1016/j.scitotenv.2019.135886
38
Melgarejo-ColmenaresK.CardoM. V.VezzaniD. (2022). Blood feeding habits of mosquitoes: hardly a bite in south america. Parasitol. Res.121, 1829–1852. doi: 10.1007/s00436-022-07537-0
39
Ministério do Meio AmbienteMata atlântica em desenvolvimento. (2025). Available online at: https://antigo.mma.gov.br/biomas/mata-atl%C3%A2ntica_emdesenvolvimento.html (Accessed May 21, 2024).
40
MorenoG. S. (2021). Burning, wildfires and arboviruses: emerging relationships in the pre and post pandemic. Rev. Científica ANAP Bras.14. doi: 10.3389/fmicb.2018.00702gt
41
MorenoE. S.RoccoI. M.BergoE. S.BrasilR. A.SicilianoM. M.SuzukiA.et al. (2011). Reemergence of yellow fever: detection of transmission in the state of são paulo, Brazil, 2008. Rev. Soc Bras. Med. Trop.44, 290–296. doi: 10.1590/S0037-86822011005000041
42
MucciL. F.JúniorR. P. C.De PaulaM. B.ScandarS. A. S.PacchioniM. L.FernandesA.et al. (2015). Feeding habits of mosquitoes (Diptera: culicidae) in an area of sylvatic transmission of yellow fever in the state of são paulo, Brazil. J. Venom Anim. Toxins Incl Trop. Dis.21, 6. doi: 10.1186/s40409-015-0005-z
43
MukabanaW. R.TakkenW.SedaP.KilleenG. F.HawleyW. A.KnolsB. G. J. (2002). Extent of digestion affects the success of amplifying human DNA from blood meals of anopheles Gambiae (Diptera: culicidae). Bull. Entomol. Res.92, 233–239. doi: 10.1079/BER2002164
44
MuturiE. J.DunlapC.TchouassiD. P.SwansonJ. (2021). Next generation sequencing approach for simultaneous identification of mosquitoes and their blood-meal hosts. J. Vect. Ecol.46, 116–121. doi: 10.52707/1081-1710-46.1.116
45
NagakiS. S.ChavesL. S. M.LópezR. V. M.BergoE. S.LaportaG. Z.ConnJ. E.et al. (2021). Host feeding patterns of nyssorhynchus darlingi (Diptera: culicidae) in the Brazilian amazon. Acta Trop.213, 105751. doi: 10.1016/j.actatropica.2020.105751
46
PiresR. S. A.SoaresG.SouzaR. F.TeixeiraT. S. M.Monteiro-AlvesP. S.LourençoE. C.et al. (2022). Bat Species Diversity from Reserva Ecológica de Guapiaçu, Rio de Janeiro, Brazil: A Compilation of Two Decades of Sampling. Zoologia (Curitiba).39, e22032. doi: 10.1590/s1984-4689.v39.e22032
47
RyanS. J.CarlsonC. J.MordecaiE. A.JohnsonL. R. (2019). Global expansion and redistribution of aedes-borne virus transmission risk with climate change. PloS Negl. Trop. Dis.13, e0007213. doi: 10.1371/journal.pntd.0007213
48
SantosC. S.PieM. R.Da RochaT. C.Navarro-SilvaM. A. (2019). Molecular identification of blood meals in mosquitoes (Diptera, culicidae) in urban and forested habitats in southern Brazil. PloS One14, e0212517. doi: 10.1371/journal.pone.0212517
49
SantosL. E. D.Silva-JrE.BeierC.WagenerT. L. S.SantanaA. V. D.AguiarC. A. D.et al. (2021). First records of gray-hooded gull, chroicocephalus cirrocephalus (Vieillot, 1818) (Charadriiformes, laridae), in the state of espirito santo, Brazil. CheckList.17, 21–26. doi: 10.15560/17.1.21
50
SeguraN. A.MuñozA. L.Losada-BarragánM.TorresO.RodríguezA. K.RangelH.et al. (2021). Minireview: epidemio-logical impact of arboviral diseases in latin american countries, arbovirus-vector interactions and control strategies. Pathog. Dis.79, ftab043. doi: 10.1093/femspd/ftab043
51
TakizawaF. H. (1995). Levantamento Pedológico e Zoneamento Ambiental Da Reserva Biológica de Poço Das Antas (Piracicaba - SP: Departamento de Ciência do Solo, Escola Superior de Agricultura Luiz de Queiroz, Universidade de São Paulo).
