ORIGINAL RESEARCH article

Front. Microbiol., 06 October 2021

Sec. Microbe and Virus Interactions with Plants

Volume 12 - 2021 | https://doi.org/10.3389/fmicb.2021.664271

Endophytic Microbes Are Tools to Increase Tolerance in Jasione Plants Against Arsenic Stress

  • 1. Department of Biology, Geology, Physics, and Inorganic Chemistry, Universidad Rey Juan Carlos, Madrid, Spain

  • 2. Unidad de Bioinformática, Instituto de Salud Carlos III, Madrid, Spain

  • 3. Área de Electromagnetismo, Universidad Rey Juan Carlos, Madrid, Spain

  • 4. Department of Plant Biology, Rutgers University, New Brunswick, NJ, United States

Abstract

Seed microbiota is becoming an emergent area of research. Host plant microbial diversity is increasingly well described, yet relatively little is known about the stressors driving plant endomicrobiota at the metaorganism level. The present work examines the role of horizontal and vertical transmission of bacterial microbiota in response to abiotic stress generated by arsenic. Horizontal transmission is achieved by bioaugmentation with the endophyte Rhodococcus rhodochrous, while vertical transmission comes via maternal inheritance from seeds. To achieve this goal, all experiments were conducted with two Jasione species. J. montana is tolerant to arsenic (As), whereas J. sessiliflora, being phylogenetically close to J. montana, was not previously described as As tolerant. The Jasione core bacterial endophytes are composed of genera Pseudomonas, Ralstonia, Undibacterium, Cutibacterium, and Kocuria and family Comamanadaceae across different environmental conditions. All these operational taxonomic units (OTUs) coexisted from seeds to the development of the seedling, independently of As stress, or bioaugmentation treatment and Jasione species. R. rhodochrous colonized efficiently both species, driving the endomicrobiota structure of Jasione with a stronger effect than As stress. Despite the fact that most of the OTUs identified inside Jasione seeds and seedlings belonged to rare microbiota, they represent a large bacterial reservoir offering important physiological and ecological traits to the host. Jasione traits co-regulated with R. rhodochrous, and the associated microbiota improved the host response to As stress. NGS-Illumina tools provided further knowledge about the ecological and functional roles of plant endophytes.

Introduction

Microorganisms with 3 billion years of evolution have acquired a wide range of metabolic activities, being able to colonize almost all ecological niches including plants and animals. Plant microbiomes can modify the genomic and metabolic functions of their hosts, improving functions and stress tolerance (). In this sense, plants are constituted by the genome of the plant and its associated microbiota, which establish an inter- and intracellular association (Thijs et al., 2016; ). Plants have a set of microorganisms necessary for their survival considered as core or obligate microbiota (; Vandenkoornhuyse et al., 2015; Trivedi et al., 2020), generally obtained by a vertical maternal route (Truyens et al., 2015; ; ). Another set of microorganisms is considered accessory or facultative, providing mutualistic or antagonistic interactions to the plant under certain environmental conditions, generally obtained by horizontal transmission (; ). Among microbiota associated with host plants, endophytes are “all living organisms inside plant tissues” (), but since its origin, this term has evolved over time to become more complex. Some authors have considered this term to refer to the location of the microorganisms (Schulz and Boyle, 2005; ), but others have included the nature of the interaction with the plant (; Wennstrom, 1994; Verma and White, 2019). The lack of consensus on this term may lead to controversy.

The same plant species may recruit different endophyte assemblages depending on the environment. The soil reservoir of endophytes will offer a wide range of physiological functions to the host plant providing growth promotion (), more protection against pathogens () and herbivory (Verma et al., 2017), and a better adaptation to environmental conditions and abiotic stress ().

Arsenic is considered one of the major stresses to plants () and is a highly toxic metalloid from anthropogenic and natural sources. Plant exposure to As, even at low concentrations, could trigger negative consequences in morphology, physiology, and biochemistry (; ). However, some plants are able to complete their life cycles in environments highly contaminated with As (; ; ).

Many studies examine host plant microbial diversity, but studies on the mechanisms of how stressors drive plant endomicrobiota at the metaorganism level are lacking. We hypothesized that endophytes play an important role on host traits against environmental stress. To test this hypothesis, the present work addresses the role of horizontal and vertical transmission of bacteria in two species of Jasione against As stress. The choice of this host plant was inclined toward Jasione montana L. because it is tolerant to arsenic (; ) and Jasione sessiliflora Boiss. & Reut., which is phylogenetically close (sister group) to J. montana () and has not been previously described as As tolerant. For bioaugmentation experiments, we used Rhodococcus rhodochrous, an As-resistant and plant growth-promoting bacteria endophyte from J. montana collected from highly As-contaminated soils ().

Materials and Methods

Jasione montana and Jasione sessiliflora

Seeds of J. montana were collected by Pauthier and Lang, 2010 in Saint-Georges (France). The area was located on a road edge in acid rocky ground at 787 m altitude in the Garabit viaduct (N 44° 58′ 21.9″, E 3° 10′ 27.8″). Seeds of J. sessiliflora were collected by Pauthier, 1996 in siliceous soils at 650 m altitude in Villefort, Lozère (N 44° 29′ 7″, E 3° 55’25″). Seeds from both species were given to us by the germplasm bank of the French National Museum of Natural History. Seeds were stored in airtight containers at low temperatures (−18°C) after desiccation in desiccation chambers (15% relative humidity).

Bacteria for Bioaugmentation

Rhodococcus rhodochrous (Nocardiaceae) is an endophyte isolated from an adult plant of J. montana collected in a highly polluted area in the Mónica mine, Bustarviejo (19 × 103 mg kg–1). R. rhodococcus has been previously identified () and shows resistance up to 450 mM of arsenate a, produces indole acetic acid (IAA), and inhibits 40% of the growth of Alternaria sp., which is a potential pathogenic ascomycete fungus (Soares et al., 2016) also isolated from Jasione seeds (). Due to these characteristics, this bacterium has been used for the study the horizontal transmission of bacteria.

Experimental Design

The Role of Endomicrobiota for Plant Development

Seeds were subjected to two procedures (Figure 1). Sterilization (S) and No sterilization (no S). For No S, seeds were washed to remove only bacterial and fungal epiphytes with 2% (v/v) sodium hypochlorite during 5 min with slow rotation and rinsed three times with milliQ water (). For the S procedure, seeds were washed with streptomycin sulfate (100 μg/ml, Sigma-Aldrich, MO, United States) during 24 h in continuous agitation () to obtain a gnotobiotic organism.

FIGURE 1

Each treatment for each plant was replicated eight times; each replicate consisted of 25–30 seeds per Petri dish in a basal germination medium (0.7% agarose, Sigma-Aldrich). Dishes were incubated in a cultivation chamber (Selecta HOTCOLD-GL, Refrigerated Precision Cabinet) for 30 days at 24°C and 12-h photoperiod cycles with continuous illumination. Dishes were periodically changed to eliminate any fungal contamination. Germination was indicated when seeds showed hypocotyl and/or radicle. Complete development of healthy seedlings was indicated when seedlings had, at least, hypocotyl, main root or radicle, and cotyledons.

The Role of Vertical and Horizontal Transmission of Microbiota in Response to as Stress

After 30 days of incubation, we applied four treatments to each of the seeds from C treatment (Figure 1). As treatment (addition of 125μM As[V]; As), bioaugmentation treatment (addition of R. rhodochrous; BA), combination treatment (As + BAs), and control treatment (no As + no BA). All experiments were carried out under sterile conditions avoiding any contamination by bacteria except for the controlled colonization by R. rhodochrous. All seedlings were planted in autoclaved individual tubes with Murashige & Skoog nutrient medium (Sigma Aldrich). Tubes were cultivated in the same cultivation chamber to have the same temperature and light conditions during germination experiments. We rotated tubes every 2 to 3 days to avoid position effects during the 45 days of incubation. There were a total of 25 seedling per treatment (Figure 1).

The number of leaves and roots and the length of stem and main root were analyzed with the software ImageJ1. The main root was measured from the first lateral branch to the root cap. The shoot was measured from the first branch of the root to the apical shoot tip. A plant was considered dead when, visibly, it did not have photosynthetic pigments.

Identification of Endophytic Bacteria From Seeds and Seedlings of J. montana and J. sessiliflora

Seeds (50 seeds from each plant species) and seedlings (four from each plant species) were washed with hypochlorite 2% (v/v) to remove epiphytic microorganisms as we mentioned above. We used DNEASY Plant Kit (Qiagen, Hilden, Germany), and for the seeds, we used DNA Isolation Kit (MO BIO Technologies, CA, United States). Quant-IT PicoGreen reagent (Thermo Fisher Scientific, MA, United States) was used to measure the DNA concentration of each sample. DNA samples were used to amplify the V5–V6 region of the 16S rRNA gene using the protocol in . Also, blocking primers were used in order not to amplify DNA from mitochondria and chloroplast (). PCR products had a length of approximately 421 bp. PCR products with the extension tails (PE1-CS1 and PE2-BC-CS2) allowed the addition of 10 nucleotide barcodes and a specific Illumina sequence in the second low-cycle number PCR, using a Fluidigm protocol:

  • V5-F: ACACTGACGACATGGTTCTACAGGATTAGATA CCCTGGTA

  • V6-R: TACGGTAGCAGAGACTTGGTCTCGACRRCCAT GCANCACCT

  • PE1-CS1: 5′-AATGATACGGCGACCACCGAGATCTACA CTGACGACATGGTTCTACA-3′

  • PE2-BC-CS2: 5′-CAAGCAGAAGACGGCATACGAGAT-[10 nucleotides barcode]-TACGGTAGCAGAGACTT GGTCT-3′.

DNA samples were sequenced with Illumina MiSeq (2 × 301). Pass filter reads were prepared using standard procedures (MiSeq Real Time Analysis, Illumina). Sequences were de-noised, merged, and clustered into operational taxonomic units (OTUs) using DADA2 () in Qiime 2 version 2020.6 (). OTUs were aligned and classified with a Qiime2 q2-feature-classifier with a pre-trained Naïve Bayes classifier on the Silva 99% OTUs full-length sequences (version 138)2. The number of sequences per sample was rarefied to ensure even sampling (Suplementary Figure 1). Taxonomic assignments were made by comparison with their homolog in GenBank using BLAST ().

Diversity indices were then calculated on relative abundance OTU tables. Seeds and plant taxonomic richness were expressed as the number of OTUs. The diversity was measured by Simpson’s diversity index (1-Ds), while evenness was measured by Pielou’s evenness index (J′).

Statistical Analysis

All data were analyzed with R v.3.6.0 (). We compared germination and plant development among treatments by generalized linear mixed models (GLMMs), including species and treatment as a fixed factor and dish and seed as random factors. Random factors were not significant; therefore, we analyzed germination, plant development, and number of leaves and roots with generalized linear models (GLMs). Data presented heteroscedasticity; therefore, GLMs were estimated with a Poisson distribution for germination, plant development, and number of leaves and roots, but the length of stem and main root was estimated with Gaussian distribution. The best model selection was based on the Akaike’s information criterion (AIC) corrected for small sample size (AICc). Akaike weights () were calculated for the final model, including all significant variables, and then for models in which the variables were sequentially excluded.

The similarity among whole samples was estimated with the index similarity coefficient using the Bray–Curtis distance with the function vegdist in the R package Vegan (). The dendrogram was generated using the unweighted pair group with arithmetic means (UPGMA) using the function hclust of the stats package in R (version 1.2.5033). The overlapping areas of the Venn diagrams are used to represent shared OTUs between all treatments (BA, no BA, As, and no As) and species (J. montana and J. sessiliflora).

Results

The Role of Jasione Endomicrobiota in Modulating Plant Development

Jasione montana (Figure 2A and Table 1) had a significant higher percentage of germination (80.1% ± 2.5%) and healthy plant development (44.7% ± 9.4%) than J. sessiliflora (60.9% ± 2.3% and 34.7% ± 8.0%, respectively). The role of Jasione endomicrobiota was found to be important for plant development with significantly higher scores (Figure 2B and Table 1) observed in the holobiotic (plant with bacteria endomicrobiota; 71.4% ± 3.0%) than in the gnotobiotic model (6.2% ± 1.5%).

FIGURE 2

TABLE 1

FactorModeldfAICΔ AIC
GerminationNull11015.7535.45
Sp2980.310.00
Sterilization21016.9536.65
Sp + Sterlization3981.270.96
Sp:Sterilization4983.252.94

FactorModeldfAICΔ AIC

Healthy plantNull11115.26428.39
Sp21107.10420.23
Sterilization2707.1720.30
Sp + Sterlization3686.870.00
Sp:Sterilization4688.872.00
Sp*Sterilization4688.872.00

Generalized linear model analyses to test the effect of species (spp.; J. montana and J. sessiliflora) and sterilization treatment (no S = holobiotic vs. S = gnotobiotic) and interactions of both (sp and sterilization) on the germination and plant development of healthy plants.

Null effect as an alternative hypothesis, using the Akaike Information Criterion (AIC). The bold type indicates the best models selected.