52
TakkenW.VerhulstN. O. (2013). Host preferences of blood-feeding mosquitoes. Annu. Rev. Entomol.58, 433–453. doi: 10.1146/annurev-ento-120811-153618
53
ThiemannT. C.ReisenW. K. (2012). Evaluating sampling method bias in culex tarsalis and culex quinquefasciatus (Diptera: culicidae) bloodmeal identification studies. Jnl. Med. entom.49, 143–149. doi: 10.1603/ME11134
54
ThiemannT. C.WheelerS. S.BarkerC. M.ReisenW. K. (2011). Mosquito host selection varies seasonally with host availability and mosquito density. PloS Negl. Trop. Dis.5, e1452. doi: 10.1371/journal.pntd.0001452
55
TownzenJ. S.BrowerA. V. Z.JuddD. D. (2008). Identification of mosquito bloodmeals using mitochondrial cytochrome oxidase subunit I and cytochrome b gene sequences. Med. Vet. Entomology.22, 386–393. doi: 10.1111/j.1365-2915.2008.00760.x
56
TrivelloneV.CaoY.DietrichC. H. (2022). Comparison of traditional and next-generation approaches for uncovering phyto-plasma diversity, with discovery of new groups, subgroups and potential vectors. Biology11, 977. doi: 10.3390/biology11070977
57
Vazquez-ProkopecG. M.GalvinW. A.KellyR.KitronU. (2009). A new, cost-effective, battery-powered aspirator for adult mosquito collections. J. Med. Entomol46, 1256–1259. doi: 10.1603/033.046.0602
58
VelosoH. P.Rangel FilhoA. L. R.LimaJ. C. A. (1991). Classificação da vegetação brasileira, adaptada a um sistema universal (Rio de Janeiro: Ministério da Economia, Fazenda e Planejamento, Fundação Instituto Brasileiro de Geografia e Estatística, Diretoria de Geociências, Departamento de Recursos Naturais e Estudos Ambientais), ISBN: 978-85-240-0384-4.
59
VerdonschotP. F. M.Besse-LototskayaA. A. (2014). Flight distance of mosquitoes (Culicidae): A metadata analysis to support the management of barrier zones around rewetted and newly constructed wetlands. Limnologica45, 69–79. doi: 10.1016/j.limno.2013.11.002
60
VianaD. S.SantamaríaL.FiguerolaJ. (2016). Migratory birds as global dispersal vectors. Trends Ecol. Evol.31, 763–775. doi: 10.1016/j.tree.2016.07.005
61
VianaG.AbendC.MattaD.StutzJ. P.HonoratoR.CampanárioR.et al. (2016). Guapiaçu Grande Vida. Documento de Concepção do Programa para Atividades de Reflorestamento. Projeto Guapiaçu, Grande Vida1, 1–36.
62
World Health Organization (2017). Global Vector Control Response 2017-2030 (Geneva: World Health Organization), ISBN: 978-92-4-151297-8.
63
World Health Organization (2023). World Malaria Report 2023 (Geneva: World Health Organization), ISBN: 978-92-4-008617-3.
Summary
Keywords
mosquito ecology, blood meal analysis, Atlantic Forest, anthropophily, vector-host interaction
Citation
Alves DCV, Machado SL, Silva JS, de Almeida NM, Dias R, Silva SOF and Alencar J (2026) Aspects of the blood meal of mosquitoes (Diptera: culicidae) during the crepuscular period in Atlantic Forest remnants of the state of Rio de Janeiro, Brazil. Front. Ecol. Evol. 14:1721533. doi: 10.3389/fevo.2025.1721533
Received
09 October 2025
Revised
31 October 2025
Accepted
13 November 2025
Published
15 January 2026
Volume
14 - 2025
Edited by
Lin Zhang, Hubei University of Chinese Medicine, China
Reviewed by
Rosângela Barbosa, Fiocruz Pernambuco, Brazil
Julio Cesar Canales-Delgadillo, National Council of Science and Technology (CONACYT), Mexico
Updates
Copyright
© 2026 Alves, Machado, Silva, de Almeida, Dias, Silva and Alencar.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Jeronimo Alencar, jalencar@ioc.fiocruz.br; Sérgio Lisboa Machado, machadosl2011@gmail.com
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.