*Test the pure effects of the two factors and the interaction.

+Test only the pure effects of the two factors.

:Test only the interaction of the two factors.

TABLE 2

FactorModeldfAICΔ AIC
Number of leavesNull1553.87272.82
Sp: As + Sp: BA6481.050
Sp*As + Sp * BA6481.050

FactorModeldfAICΔ AIC

Number of rootsNull1263.4913.12
Sp * BA4251.711.34
BA: Sp + BA: As6250.360
BA* Sp + BA*As8250.360

Generalized linear model analyses to test the effect of species (J. montana and J. sessiliflora), As, and BA (R. rhodochrous) on the number of plant leaves and lateral roots.

Null effect as an alternative hypothesis, using the Akaike Information Criterion (AIC) and difference in AIC score between the best model and the model being compared (ΔAIC). The bold type indicates the best models selected. It shows null model and best model selected.

*Test the pure effects of the two factors and the interaction.

+Test only the pure effects of the two factors.

:Test only the interaction of the two factors.

Effects of Arsenic and BA on Jasione Develpment

After 45 days of incubation, the treatment BA (addition of R. rhodochrous) did not show any effect on the number of leaves in J. sessiliflora (7.6 ± 1.2 and 6.5 ± 1.4 leaves without BA and with BA, respectively) whereas it had a positive effect (4.6 ± 1.0 and 8.4 ± 0.8 leaves without BA and with BA, respectively) in J. montana (Figure 3A and Table 2). The opposite pattern was observed on the number of lateral roots (LR). The addition of R. rhodochrous (treatment BA) did not show any effect in J. montana (1.2 ± 0.5 and 1.6 ± 0.4 LR without BA and with BA, respectively) whereas J. sessiliflora (0.9 ± 0.3 and 0.3 ± 0.2 LR without BA and with BA, respectively) showed a significantly reduced number of leaves (Figure 3B and Table 2). Accordingly, As did not show any significant effect on the number of leaves (7.1 ± 1.0 and 6.6 ± 0.9 leaves without As and with As, respectively) of J. montana (Figure 4 and Table 2) whereas J. sessiliflora showed a significantly reduced number of leaves under As stress (9.3 ± 1.2 and 3.1 ± 0.6 leaves without As and with As, respectively). However, the interaction of As and BA treatments was significant (Table 2). The addition of R. rhodochrous (BA treatment) increased the number of LR under As stress (0.7 ± 0.3 and 1.6 ± 0.6 LR without BA and with BA, respectively) whereas it did not show any effect (1.1 ± 0.3 and 0.7 ± 0.2 LR without BA and with BA, respectively) under conditions without stress (Figure 5 and Table 2). The lengths of the roots and shoots were not significantly changed in any treatment.

FIGURE 3

FIGURE 4

FIGURE 5

Molecular Identification and Characterization of Jasione Endomicrobiota

Rhodococcus rhodochrous was the dominant OTU when it was inoculated and was present in all adult plants under BA treatments (Figures 6, 7). Cluster dendrogram analysis (UPGMA) based on the relative abundance of all OTUs revealed three major distinct clusters (Figure 6): (1) seeds group, (2) BA group, and (3) NoBA group. Among OTUs identified through high-throughput sequencing, the most common OTUs observed inside Jasione samples were genera Pseudomonas spp., Ralstonia spp., Undibacterium spp., Cutibacterium spp., Kocuria spp., and Comamonadaceae family (Figure 7A). Even though Jasione plants were grown under sterile conditions to avoid contamination, the number of OTUs within seeds was lower than those present in adult plants (Table 3). OTUs exclusively associated with plants growing under As stress were genus Brevundimonas spp. and family Oxalobacteraceae; shared with BA treatments were genera Nocardioides spp. and Sphingomonas spp.; and shared with NoBA were genera Methylobacterium spp., Enhydrobacter spp., Staphylococcus spp., and Stenotrophomonas spp. (Figure 7A). OTUs exclusively associated with plants in the BA treatment included species R. rhodochrous (which was inoculated), Massilia spp., and Asinibacterium spp. OTUs exclusively present in the NoBA treatment were families Lachnospiraceae, Erwiniaceae, and Micrococcaceae and genera Bacillus spp., Lawsonella spp., Chryseobacterium spp., Paenibacillus spp., and Rickettsiella grylli. No OTUs were exclusively in No As treatment (Figure 7A). The OTU exclusively associated with J. montana was Rhodococcus spp. and those associated with J. sessiliflora were the families Hymenobacteraceae and Caulobacteraceae (Figure 7B). A dynamic rank-abundance distribution curve for the endomicrobiota of Jasione is shown in Figure 7C. A small number of OTUs were dominant, while most of the OTUs were considered rare because of their low abundances.

FIGURE 6

FIGURE 7

TABLE 3

OTUSSimpson index of diversity (Ds)Pielou’s evenness index (J′)
J. montana
J. sessiliflora
66 ± 5
72 ± 8
F1,6 = 0.45;
p = 0.52
0.77 ± 0.09
0.76 ± 0.10
F1,6 = 0.005;
p = 0.9
0.53 ± 0.15
0.44 ± 0.09
F1,6 = 0.29;
p = 0.60

As
No As
73 ± 2
65 ± 9
F1,6 = 0.84;
p = 0.34
0.74 ± 0.10
0.79 ± 0.09
F1,6 = 0.09;
p = 0.77
0.40 ± 0.10
0.57 ± 0.13
F1,6 = 1.07;
p = 0.33

BA
No BA
62 ± 7
76 ± 4
F1,6 = 3.09;
p = 0.12
0.73 ± 0.09
0.80 ± 0.10
F1,6 = 0.28;
p = 0.61
0.39 ± 0.06
0.58 ± 0.15
F1,6 = 1.5;
p = 0.26

Seeds23 ± 60.54 ± 0.270.34 ± 0.17

Average (± SE) and ANOVA for the effects of species of Jasione, As, and BA treatment on total number of OTUs (S), Simpson index of diversity (Ds), and Pielou’s evenness index (J′).

Discussion

The study of seed endomicrobiota is an emergent area of research (; Verma and White, 2019; ; Xu et al., 2021). Diversity of seed endomicrobiota is highly underestimated since most studies have used culturable techniques and not culture-independent approaches (). Very little is known regarding how the seed endobiota modulates plant development.

The Role of Endomicrobiota in Jasione Development

Jasione seeds contained an average of 23 ± 6 OTUs. During Jasione seed imbibition and germination, seed endomicrobiota become activated (including germinating endospores) to create part of the spermosphere and play a role in development of the seedling and the adult plant (; ). OTUs found in adult plants (70 ± 6) likely came from seeds (). Seeds are in a dormant state, and it is probable that bacteria in seeds are also in a state of dormancy (Truyens et al., 2015). Since seed endomicrobiota are exposed to high osmotic pressures within seeds, endospore formation may be a feature to withstand this environment (; Truyens et al., 2015). However, standard DNA purification procedures are not suitable to disrupt endospores. Some authors (e.g., ) have proposed, as an alternative approach, a microwave treatment before the standard method to extract DNA from endospore and resistant structures. The lower number of OTUs identified inside the seeds is probably due to the presence of endospores where DNA was not extracted and amplified. Our findings suggest that combined OTU identifications from sterilized seeds and plants developed under axenic conditions show a more complete seed endomicrobiota diversity.

When endomicrobiota were removed from seeds with antibiotics, the gnotobiotic plants show a lower percentage of germination and plant development than holobiotic plants (plants with endomicrobiota associated). Previous studies have suggested that antibiotic treatment might cause irreparable damage to seed organelles, such as mitochondria (). However, the addition of endophytes to gnotobiotic organisms frequently improves seedling growth and plant development (; Verma and White, 2017; Verma et al., 2017; ), suggesting that organelles are not damaged with the sterilization treatment. We agree with previous conclusions (Truyens et al., 2015; ; Verma and White, 2017; Verma et al., 2017; ) that bacterial endomicrobiota of seeds are essential to seed germination and plant development.

Core Bacterial Endophytes of Jasione

Most studies of plant microbiota are focused on the rhizosphere microbiome (Thijs et al., 2016; ) because it is a reservoir of potential microorganisms with benefits for plants and therefore may be used as biofertilizers for sustainable agriculture. However, not all microorganisms from the rhizosphere are able to colonize efficiently into plant tissues; only 2–5% are considered plant growth-promoting bacteria (PGPB) (). Therefore, a better starting point to obtain plant microbes would be to focus on the study of the seed endomicrobiota (; ); this especially since they are selected generation to generation for the ability to enter the host plant (). Nevertheless, seeds have already shown to be a microbiota reservoir providing beneficial traits to the host plant (; ; ; Wang et al., 2021). Jasione persistent OTUs were genera Pseudomonas spp., Ralstonia spp., Undibacterium spp., Cutibacterium spp., and Kocuria spp. and family Comamonadaceae. These OTUs were inside all seedling plants of J. montana and J. sessiliflora and detected across all treatments. These OTUs have been previously identified as plant microbiota. Members of genus Pseudomonas have shown various PGP traits such as IAA and siderophore production and phosphate solubilization (). In addition, Pseudomonas spp. are common plant endophytes (; ; Wang et al., 2021), acting also as biocontrol agents () and members of the core microbiome of many plant species, including canola (Brassica napus) (). Recently, Pseudomonas has been found in rice plants with the ability to decrease arsenic translocation from roots into grains (; Wang et al., 2021), and in lettuce roots as rare microbiota that protect against plant pathogens (). Accordingly, other PGPB species, including Cutibacterium spp., identified in wheat (Triticum) seeds (; ); Undibacteriumin spp. identified in maize (Zea mays) (); and Kocuria spp. identified in alfalfa (Medicago sativa) (). Species of Comamonadaceae family were found to dominate barley (Hordeum vulgare) roots and rhizospheres (). Species of genus Ralstonia can also colonize plants as endophytes (van Overbeek et al., 2004) and can be a diazotrophic endophyte with a capacity to increase N availability to plants (Patel and Archana, 2017). Together with species of genus Pseudomonas, Ralstonia species are part of the core microbiota of some grapevines (). More recently, Ralstonia eutropha was found to alleviate As toxicity to wheat plants by increasing the efficiency of root energy metabolism and cell wall biosynthesis (Wang et al., 2018). Therefore, these OTUs can be considered as core bacterial endophytes since they are inside tissues of J. montana and J. sessiliflora and provide benefits to the host.

Rare Endomicrobiota of Seeds

The long tail of the rank abundance curve (Figure 7) represents the rare microbiota of Jasione. Most of the OTUs were below 1% of the contribution to total diversity. Only a few OTUs such as R. rhodochrous (inoculated), Sphingomonas spp., and Paenibacillus spp. represent more than 50% of the total microbiota. For instance, the members of the genera associated with BA treatment such as Asinibacterium and Nocardioides are considered rare since they only represent less than 1% of the total diversity of the Jasione seed endomicrobiota. However, species of genus Asinibacterium have shown tolerance to uranium () and species of genus Nocardioides have shown halotolerance and methylotrophic strains with the capacity to alleviate salinity stress of crop plants (). Species of genus Brevundimonas, associated with As treatment, only represented 0.4% but some strains showed versatility to degrade recalcitrant aromatic compounds (). Thus, most of the OTUs from Jasione seeds were rare microbiota. However, despite their low contribution, they represent a large bacterial reservoir with rapid responses to environmental changes (; ), playing important physiological and ecological roles in improving host traits (Sogin et al., 2006; ; ).

Biotic and Abiotic Factors Controlling Endomicrobiota Structure

The degree of similarity between seed endomicrobiota of J. montana and J. sessiliflora is high. Endomicrobiota structure is a consequence of ecological and evolutionary forces driving microbial diversity and structure (West et al., 2019; ). The plant microbiome is thought to be controlled by various processes such as selection and speciation (which are deterministic events), drift, and dispersal represented by stochastic events (Vellend, 2016). Both niche (deterministic processes) and neutral (stochastic processes) theories have been advanced to explain microbial community assembly (Zhou and Ning, 2017; Wilber et al., 2020). Previous works have shown (Wilber et al., 2020) that abiotic (i.e., As) and biotic (i.e., addition of R. rhodochrous) factors affect bacterial selection from the host microbial assemblage after accounting for the effects of dispersal and drift.

The high similarity between the seed endomicrobiota of both species and the fact that J. montana and J. sessiliflora are phylogenetically very close could be a starting point to investigate coevolution between these two organisms. Jasione microbial assemblage are modulated by abiotic (i.e., As) or biotic (i.e., addition of R. rhodochrous) factors with important consequences at a functional and genetic level. From a functional point of view, these closely related species (plant genome plus its associated microbiota) showed different responses against stresses. The negative consequences of the As stress were only observed within J. sessiliflora but not in J. montana. These results would suggest that only J. montana have physiological traits against As stress. The exclusive J. montana core bacterial endophyte was composed by genus Rhodococcus. Members of this genus (R. aetherivorans, R. erythropolis, R. equi, and R. rhodochrous) have also been described as PGPB or endophytes resistant to As (; ; ). From a functional point of view, R. rhodochrous has been shown to colonize efficiently Jasione species, modifying the response to As stress. According to Thijs et al. (2016), plant microbiota assembly under environmental stress depends on the recruitment of key species. The bioaugmentation with R. rhodochrous provides different physiological traits depending on the Jasione species. For instance, R. rhodochrous provided synergistic mechanisms to J. montana, increasing the number of leaves. The same endophyte was antagonistic to J. sessiliflora, decreasing the number of LR. It is interesting that under As stress, R. rhodochrous provided benefits to both species, increasing the number of LR over the control conditions under equivalent stress. Previous investigations have already shown that continuous exposure of plants to stress conditions decreases plant endogenous IAA levels. However, the inoculation with endophytes and rhizobacteria increases IAA synthesis (Sheng et al., 2008; ; ). Therefore, R. rhodochrous may affect Jasione traits in two ways as follows. R. rhodochrous is a PGPB that is resistant to As and produces IAA (). This phytohormone increases LR () but also alleviates ROS accumulation produced by As stress (). In addition, R. rhodochrous is capable of metabolizing As (V) to organic forms, possibly less toxic (), which is an obvious advantage for both species but especially for J. sessiliflora, which does not have this microorganism among the components of its microbiota. Therefore, R. rhodochrous may modulate Jasione root plasticity, which is a key adaptative trait to cope As stress (). Our results provide empirical evidence for the role of a key species (R. rhodochrous) transmitted horizontally, driving the structure and final functionality of host endomicrobiota against As stress. Our findings suggest the Jasione traits are influenced by R. rhodochrous and associated microbiota () and improve host response to As stress.

Conclusion

In this study, we have shown that Jasione traits are influenced by both R. rhodochrous and seed-associated endomicrobiota and improve host response against As stress. Our experimental evidence shows that R. rhodochrous efficiently colonizes Jasione plants, influencing the structure and final functionality of the endomicrobiota. Furthermore, in this study, next-generation sequencing technologies (NGS-Illumina) helped to identify Jasione core bacterial endophytes composed of genera Pseudomonas spp., Ralstonia spp., Undibacterium spp., Cutibacterium spp., and Kocuria spp. and family Comamanadaceae. This technology also provided empirical evidence of the rare endomicrobiota inside Jasione seeds. These rare members represent most of the total diversity, and despite their low contribution, they offer important physiological and ecological traits to host. Therefore, plant seed endomicrobiota or endophytes should be considered to be a resource for exploitation; they have potential applications and utility to environmental remediation, sustainable agriculture, and biotechnology.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/, SUB9031392. Sequence data were deposited in the NCBI Sequence REacd Archive, Bioproject ID PRJNA699582, accessions SAMN17799125 to SAMN17799134.

Author contributions

MM and NG-B: conceptualization and methodology. IM-R, IC, and MA: the expertise on the software. NG-B, IM-R, and MA: formal analysis. NG-B and IM-R: writing the original draft. JW: showing the techniques to manipulate and isolate endophytes. MM, MA, IC, and JW: review and editing. All authors contributed extensively to the work, and read and agreed to the published version of the manuscript.

Funding

This work has been supported by the Research grant from Universidad Rey Juan Carlos (AYUDA PUENTE 2019-DRIADES Project). IM-R gratefully acknowledges PEJD-2019-PRE/AMB-16306 from the Madrid Community program. Funding support was also provided by USDA-NIFA Multistate Project W4147 and the New Jersey Agricultural Experiment Station.

Acknowledgments

The authors would like to thank Aida Vaquero (URJC) during the experimental phase of the work and Marcos Méndez (URJC) for their support and assistance during the initial stages and development and Pauthier and Lang for providing the seeds from the collection of the French National Museum of Natural History.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2021.664271/full#supplementary-material

References

  • 1

    AbbasG.MurtazaB.BibiI.ShahidM.NiaziN. K.KhanM. I.et al (2018). Arsenic uptake, toxicity, detoxification, and speciation in plants: physiological, biochemical, and molecular aspects.Int. J. Environ. Res. Public Health1559104. 10.3390/ijerph15010059

  • 2

    AbdullaevaY.ManirajanB. A.HonermeierB.SchnellS.CardinaleM. (2020). Domestication affects the composition, diversity, and co-occurrence of the cereal seed microbiota.J. Adv. Res.31, 7586. 10.1016/j.jare.2020.12.008

  • 3

    AltschulS. F.MaddenT. L.SchäfferA. A.ZhangJ.ZhangZ.MillerW.et al (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Res.2533893402. 10.1093/nar/25.17.3389

  • 4

    AntounH.KloepperJ. W. (2001). “Plant growth promoting rhizobacteria,” in Encyclopedia of Genetics, 2nd Edn. edsBrennerS.MillerJ. H. (Amsterdam: Elsevier), 14771480.

  • 5

    ArenzB. E.SchlatterD. C.BradeenJ. M.KinkelL. L. (2015). Blocking primers reduce co-amplification of plant DNA when studying bacterial endophyte communities.J. Microbiol. Methods11713. 10.1016/j.mimet.2015.07.003

  • 6

    BarretM.BriandM.BonneauS.PréveauxA.ValièreS.BouchezO.et al (2015). Emergence shapes the structure of the seed microbiota.Appl. Environ. Microbiol.8112571266. 10.1128/AEM.03722-14

  • 7

    BoylenE.RideoutJ. R.DillonM. R.BokulichM. R.AbnetC. C.CaporasoJ. G. (2019). Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2.Nat. Biotechnol.37852857. 10.1038/s41587-019-0209-9

  • 8

    BrzoskaR. M.HuntemannM.ClumA.ChenA.KyrpidesN.PalaniappanK.et al (2019). Complete genome sequence for Asinibacterium sp. Strain OR53 and draft genome sequence for Asinibacterium sp. Strain OR43, two bacteria tolerant to uranium.Microbiol. Resour. Announc.8:e01701-18. 10.1128/MRA.01701-18

  • 9

    BulgarelliD.Garrido-OterR.MunchP. C.WeimanA.DrogeJ.PanY.et al (2015). Structure and function of the bacterial root microbiota in wild and domesticated barley. Cell Host Microbe.17, 392403. 10.1016/j.chom.2015.01.011

  • 10

    BurnhamK.AndersonD. (2002). Model Selection and Multimodel Inference:A Practical Information-Theoretic Approach, 2nd Edn.New York, NY: Springer.

  • 11

    CalabreseE. J.AgathokleousE. (2021). Accumulator plants and hormesis.Environ. Pollut.274:116526. 10.1016/j.envpol.2021.116526

  • 12

    CallahanB. J.McMurdieP. J.RosenM. J.HanA. W.JohnsonA. J. A.HolmesS. P. (2016). DADA2: high-resolution sample inference from Illumina amplicon data.Nat. Methods13581583.

  • 13

    CardinaleM.GrubeM.ErlacherA.QuehenbergerJ.BergG. (2015). Bacterial networks and co-occurrence relationships in the lettuce root microbiota.Environ. Microbiol.17239252. 10.1111/1462-2920.12686

  • 14

    ChangX.KingsleyK. L.WhiteJ. F. (2021). Chemical interactions at the interface of plant root hair cells and intracellular bacteria.Microorganisms9:1041. 10.3390/microorganisms9051041

  • 15

    ClayK. (1998). Fungal endophytes of grasses: a defensive mutualism between plants and fungi.Ecology691016.

  • 16

    CompantS.CambonM. C.VacherC.MitterB.SamadA.SessitschA. (2021). The plant endosphere world–bacterial life within plants.Environ. Microbiol.2318121829. 10.1111/1462-2920.15240

  • 17

    CompantS.MitterB.Colli-MullJ. G.GanglH.SessitschA. (2011). Endophytes of grapevine flowers, berries, and seeds: identification of cultivable bacteria, comparison with other plant parts, and visualization of niches of colonization.Microb. Ecol.62188197. 10.1007/s00248-011-9883-y

  • 18

    CordovezV.Dini-AndreoteF.CarriónV. J.RaaijmakersJ. M. (2019). Ecology and evolution of plant microbiomes.Annu. Rev. Microbiol.736988.

  • 19

    De BarryA. (1866). Morphologie und Physiologie der Pilze, Flechten, und Myxomyceten. Hofmeister’s Hand- Book of Physiological Botany, Vol. II.Leipzig: W. Engelmann.

  • 20

    DolphenR.ThiravetyanP. (2019). Reducing arsenic in rice grains by leonardite and arsenic–resistant endophytic bacteria.Chemosphere223448454. 10.1016/j.chemosphere.2019.02.054

  • 21

    DuS.Dini-AndreoteF.ZhangN.LiangC.YaoZ.ZhangH.et al (2020). Divergent co-occurrence patterns and assembly processes structure the abundant and rare bacterial communities in a salt marsh ecosystem.Appl. Environ. Microbiol.86:e00322-20. 10.1128/AEM.00322-20

  • 22

    ElshahedM. S.YoussefN. H.SpainA. M.SheikC.NajarF. Z.KrumholzL. R. (2008). Novelty and uniqueness patterns of rare members of the soil biosphere.Appl. Environ. Microbiol.7454225428. 10.1128/AEM.00410-08

  • 23

    EstebanM.MarcosP.HornaC.Galan-MaloP.MataL.SánchezL. (2020). Evaluation of methods for DNA extraction from Clostridium tyrobutyricum spores and its detection by qPCR.J. Microbiol. Methods169:105818. 10.1016/j.mimet.2019.105818

  • 24

    EwaldP. W. (1987). Transmission modes and evolution of the parasitism-mutualism continuum.Ann. N. Y. Acad. Sci.503295306. 10.1111/j.1749-6632.1987.tb40616.x

  • 25

    Franco-FranklinV.Moreno-RiascosS.Ghneim-HerreraT. (2021). Are endophytic bacteria an option for increasing heavy metal tolerance of plants? A meta-analysis of the effect size.Front. Environ. Sci.8:603668. 10.3389/fenvs.2020.603668

  • 26

    García-SalgadoS.García-CasillasD.Quijano-NietoM.Bonilla-SimónM. (2011). Arsenic and heavy metal uptake and accumulation in native plant species from soils polluted by mining activities.Water Air Soil Pollut.223559572. 10.1007/s11270-011-0882-x

  • 27

    GuY.WangY.SunY.ZhaoK.XiangQ.ChenQ. (2018). Genetic diversity and characterization of arsenic-resistant endophytic bacteria isolated from Pteris vittata, an arsenic hyperaccumulator.BMC Microbiol.18:42. 10.1186/s12866-018-1184-x

  • 28

    GuterresJ.RossatoL.DoleyD.PudmenzkyA.BeeC.CobenaV. (2019). Assessing germination characteristics of Australian native plant species in metal/metalloid solution. J. Hazard. Mater.364, 173181. 10.1016/j.jhazmat.2018.10.019

  • 29

    Gutiérrez-GinésM. J.PastorJ.HernándezA. J. (2015). “Heavy metals in native mediterranean grassland species growing at abandoned mine sites: ecotoxicological assessment and phytoremediation of polluted soils,” in Heavy Metal Contamination of Soils, edsSherametiI.VarmaA. (Cham: Springer), 159178.

  • 30

    HardoimP. (2019). “The ecology of seed microbiota,” in Seed Endophytes, edsVermaS.WhiteJ. (Cham: Springer), 103125.

  • 31

    HardoimP. R.van OverbeekL. S.BergG.PirttiläA. M.CompanyS.SessitschA. (2015). The Hidden World within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes.Microbiol. Mol. Biol. Rev.79293320. 10.1128/MMBR.00050-14

  • 32

    HardoimP. R.van OverbeekL. S.van ElsasJ. D. (2008). Properties of bacterial endophytes and their proposed role in plant growth.Trends Microbiol.16463471. 10.1016/j.tim.2008.07.008

  • 33

    HerreraS. D.GrossiC.ZawoznikM.GroppaM. D. (2016). Wheat seeds harbour bacterial endophytes with potential as plant growth promoters and biocontrol agents of Fusarium graminearum.Microbiol. Res.186–1873743. 10.1016/j.micres.2016.03.002

  • 34

    JiM.KongW.StegenJ.YueL.WangF.FerrariB. C. (2020). Distinct assembly mechanisms underlie similar biogeographical patterns of rare and abundant bacteria in Tibetan Plateau grassland soils.Environ. Microbiol.2222612272. 10.1111/1462-2920.14993

  • 35

    KhaksarG.TreesubsuntornC.ThiravetyanP. (2017). Euphorbia milii-native bacteria interactions under airborne formaldehyde stress: effect of epiphyte and endophyte inoculation in relation to IAA, ethylene and ROS levels.Plant Physiol. Biochem.111284294. 10.1016/j.plaphy.2016.12.011

  • 36

    KlaedtkeS.JacquesM. A.RaggiL.PréveauxA.BonneauS.BarretM. (2016). Terroir is a key driver of seed-associated microbial assemblages.Environ. Microbiol.1817921804. 10.1111/1462-2920.12977

  • 37

    KumarA.VermaJ. P. (2018). Does plant—microbe interaction confer stress tolerance in plants: a review?Microbiol. Res.2074152. 10.1016/j.micres.2017.11.004

  • 38

    KumarA.VoropaevaO.MalevaM.PanikovskayaK.BorisovaG.BrunoL. B. (2020). Bioaugmentation with copper tolerant endophyte Pseudomonas lurida strain EOO26 for improved plant growth and copper phytoremediation by Helianthus annuus.Chemosphere266:128983. 10.1016/j.chemosphere.2020.128983

  • 39

    KuźniarA.WłodarczykK.Grza̧dzielJ.WoźniakM.FurtakK.WolińskaA. (2020). New insight into the composition of wheat seed microbiota.Int. J. Mol. Sci.21:4634. 10.3390/ijms21134634

  • 40

    LavenusJ.GohT.RobertsI.Guyomarc’hS.LucasM.LaplazeL. (2013). Lateral root development in Arabidopsis: fifty shades of auxin.Trends Plant Sci.18450458. 10.1016/j.tplants.2013.04.006

  • 41

    LiuY.ZuoS.ZouY.WangJ.SongW. (2013). Investigation on diversity and population succession dynamics of endophytic bacteria from seeds of maize (Zea mays L., Nongda108) at different growth stages.Ann. Microbiol.637179. 10.1007/s13213-012-0446-3

  • 42

    LópezJ. L.AlvarezF.PríncipeA.SalasM. E.LozanoM. J.LagaresA. (2018). Isolation, taxonomic analysis, and phenotypic characterization of bacterial endophytes present in alfalfa (Medicago sativa) seeds.J. Biotechnol.2675562. 10.1016/j.jbiotec.2017.12.020

  • 43

    LynchM. D.NeufeldJ. D. (2015). Ecology and exploration of the rare biosphere.Nat. Rev. Microbiol.13217229. 10.1038/nrmicro3400

  • 44

    MatsumotoH.FanX.WangY.KusstatscherP.DuanJ.WangM. (2021). Bacterial seed endophyte shapes disease resistance in rice.Nat. Plants76072. 10.1038/s41477-020-00826-5

  • 45

    MeenaK. K.BitlaU. M.SortyA. M.SinghD. P.GuptaV. K.KumarS. (2020). Mitigation of salinity stress in wheat seedlings due to the application of phytohormone-rich culture filtrate extract of methylotrophic actinobacterium Nocardioides sp. NIMMe6.Front. Microbiol.11:2091. 10.3389/fmicb.2020.02091

  • 46

    MohanramS.KumarP. (2019). Rhizosphere microbiome: revisiting the synergy of plant-microbe interactions.Ann. Microbiol.69307320. 10.1007/s13213-019-01448-9

  • 47

    MolinaM. D. C.WhiteJ. F.García-SalgadoS.QuijanoM.González-BenítezN. (2021). A gnotobiotic model to examine plant and microbiome contributions to survival under arsenic stress.Microorganisms9:45. 10.3390/microorganisms9010045

  • 48

    MoreiraM. Z.HelgasonB.GermidaJ. (2021). Environment has a stronger effect than host plant genotype in shaping spring Brassica napus seed microbiomes.Phytobiomes J.111. 10.1094/PBIOMES-08-20-0059-R

  • 49

    Moreno-JiménezE.PeñalosaJ. M.Carpena-RuizR. O.EstebanE. (2008). Comparison of arsenic resistance in Mediterranean woody shrubs used in restoration activities.Chemosphere71466473. 10.1016/j.chemosphere.2007.10.030

  • 50

    MunakataY.GaviraC.GenestierJ.BourgaudF.HehnA.Slezack-DeschaumesS. (2020). Composition and functional comparison of vetiver root endophytic microbiota originating from different geographic locations that show antagonistic activity towards Fusarium graminearum.Microbiol. Res.243:126650. 10.1016/j.micres.2020.126650

  • 51

    NavazasA.ThijsS.FeitoI.VangronsveldJ.PeláezA. I.GonzálezA. (2021). Arsenate-reducing bacteria affect as accumulation and tolerance in Salix atrocinerea.Sci. Total Environ.769:144648. 10.1016/j.scitotenv.2020.144648

  • 52

    NelsonE. B. (2018). The seed microbiome: origins, interactions, and impacts.Plant Soil422734. 10.1007/s11104-017-3289-7

  • 53

    OksanenJ. (2016). Design Decisions and Implementation Details in Vegan, in Vignette of the Package Vegan. R Package Version, Vol. 201624.

  • 54

    ÖzkurtE.HassaniM. A.SesizU.KünzelS.DaganT.ÖzkanH.et al (2020). Seed-derived microbial colonization of wild emmer and domesticated bread wheat (Triticum dicoccoides and T. aestivum) seedlings shows pronounced differences in overall diversity and composition.mBio11:e02637-20. 10.1128/mBio.02637-20

  • 55

    PacificoD.SquartiniA.CrucittiD.BarizzaE.Lo SchiavoF.MuresuR.et al (2019). The role of the endophytic microbiome in the grapevine response to environmental triggers.Front. Plant Sci.10:1256. 10.3389/fpls.2019.01256

  • 56

    ParthasarathyS.AzamS.Lakshman SagarA.Narasimha RaoV.SiddavattamD. (2017). Genome-guided insights reveal organophosphate-degrading Brevundimonas diminuta as Sphingopyxis wildii and define its versatile metabolic capabilities and environmental adaptations.Genome Biol. Evol.97781. 10.1093/gbe/evw275

  • 57

    PatelJ. K.ArchanaG. (2017). Diverse culturable diazotrophic endophytic bacteria from Poaceae plants show cross-colonization and plant growth promotion in wheat.Plant Soil41799116. 10.1007/s11104-017-3244-7

  • 58

    Pérez-EsponaS.SalesF.HedgeI. C.MollerM. (2005). Phylogeny and species relationships in Jasiones (Campanulaceae) with emphasis on the ‘montana-complex’.Edinb. J. Bot.622951. 10.1017/S0960428606000047

  • 59

    PerottiR. (1926). On the limits of biological inquiry on soil science.Proc. Int. Soc. Soil Sci.2146161.

  • 60

    R Core Team (2019). R: A Language and Environment for Statistical Computing.Vienna: R Foundation for Statistical Computing.

  • 61

    RajkumarM.AeN.FreitasH. (2009). Endophytic bacteria and their potential to enhance heavy metal phytoextraction.Chemosphere77153160. 10.1016/j.chemosphere.2009.06.047

  • 62

    RavanbakhshM.KowalchukG. A.JoussetA. (2019). Root-associated microorganisms reprogram plant life history along the growth–stress resistance trade-off.ISME J.1330933101. 10.1038/s41396-019-0501-1

  • 63

    RobertF.HevorT. K. (2007). Abnormal organelles in cultured astrocytes are largely enhanced by streptomycin and intensively by gentamicin.Neuroscience144191197. 10.1016/j.neuroscience.2006.08.059

  • 64

    RodríguezR. J.HensonJ.van VolkenburghE.HoyM.WrightL.RedmanR. S. (2008). Stress tolerance in plants via habitat-adapted symbiosis.ISME J.2404416. 10.1038/ismej.2007.106

  • 65

    RudgersJ. A.AfkhamiM. E.RúaM. A.DavittA. J.HammerS.HuguetV. M. (2009). A fungus among us: broad patterns of endophyte distribution in the grasses.Ecology9015311539. 10.1890/08-0116.1

  • 66

    SchulzB.BoyleC. (2005). The endophytic continuum.Mycol. Res.109661686. 10.1017/S095375620500273

  • 67

    ShengX. F.XiaJ. J.JiangC. Y.HeL. Y.QianM. (2008). Characterization of heavy metal-resistant endophytic bacteria from rape (Brassica napus) roots and their potential in promoting the growth and lead accumulation of rape.Environ. Pollut.15611641170. 10.1016/j.envpol.2008.04.007

  • 68

    SoaresM. A.LiH. Y.BergenM.da SilvaJ. M.KowalskiK. P.WhiteJ. F. (2016). Functional role of an endophytic Bacillus amyloliquefaciens in enhancing growth and disease protection of invasive English ivy (Hedera helix L.).Plant Soil405107123. 10.1007/s11104-015-2638-7

  • 69

    SoginM. L.MorrisonH. G.HuberJ. A. (2006). Microbial diversity in the deep sea and the underexplored “rare biosphere.”.Proc. Natl. Acad. Sci. U.S.A.1031211512120. 10.1073/pnas.0605127103

  • 70

    ThijsS.SillenW.RineauF.WeyensN.VangronsveldJ. (2016). Towards an enhanced understanding of plant–microbiome interactions to improve phytoremediation: engineering the metaorganism.Front. Microbiol.7:341. 10.3389/fmicb.2016.00341

  • 71

    TrivediP.LeachJ. E.TringeS. G.SaT.SinghB. K. (2020). Plant–microbiome interactions: from community assembly to plant health.Nat. Rev. Microbiol.18607621. 10.1038/s41579-020-0412-1

  • 72

    TruyensS.WeyensN.CuypersA.VangronsveldJ. (2015). Bacterial seed endophytes: genera, vertical transmission, and interaction with plants.Environ. Microbiol. Rep.74050.

  • 73

    van OverbeekL. S.BergervoetJ. H. W.JacobsF. H. H.van ElsasJ. D. (2004). The low-temperature-induced viable-but-nonculturable state affects the virulence of Ralstonia solanacearum Biovar 2.Phytopathology94463469. 10.1094/PHYTO.2004.94.5.463

  • 74

    VandenkoornhuyseP.QuaiserA.DuhamelM.Le VanA.DufresneA. (2015). The importance of the microbiome of the plant holobiont.New Phytol.20611961206. 10.1111/nph.13312

  • 75

    VellendM. (2016). The Theory of Ecological Communities.Princeton, NJ: Princeton University Press.

  • 76

    VermaS. K.KingsleyK.IrizarryI.BergenM.KharwarR. N.WhiteJ. F. (2017). Seed vectored endophytic microbes involved in modulation of development in rice seedlings.J. Appl. Microbiol.12216801691. 10.1111/jam.13463

  • 77

    VermaS. K.WhiteJ. F. (2017). Indigenous endophytic seed bacteria promote seedling development and defend against fungal disease in browntop miller (Urochloa ramose L.).J. Appl. Microbiol.124764778. 10.1111/jam.13673

  • 78

    VermaS. K.WhiteJ. F. (2019). Seed Endophytes Biology and Biotechnology.Cham: Springer.

  • 79

    WangX. H.WangQ.NieZ. W.HeL. Y.ShengX. F. (2018). Ralstonia eutropha Q2-8 reduces wheat plant above-ground tissue cadmium and arsenic uptake and increases the expression of the plant root cell wall organization and biosynthesis-related proteins.Environ. Pollut.24214881499.

  • 80

    WangZ.ZhuY.JingR.WuX.LiN.LiuH.et al (2021). High-throughput sequencing-based analysis of the composition and diversity of endophytic bacterial community in seeds of upland rice.Arch. Microbiol.203609620. 10.1007/s00203-020-02058-9

  • 81

    WennstromA. (1994). Endophyte the misuse of an old term.Oikos71535536.

  • 82

    WestA. G.WaiteD. W.DeinesP.BourneD. G.DigbyA.MckenzieV. J.et al (2019). The microbiome in threatened species conservation.Biol. Conserv.2298598. 10.1016/j.biocon.2018.11.016

  • 83

    WilberM. Q.JaniA. J.MihaljevicJ. R.BriggsC. J. (2020). Fungal infection alters the selection, dispersal and drift processes structuring the amphibian skin microbiome.Ecol. Lett.238898. 10.1111/ele.13414

  • 84

    XuL.PierrozG.WipfH. M. L.GaoC.TaylorJ. W.LemauxP. G.et al (2021). Holo-omics for deciphering plant-microbiome interactions.Microbiome9:69. 10.1186/s40168-021-01014-z

  • 85

    ZhouJ.NingD. (2017). Stochastic community assembly: does it matter in microbial ecology?Microbiol. Mol. Biol. Rev.81:e00002-17. 10.1128/MMBR.00002-17

Summary

Keywords

arsenic, gnotobiont, Jasione sessiliflora, vertical transmission, horizontal transmission, bacterial endophyte core, Rhodococcus rhodochrous, Jasione montana

Citation

González-Benítez N, Martín-Rodríguez I, Cuesta I, Arrayás M, White JF and Molina MC (2021) Endophytic Microbes Are Tools to Increase Tolerance in Jasione Plants Against Arsenic Stress. Front. Microbiol. 12:664271. doi: 10.3389/fmicb.2021.664271

Received

05 February 2021

Accepted

08 June 2021

Published

06 October 2021

Volume

12 - 2021

Edited by

Milko Alberto Jorquera, University of La Frontera, Chile

Reviewed by

Massimiliano Cardinale, University of Salento, Italy; Aradhana Mishra, National Botanical Research Institute (CSIR), India

Updates

Copyright

*Correspondence: Natalia González-Benítez,

This article was submitted to Microbe and Virus Interactions with Plants, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics