Abstract
The Gram-positive pathogen Clostridioides difficile is the main bacterial agent of nosocomial antibiotic associated diarrhea. Bacterial peptidyl-prolyl-cis/trans-isomerases (PPIases) are well established modulators of virulence that influence the outcome of human pathologies during infections. Here, we present the first interactomic network of the sole cyclophilin-type PPIase of C. difficile (CdPpiB) and show that it has diverse interaction partners including major enzymes of the amino acid-dependent energy (LdhA, EtfAB, Had, Acd) and the glucose-derived (Fba, GapA, Pfo, Pyk, Pyc) central metabolism. Proteins of the general (UspA), oxidative (Rbr1,2,3, Dsr), alkaline (YloU, YphY) and cold shock (CspB) response were found bound to CdPpiB. The transcriptional (Lrp), translational (InfC, RFF) and folding (GroS, DnaK) control proteins were also found attached. For a crucial enzyme of cysteine metabolism, O-acetylserine sulfhydrylase (CysK), the global transcription regulator Lrp and the flagellar subunit FliC, these interactions were independently confirmed using a bacterial two hybrid system. The active site residues F50, F109, and F110 of CdPpiB were shown to be important for the interaction with the residue P87 of Lrp. CysK activity after heat denaturation was restored by interaction with CdPpiB. In accordance, tolerance toward cell wall stress caused by the exposure to amoxicillin was reduced. In the absence of CdPpiB, C. difficile was more susceptible toward L-cysteine. At the same time, the cysteine-mediated suppression of toxin production ceased resulting in higher cytotoxicity. In summary, the cyclophilin-type PPIase of C. difficile (CdPpiB) coordinates major cellular processes via its interaction with major regulators of transcription, translation, protein folding, stress response and the central metabolism.
Introduction
The multi-resistant Gram-positive obligate anaerobe Clostridioides (Clostridium) difficile is the main nosocomial bacterial agent of antibiotic treatment associated diarrhea (Hopkins and Wilson, 2018). The rise of C. difficile infection (CDI) coincides with the introduction of clindamycin, the first broad-band lincosamin against anaerobic Gram-negative pathogens (Bartlett et al., 1977; Lusk et al., 1978). Currently, first line of treatment is the use of antibiotics like vancomycin, metronidazole and fidaxomicin. However, high recurrence rates, especially after treatment with vancomycin or metronidazole, make this disease difficult to manage (Mullane, 2014; Hopkins and Wilson, 2018).
A major factor influencing the course and outcome of CDI is the composition of the host intestinal microbiome and, connected to it, the bile acid status of the infected individual. Patients undergoing a CDI typically have an antibiotic dependent change of their microbiome followed by a transition from antibacterial to less antibacterial bile acids in their gastrointestinal tract (Theriot et al., 2016). Most commonly, CDI manifests in form of pseudomembranous colitis, which is a strong inflammation of the large intestine. This is caused by massive tissue destruction and leukocytosis due to the production of two large glycosylating toxins, TcdA and TcdB. These exert their cytotoxic activity by inactivating small GTPases and disturbing the actin cytoskeleton dynamics leading to disruption of the gut epithelial barrier (Barbut et al., 2007; Rupnik et al., 2009; Chandrasekaran and Lacy, 2017).
The production of TcdA and TcdB typically coincides with the entry of the bacteria into the stationary phase. Nevertheless, it is controlled by complex regulatory processes on multiple levels and by diverse environmental cues, including subinhibitory concentrations of antibiotics, temperature or the availability of carbon sources and amino acids (Dupuy and Sonenshein, 1998; Bouillaut et al., 2015). One central metabolite in this respect is L-cysteine that represses toxin production (Karlsson et al., 2000). Apart from that, L-cysteine also affects the expression of genes of amino acid biosynthesis, fermentation, energy metabolism, iron acquisition and stress response (Dubois et al., 2016; Gu et al., 2018). Furthermore, there is a strong interconnectedness between iron and L-cysteine dependent gene regulation circuits. Several of the genes of the latter contain Fur boxes in their promoters, which are binding sites for the global iron-responsive transcriptional ferric uptake regulator (Fur) (Dubois et al., 2016). If not metabolized effectively L-cysteine also has an inhibitory effect on growth on C. difficile as it was nicely shown in case of a mutant lacking the cysteine desulfidase CdsB (Gu et al., 2017).
Although there is strong correlation between CDI severity and the capability of the bacteria to produce TcdA and TcdB, this alone does not explain the virulence spectrum of C. difficile in its entirety. Accordingly, several other virulence factors such as extracellular proteases, surface layer proteins, a fibronectin binding protein (Fbp68), a collagen binding protein (CbpA), type IV pili and flagella have been shown or are suspected to contribute to disease severity and host colonization (Geric et al., 2004; Janoir, 2016; Ünal and Steinert, 2016; Péchiné et al., 2018). Especially, the regulation of flagellation and its main structural component flagellin (FliC) is crucial for modulating adherence to host cells, promoting colonization and eliciting immune responses via toll-like receptor 5 (Tasteyre et al., 2001; Dingle et al., 2011; Batah et al., 2016). Moreover, flagellation and toxin production are co-regulated by an intricate genetic switch adding up to the complexity of toxin-related pathogenicity of C. difficile (Aubry et al., 2012; Anjuwon-Foster and Tamayo, 2017).
Currently, many single components and mechanisms of CDI that contribute to host colonization, disease outbreak and dissemination are known. However, their concerted action is still not fully understood. Bacterial PPIases (FKBPs, parvulins and cyclophilins) have in many instances been shown to modulate infectious processes (Ünal and Steinert, 2014). Among those are prominent representatives like Mip and Mip-like FKBPs, or parvulins, like SurA in Gram-negative as well as PrsA and PrsA2 in Gram-positive bacteria (Jacobs et al., 1993; Heikkinen et al., 2009; Behrens-Kneip, 2010; Alonzo et al., 2011; Obi et al., 2011; Ikolo et al., 2015; Ünal and Steinert, 2015). Additionally, recent studies have shown the participation of cyclophilins in the maturation of a secreted nuclease in Staphylococcus aureus as well as in virulence traits, like biofilm formation in Escherichia coli or in sliding motility and amoeba infection by Legionella pneumophila (Skagia et al., 2016; Wiemels et al., 2017; Rasch et al., 2018). The aim of our study was to identify the interaction partners of the sole cyclophilin of C. difficile (CdPpiB) and to characterize its contribution to bacterial physiology as well as virulence. Our results show an unprecedented relationship between bacterial cysteine metabolism and CdPpiB with far reaching implications on virulence. Furthermore, a protein network controlling major cellular function including transcription, translation, protein folding, metabolism, and stress responses was uncovered.
Materials and Methods
Bacterial Strains and Culture
Bacterial strains and plasmids used in this study are listed in Table 1. C. difficile 630Δerm (hereafter referred to as wild type or wt) and its derivatives were cultured in BHIS medium (brain-heart infusion broth (Carl Roth GmbH, Germany) supplemented with 5 g/L yeast extract (BD BactoTM, United States) and 1 g/L L-cysteine (Sigma-Aldrich®, Germany) or TY-medium (30 g/L tryptone, 20 g/L yeast extract) under anaerobic conditions (95% N2/5% H2). If necessary, 5 μg/mL erythromycin or 15 μg/mL thiamphenicol were added. Escherichia coli and Bacillus megaterium were cultured in LB medium supplemented with 100 μg/mL ampicillin, 10 μg/mL tetracycline or 30 μg/ml chloramphenicol at 37°C and 200 rpm. All antibiotics were purchased from Sigma-Aldrich®. Media were solidified by adding 1.5% (wt/vol) agar when needed.
Table 1
| Name | Features | References |
|---|---|---|
| C. difficile str. 630Δerm | Erythromycin-sensitive derivative of strain 630 | DSMZ† (DSM 28645) (Hussain et al., 2005) |
| C. difficile str. 630ΔermΔppiB | cd03310::ClosTron, ErmR | This study |
| E. coli DH10β | Strain for cloning and plasmid propagation, F−mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara, leu)7697 araD139 galU galK nupG rpsL λ− | Grant et al., 1990 |
| E. coli CA434 | E. coli HB101 carrying the R702- conjugative plasmid (Tra+, Mob+) | Purdy et al., 2002 |
| E. coli BTH101 | F−, cya-99, araD139, galE15, galK16, rpsL1 (StrR), hsdR2, mcrA1, mcrB1 | Euromedex, France |
| B. megaterium MS941 | Strain for recombinant production, deficient of the major secreted protease, ΔnrpM | Wittchen and Meinhardt, 1995 |
| pMTL82151 | Shuttle vector for complementation of C. difficile mutants; pBP1-ori (Gram-pos.), ColE1 ori (Gram-neg.), tra, MCS, CmR | Heap et al., 2009 |
| pPpiB_NStrep | pMTL82151 carrying wild type ppiB including its 250 bp upstream and 50 bp downstream regions and a N-terminal StrepII-tag | This study |
| pDSW1728 | Ptet::mCherryOpt, CmR | Ransom et al., 2015 |
| pPpiB-tet | mCherryOpt in pDSW1728 replaced by cd03310 by SacI and BamHI yielding Ptet::ppiB, CmR | This study |
| pN-STREPXa1622 | Vector for recombinant protein production in B. megaterium, PxylA-StrepII-Xa-MCS, TcR, AmpR | Biedendieck et al., 2007 |
| p119_PpiB | pN-STREPXa1622 in which the ORF of ppiB (CD630_03310) was cloned using BglII and SphI | This study |
| p119_CysK | pN-STREPXa1622 in which the ORF of cysK (CD630_15940) was cloned using BglII and SphI | This study |
| pKNT25 | Low copy plasmid carrying the T25 subunit of adenylate cyclase with N-terminal MCS, KmR | Euromedex, France |
| pKNTB | pKNT25 carrying wt ppiB | This study |
| pUT18 | High copy plasmid carrying the T18 subunit of adenylate cyclase with N-terminal MCS, AmpR | Euromedex, France |
| pUT18_CysK | pUT18 carrying wt cysK of C. difficile str. 630Δerm | This study |
| pUT18_Lrp | pUT18 carrying wt lrp of C. difficile str. 630Δerm | This study |
| pUT18_FliC | pUT18 carrying wt fliC of C. difficile str. 630Δerm | This study |
Bacterial strains and plasmids used in this study.
†Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH.
In vivo Cross-Linking for the Identification of PpiB Interaction Partners
Possible interaction partners of PpiB were identified by in vivo cross-linking as previously described (Borrero-de Acuña et al., 2015). Briefly, C. difficile str. 630ΔermΔppiB + PpiB-NStrep was grown for 8 h in 25 mL of BHIS and refreshed 1:1000 in 2 L BHIS. After 16 h 0.125 % (vol/vol) formaldehyde (AppliChem, Germany) was added for chemical cross-linking (30 min at 37°C). Excess formaldehyde was quenched for 5 min at 37°C by the addition of glycine at a final concentration of 130 mM. Cells were harvested and washed twice with PBS (4000 g for 20 min at 4°C). Finally, the cells were resuspended in 25 mL PBS supplemented with complete Protease Inhibitor Cocktail (Roche, Switzerland), and homogenized using FRENCH® Press (Thermo, United States) or glass beads and FastPrep® (MP Biomedicals, United States). Cell debris was removed by centrifugation (10,000 g, 10 min, 4°C), and filtering the supernatant through a 0.45 μm syringe filter. The supernatant was applied onto a 3 mL Strep-Tactin® column (iba Lifesciences, Germany) in order to purify PpiB and its cross-linked partners according to manual instructions. The elution fraction was concentrated using Amicon Ultra-0.5 mL centrifugal filters (Merck, Germany) with a molecular cut-off of 10 kDa. For analysis, the concentrated eluate was mixed with 4x SDS loading buffer and subjected to decrosslinking by heating at 95°C for 30 min. Proteins were separated on a 12% acrylamide gel, and stained using Coomassie stain [100 g/L (NH4)2SO4, 100 mL/L H3PO4, 20% vol/vol methanol]. Bands of interest were analyzed by LC-MS as previously described (Borrero-de Acuña et al., 2016). Resulting protein identifications (hits) were filtered according to their overall coverage by the LC/MS approach and the overall number of unique peptides. Hits with at least 15% coverage and two or more unique peptides were taken into account as this indicated robust enrichment. Ribosomal proteins were discarded because of their intrinsically high abundance in the cell and their known unspecific protein-protein interactions due to their overall strong basic character.
Bacterial Two Hybrid (BACTH) Screening
Protein-protein interactions were confirmed using the BACTH-system of Euromedex (France), which bases on an adenylate cyclase (CyaA) dependent reporter system. For this, ppiB, fliC (CD630_02390), lrp (CD630_35440) and cysK (CD630_15940) were cloned in frame with in two different vectors, each containing one subunit of the adenylate cyclase of Bordetella pertussis (Tables 1, 2). After confirmation of correct cloning, the CyaA-deficient strain E. coli BTH101 was transformed with combinations of plasmids carrying ppiB and the respective interaction partners, and transformants were selected on LB-agar containing 50 μg/mL kanamycin and 100 μg/mL ampicillin. Single transformants were then streaked out on MacConkey-agar (BD DifcoTM, United States) supplemented with 50 μg/mL kanamycin and 100 μg/mL ampicillin, incubated for 2 days at 30°C, and checked for pink coloring due to CyaA-activity.
Measuring the Interaction of PpiB and Lrp and Their Amino Acid Substitution Mutants by β-Galactosidase Assay
Escherichia coli BTH101 carrying plasmid combinations that had been confirmed on MacConkey-agar were used in a β-galactosidase assay for quantitative comparison of interactions between amino acid mutants of PpiB and Lrp, respectively. For this, at least six clones of each transformation were picked and grown o/n (30°C, 200 rpm) in 5 mL LB medium supplemented with 50 μg/mL kanamycin, 100 μg/mL ampicillin and 0.5 mM IPTG (GERBU, Germany). Prior to the assay, bacterial growth was stalled by chilling the cultures for at least 30 min at 4°C and the OD600 was determined. Bacteria of 200 μL culture were pelleted (3500 rpm, 5 min, 4°C), and resuspended in 900 μL of Z-Buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, and freshly added 50 mM β-mercaptoethanol, pH 7.0). Bacteria were lysed by the addition of 50 μL chloroform and 50 μL 0.1% SDS (wt/vol) for 5 min at 30°C. After this, 200 μl of o-nitrophenyl-β-D-galactoside (ONPG, Roth GmbH, Germany) dissolved at 4 mg/mL in phosphate buffer (60 mM Na2HPO4, 40 mM NaH2PO4, pH 7.0) was added. The reactions were kept for 12 min at 30°C and subsequently stopped by the addition of 500 μL 1 M Na2CO3. After removal of cell debris and chloroform by centrifugation (14000 rpm, 5 min, 4°C) absorption at 420 and 550 nm were recorded with a VarioSkanTM (Thermo Fisher, United States) plate reader. β-galactosidase activity, expressed in Miller Units, was calculated according to the following formula:
Construction of a ppiB Destruction Mutant (ΔppiB) in C. difficile 630Δerm Using ClosTron
A synthetic vector containing the region of ppiB (CD630_03310/CDIF630erm_00459) was designed with the help of the ClosTron website1 using the Perutka algorithm (Perutka et al., 2004). E. coli CA434 was transformed with customized vectors for mating with C. difficile 630Δerm cells as described previously (Heap et al., 2009, 2010). Mutants were selected on BHIS containing 15 μg/mL erythromycin and confirmed by PCR and sequencing using gene specific primers (Table 2).
Table 2
| Name | Sequence† | Features | References |
|---|---|---|---|
| PpiB_KompF1 | gatgagcttGAACCATTAATTGGGGATAATG | HindIII, for cloning into pMTL82151 | This study |
| PpiB_KompR1 | atcatgcggccgcTTTATCCTCATTTTTAAGTA ATATATA | NotI, for cloning into pMTL82151 | This study |
| PpiB_NStrep_F | cgggtggctccaTTCCATAATTTATTACCTTCCTTTTC | For introducing N-terminal SrepII-Tag | This study |
| PpiB_NStrep_R | cagtttgaaaaaAATAAAAATCCTATAGTAACTATAGAAATG | For introducing N-terminal SrepII-Tag | This study |
| PpiB_For4 | TCTgagctcATGAAAAGGAAGGTAATAAATTATG | SacI, for cloning into pDSW1728 | This study |
| PpiB_Rev4 | ATAggatccTTAGTTTTTTTCTACATCTGAGTAA | BamHI, for cloning into pDSW1728 | This study |
| CdPpiB_TH_For | gactctagagGAAAATAAAAATCCTATAGTAAC | XbaI, for cloning into BACTH vectors | This study |
| CdPpiB_TH_Rev | ctcggtaccgcGTTTTTTTCTACATCTGAGTAA | KpnI, for cloning into BACTH vectors | This study |
| CdLrp_TH_For | gactctagagGATGTTACAGATTACAGAATC | XbaI, for cloning into BACTH vectors | This study |
| CdLrp_TH_Rev | ctcggtaccgcCAATATTGATTTTGCTTGTATTG | KpnI, for cloning into BACTH vectors | This study |
| CdFliC_TH_For | gactctagagAGAGTTAATACAAATGTAAGTG | XbaI, for cloning into BACTH vectors | This study |
| CdFliC_TH_Rev | ctcggtaccgcTCCTAATAATTGTAAAACTCC | KpnI, for cloning into BACTH vectors | This study |
| CdCysK_TH_For | gactctagagTTATATAATAACGCATTAGAGTT | XbaI, for cloning into BACTH vectors | This study |
| CdCysK_TH_Rev | ctcggtaccgcAAATATTCCCATAGACATATAC | KpnI, for cloning into BACTH vectors | This study |
| Lrp_P32A_invF | GCAGTTTCAGAAAGAGTCAAAAG | This study | |
| Lrp_P32A_invR | tgcAGAAGTTAAACCAACTATTTTTCC | This study | |
| Lrp_P56A_invF | GATTCATTAGGCAGAGTTATAAAG | This study | |
| Lrp_P56A_invR | tgcGTTGACAATAGCTTTATATCCTTC | This study | |
| Lrp_P72A_invF | gcaAGCAATGGATATACAGAATTTATTG | This study | |
| Lrp_P72A_invR | AAGAGAAATATGAATAAATGCCTTTAT | This study | |
| Lrp_P87A_invF | AGGATTGTAGAATGTCACCATAT | This study | |
| Lrp_P87A_invR | tgcGTCCTTTGCAGCTGACTC | This study | |
| Lrp_P135A_invF | gcaATACAAGCAAAATCAATATTGGC | This study | |
| Lrp_P135A_invR | CGTTGATAGTATAACAGAGG | This study | |
| PpiB_R50A_invF | GTAATACCAGGATTTATGATAC | This study | |
| PpiB_R50A_invR | tgcATGAAATATTATTCCATTGTAATATC | This study | |
| PpiB_F109A_invF | gcaTTCATAATGCATAAAAACTCACCAC | This study | |
| PpiB_F109A_invR | TTGAGAACCAGCTGAATTAGGTG | This study | |
| PpiB_F110A_invF | gcaATAATGCATAAAAACTCACCAC | This study | |
| PpiB_F110A_invR | AAATTGAGAACCAGCTGAATTAG | This study | |
| PpiB_For3 | atgagatcttaATGGAAAATAAAAATCCTATAGTAAC | BglII, for cloning into pN-STREPXa1622 | This study |
| PpiB_Rev3 | tagcatgcTTAGTTTTTTTCTACATCTGAGTAAT | SphI, for cloning into pN-STREPXa1622 | This study |
| CdCysK_119_F1 | gccagatctTGTTATATAATAACGCATTAGAG | BglII, for cloning into pN-STREPXa1622 | This study |
| CdCysK_119_R1 | ccggcatgcTTAAAATATTCCCATAGACATATAC | SphI, for cloning into pN-STREPXa1622 | This study |
| EBS universal primer | CGAAATTAGAAACTTGCGTTCAGTAAAC | Heap et al., 2007 | |
| ErmRAM_F | ACGCGTTATATTGATAAAAATAATAGTGGG | Heap et al., 2007 | |
| ErmRAM_F | ACGCGTGCGACTCATAGAATTATTTCCTCCCG | Heap et al., 2007 |
Primers used in this study.
†Restriction recognition sites are underlined; bases for the respective alanine exchange are highlighted.
Assessing Growth and Susceptibility Toward Amoxicillin
Bacterial growth was monitored by refreshing cultures of C. difficile grown overnight (o/n) in 25 mL medium to a starting optical density (OD600nm) of 0.05 in 25 mL fresh medium. Increase in OD600nm was measured starting with t0 and every 60 min until the cultures reached stationary phase. For assessing amoxicillin susceptibility, o/n cultures of wild type C. difficile and its ΔppiB mutant were prepared in 20 mL BHIS medium. The next morning the cultures were adjusted to an OD600nm of 0.1 in BHIS medium. Amoxicillin stock solution was prepared fresh (2 mM in ddH2O) and a 1:1 serial dilution starting at 256 μM was prepared in 100 μl of BHIS distributed in the wells of a 96-well plate. Following this, 100 μL of the bacterial suspension were added into each well resulting in a final OD of 0.05. Bacteria were grown for 6 h at 37°C under anaerobic conditions, and the final OD was measured at 600 nm using a VarioSkanTM (Thermo Fisher, United States) plate reader.
Complementation of C. difficileΔppiB With StrepII-Tagged PpiB and Implementing a Tetracycline- Inducible Promoter
In order to achieve a complementation of the mutant with wild type PpiB carrying a N-terminal StrepII-tag for affinity purification, ppiB was amplified including its 250 bp up- and 100 bp-downstream regions using the primer combination PpiB_KompF1/R1. This fragment was cloned into the shuttle vector pMTL82151 with HindIII and BamHI yielding pMTL_ppiB. This plasmid was used as a template for an inverse PCR by which an N-terminal StrepII-tag was added to PpiB with the primer combination PpiB_NStrep_F/R. The resulting PCR-product was gel purified, phosphorylated with T4 polynucleotide kinase (NEB) and re-ligated with T4 ligase (NEB) according to manufacturer’s instructions. Plasmids carrying the desired mutations were selected in E. coli DH10β and verified by sequencing. For complementation of the ΔppiB mutant under the control of a tetracycline-inducible promoter (Ptet), the ORF of CdPpiB was cloned into pDSW1728 utilizing the restriction sites SacI and BamHI. The ΔppiB mutant was transformed by conjugation and selected using 15 μg/ml thiamphenicol. For complementation studies the bacteria were cultured with 10 ng/mL anhydrotetracycline (AT), and a dose-dependent complementation was achieved by performing the assays with decreasing concentrations of TA starting at 400 ng/mL.
Recombinant Protein Production
For recombinant production, ppiB or cysK were amplified with Q5-Polymerase (NEB GmbH, Germany) and cloned into the production vector pN-STREPXa1622 using the restriction sites BglII and SphI yielding N-terminally StrepII-tagged proteins (Biedendieck et al., 2007). For recombinant protein production, an o/n culture of transformed B. megaterium MS941 was prepared, and the next morning refreshed 1:100 in 300 ml LB medium containing 10 μg/mL tetracycline (Biedendieck et al., 2011). The cells were induced at an OD600nm of ∼0.4 by the addition of D-xylose (Carl Roth GmbH, Germany) at a final concentration of 0.5 % (w/v). After 6 h, the cells were harvested (3000 g, 15 min, 4°C), and the pellet was once washed with 1x PBS (5000 g, 15 min, 4°C). Cells were resuspended in 25 mL ddH2O, and disrupted by FRENCH® Press (Thermo, United States). Immediately after the disruption, 10x wash buffer was added to a final concentration of 1x. Cell debris was removed by centrifugation (10000 g, 20 min, 4°C) and the supernatant was filtered through a 0.45 μm syringe filter. StrepII-tagged PpiB or CysK were purified from the supernatant using Strep-Tactin® sepharose (iba Lifesciences, Germany) according to manufacturer’s instructions. Concentration and buffer change of purified proteins were achieved by centrifugation (5000 g, RT) using Vivaspin® 20 ultrafiltration units (Sartorius, Germany) with 30 or 10 kDa molecular weight cut offs. Proteins were stored in 100 mM HEPES (pH 7.0) at −20°C. Protein yield and purity were analyzed by SDS-page, and protein concentration was determined by absorption at 280 nm.
CysK Activity Assay
Enzymatic activity of recombinantly produced CysK of C. difficile was measured photometrically as previously described with slight modifications (Tai et al., 1993; Saavedra et al., 2004). Briefly, the assays were performed in a 96-well format in 100 μL final volume. As substrates O-Acetyl-L-serine hydrochloride (OAS; Sigma-Aldrich®, A6262) and 5-Thio-2-nitrobenzoic acid (TNB) were used. 20 mM OAS stock solution was freshly prepared in 100 mM HEPES (pH 7.0). Fresh TNB-stock solution was prepared by dissolving 10 mM 5,5′-Dithiobis(2-nitrobenzoic acid) (DTNB; Sigma-Aldrich®, D8130) and 15 mM dithiothreitol in 100 mM HEPES (pH 7.0). Each reaction contained 2 mM OAS and 50 μM TNB. Following the addition of CysK at a final concentration of 7 μM, the reactions were monitored in a VarioSkanTM (Thermo Fisher, United States) plate reader at 30°C by measuring the OD412nm every 4 min. If needed CysK was denatured by incubating aliquots for 30 min at 56°C.
Determination of Toxin Concentration in Supernatants
For determining the toxin production, exponentially growing cultures were adjusted to an OD600nm of 0.05 in 10 mL of fresh BHIS and grown at 37°C under anaerobic conditions. After 48 h, the culture supernatants of 2 mL of each culture were harvested (5000 g, 5 min, RT) and sterile filtered using 0.2 μm syringe filters. Toxin concentrations in culture supernatants were determined using the Clostridium difficile Toxin A OR B ELISA Kit (tgc-E002-1) of tgcBIOMICS (Germany) following the manual instructions.
Cytotoxicity Assay
In order to visualize the cytotoxic activity of C. difficile culture supernatants, NIH-3T3 mouse fibroblast cells (ATCC® CRL-1658TM, United States) were cultured in DMEM (Gibco, United States) supplemented with 10% FBS at 37°C and 5% CO2. For the assay, 105 cells/mL were seeded on glass cover slips in 24-well plates and cultured for 2 days. In parallel, C. difficile were grown in anaerobic chamber for 24 h, and the cell free supernatant containing secreted toxins was harvested by centrifugation (8000 g, 5 min, RT). This supernatant was diluted to 0.1 % (vol/vol) in cell culture medium. Adherent NIH-3T3 cells were washed once with 1 mL PBS, and 1 mL medium with bacterial culture supernatant was added. After incubation for 2 h, medium was removed and the cells were fixed for 15 min at RT with 2% (wt/vol) PFA in 1x PBS, and subsequently permeabilized with 0.1 % (vol/vol) Triton X-100 in 1x PBS with 1% (wt/vol) BSA for 5 min. Cells were stained with PBS containing 1 μg/mL DAPI (Sigma-Aldrich®) and 1:1000 diluted Phalloidin-Alexa488 (Abcam, United Kingdom). The mounted samples were analyzed with a confocal microscope (Leica® SP8, Germany) using an 63x oil immersion objective.
Results
Identification of the Protein Interaction Partners of CdPpiB
A protein blast search using the PpiB sequence of Bacillus subtilis str. 168 (Uniprot ID: P35137) against the most recently annotated C. difficile str. 630Δerm genome identified a single potential cyclophilin encoded by the gene locus CDIF630erm_00459 (CD630_00330 in C. difficile 630). This gene is flanked upstream by a gene potentially encoding for a patatin-like phospholipase, and downstream by a gene encoding the putative exosporium glycoprotein BclA1 (Dannheim et al., 2017a). An alignment of the potential C. difficile cyclophilin with bacterial cyclophilins of E. coli str. K12 (EcPpiB; P23869), B. subtilis (BsPpiB; P35137) and Staphylococcus aureus str. NCTC8325 (SaPpiB; Q2FZU9) as well as eukaryotic representative members of yeast (ScCyp1; P14832) and human (HsCypA; P62937) revealed high amino acid sequence similarities between the different proteins. An exceptional high degree of conservation was observed for amino acid residues involved in PPIase activity (Figure 1). Accordingly, this gene was selected for destruction by ClosTron, which resulted in the generation of a ΔppiB mutant in the C. difficile str. 630Δerm background.
FIGURE 1
Next, we identified in vivo protein interaction partners of CdPpiB using an interactomics approach by using N-terminally StrepII-tagged PpiB as bait and formaldehyde as a cross-linker. A preparative SDS-PAGE of the purified protein complexes revealed in total, seven distinct protein bands that were cut out and prepared for LC-MS analysis (Figure 2).
FIGURE 2
This yielded 39 unique hits, and as expected, PpiB was found to be with 83% the best covered protein among those. The majority of the remaining 38 hits that resembled proteins interacting either directly or indirectly in larger complexes with CdPpiB belonged to the functional groups metabolism (19 hits, 50%) and stress response (8 hits, 21%). The rest of the hits were distributed among transcription/translation, protein folding and transport (3 hits and 8% each) as well as motility/surface (2 hits 5%) (Table 3). Among the retrieved potential interaction partners were LdhA, AcdB, HadA, EtfA1, EtfA3, and EtfB1. These enzymes represent the complete pathway for phenylalanine and leucine fermentation (Kim et al., 2006). Similarly, the also detected pyruvate carboxylase Pyc, pyruvate-ferredoxin oxidoreductase Pfo, aldehyde-alcohol dehydrogenase AdhE2 and pyruvate kinase Pyk as well as the glyceraldehyde-3-phosphate GapA and fructose-1,6-bisphosphate aldolase Fba are central enzymes of carbon metabolism (Dannheim et al., 2017b). Finally, the O-acetylserine sulfhydrylase/cysteine synthase (CysK), was among the metabolic proteins the one with the highest sequence coverage. It represents the last enzyme of cysteine biosynthesis (Dubois et al., 2016).
Table 3
| Class | Name | Accession-Nr.† | Gene locus† | Coverage (%) | # unique peptides | Function |
|---|---|---|---|---|---|---|
| Metabolism | CysK | ARE62524.1 | 01767 | 40 | 13 | Cysteine synthase activity |
| GapA | ARE64122.1 | 03466 | 36 | 14 | Glyceraldehyde-3-phosphate dehydrogenase | |
| Fba | ARE61306.1 | 00531 | 34 | 11 | Fructose-1,6-bisphosphate aldolase | |
| Pyc | ARE60920.1 | 00083 | 32 | 40 | Pyruvate carboxylase | |
| EtfA1 | ARE61304.1 | 00529 | 28 | 10 | Isocaproyl-CoA dehydrogenase, electron transfer flavoprotein alpha subunit | |
| AcdB | ARE61302.1 | 00527 | 24 | 8 | Isocaproyl-CoA dehydrogenase, catalytic subunit | |
| PduL | ARE63606.1 | 02937 | 24 | 5 | Phosphate propanoyltransferase | |
| Putative NUDIX-family hydrolase | ARE61693.1 | 00909 | 24 | 3 | Hydrolase | |
| Pfo | ARE63605.1 | 02936 | 23 | 25 | Pyruvate synthase | |
| NifU-like protein | ARE62199.1 | 01433 | 23 | 3 | [Fe–S]-cluster assembly protein | |
| AdhE2 | ARE63909.1 | 03250 | 20 | 17 | Aldehyde-alcohol dehydrogenase | |
| LdhA | ARE61297.1 | 00522 | 20 | 6 | D-lactate dehydrogenase | |
| PfkA | ARE64384.1 | 03700 | 20 | 4 | ATP-dependent 6-phosphofructokinase | |
| EtfA3 | ARE61965.1 | 01196 | 19 | 6 | Electron transfer flavoprotein subunit alpha | |
| Putative 5-nitroimidazole reductase | ARE62385.1 | 01623 | 19 | 3 | Putative 5-nitroimidazole antibiotic resistance protein | |
| HadA | ARE61298.1 | 00523 | 18 | 6 | Isocaprenoyl-CoA:2-hydroxyisocaproate CoA-transferase | |
| IorB | ARE63301.1 | 02620 | 18 | 3 | Indolepyruvate oxidoreductase, subunit beta | |
| EtfB1 | ARE61303.1 | 00528 | 17 | 4 | isocaproyl-CoA dehydrogenase, electron transfer flavoprotein beta subunit | |
| Pyk | ARE64383.1 | 03699 | 16 | 7 | Pyuvate kinase | |
| Stress Response | Rbr1 | ARE61727.1 | 00944 | 58 | 11 | Iron ion binding, oxidoreductase activity, rubrerythrin |
| Dsr | ARE61729.1 | 00946 | 36 | 4 | In silico predicted desulfoferrodoxin | |
| Rbr2 | ARE62400.1 | 01638 | 35 | 6 | Iron ion binding, oxidoreductase activity, rubrerythrin | |
| Rbr3 | ARE62452.1 | 01692 | 33 | 6 | In silico predicted reverse rubrerythrin | |
| UspA | ARE61714.1 | 00930 | 22 | 3 | Putative universal stress protein A | |
| YloU | ARE63487.1 | 02813 | 20 | 2 | Putative alkaline-shock protein | |
| Alkaline shock protein (YqhY) | ARE62115.1 | 01349 | 17 | 2 | Alkaline shock protein | |
| CspB | ARE62276.1 | 01511 | 15 | 2 | Cold shock protein | |
| Transcription/ Translation | Lrp | ARE64537.1 | 03859 | 30 | 4 | AsnC-family transcriptional regulator |
| InfC | ARE61586.1 | 00798 | 17 | 2 | Translation initiation factor IF-3 | |
| RFF | ARE63058.1 | 02368 | 16 | 2 | Ribosome-recycling factor | |
| Protein folding | Putative phage protein | ARE61884.1 | 01109 | 29 | 5 | Protein-export protein, SecB-like |
| GroS | ARE61098.1 | 00314 | 23 | 2 | 10 kDa chaperonin | |
| DnaK | ARE63387.1 | 02707 | 22 | 13 | Chaperone protein, unfolded protein response | |
| Transport | ABC transporter substrate- binding protein | ARE61772.1 | 00993 | 34 | 8 | ABC-type transport system, sugar-family extracellular solute-binding protein |
| Biotin carboxyl carrier protein | ARE62848.1 | 02143 | 23 | 5 | In silico predicted biotin carboxyl carrier protein | |
| UPF0145 protein | ARE62649.1 | 01899 | 23 | 2 | Putative heavy metal binding | |
| Motility/Surface | FliC | ARE61143.1 | 00361 | 54 | 19 | Flagellin |
| SlpA | ARE63719.1 | 03056 | 19 | 11 | S-layer precursor protein |
Putative interaction partners of CdPpiB identified by in vivo cross-linking.
†as annotated in str. 630Δerm by Dannheim et al. (2017a) (GenBank: CP016318.1).
A whole battery of stress response proteins was also found attached to CdPpiB, including the two rubyerythrins Rbr1 and Rbr2 and the desulfoferrodoxin Dsr, which are involved in oxidative stress response (Kawasaki et al., 2009; Riebe et al., 2009). Furthermore, the cold shock protein CspB and the two alkaline shock proteins YloU and YqhY as well as the universal stress protein UspA were among the interacting proteins (Nyström and Neidhardt, 1993; Söderholm et al., 2011; Derman et al., 2015; Tödter et al., 2017). The chaperones GroS and DnaK are part of multiple stress responses (LaRossa and Van Dyk, 1991). Key players of translational quality control, the ribosome-recycling factor RRF, translation initiation factor IF-3 InfC and most interestingly, the pleiotropic transcriptional regulator Lrp were further proteins associated with CdPpiB (Brinkman et al., 2003; Ohashi et al., 2003; Laursen et al., 2005). The screen also yielded flagellin (FliC, 54% coverage) and surface layer protein (SlpA, 19% coverage), two major virulence associated proteins (Tasteyre et al., 2001; Merrigan et al., 2013). Finally, a sugar-family solute binding protein, a putative heavy metal binding protein (UPF0145) and a predicted biotin carrier protein were identified as transporter or transporter associated proteins cross-linked to CdPpiB (Table 3).
CdPpiB Interacts With Lrp, FliC and CysK in a Bacterial Two Hybrid System
In order to verify direct interactions between candidate proteins identified by our interactomic studies, we applied bacterial two hybrid (BACTH) based protein-protein interaction tests. For this, we chose Lrp as it is a global transcriptional regulator, and as there are no reports on functional interactions between bacterial PPIases and transcriptional regulators. Another candidate was the metabolic enzyme with the highest coverage, CysK, that participates in cysteine metabolism which is central to virulence of C. difficile (Dubois et al., 2016). FliC was chosen as it is a well-established virulence factor in many pathogenic bacteria including C. difficile (Tasteyre et al., 2001). For all the tested proteins a clear-cut interaction with CdPpiB was observed, indicated by pink coloring of the resulting clones on MacConkey-agar verifying our findings from the interactomics study (Figure 3).
FIGURE 3
An Intact PPIase Domain of CdPpiB Is Required for the Interaction With P87 Substrate of Lrp
Following the confirmation of the interaction via the BACTH screen, we wanted to analyze whether these interactions may be dependent on the PPIase activity of CdPpiB. For this purpose, we chose Lrp for a detailed study as it is with 15 kDa comparably small and has only five proline residues. As PPIases act on the peptidyl-prolyl bonds in proteins, we exchanged all five proline residues in Lrp by alanine generating the single amino acid substitution mutants P32A, P56A, P72A, P87A and P135A. The interactions between CdPpiB and the generated Lrp-variants were quantified in β-galactosidase assays using the outlined BACTH system. Among the five Lrp-variants only variant P87A showed a significantly reduced β-galactosidase activity. It was with 868.8 ± 43.55 MU 30% less than the interaction with wild type Lrp which had an average β-galactosidase activity of 1246 ± 59.06 MU indicating a specific interaction between the two proteins (Figure 4A). In order to prove that the PPIase domain is involved in the overall process, we went on by exchanging highly conserved single amino acid residues within the active site of CdPpiB that are known from homologous cyclophilins of Gram-positive and Gram-negative bacteria (Göthel et al., 1996; Skagia et al., 2017a; Wiemels et al., 2017). Accordingly, we generated the CdPpiB variants R50A, F109A and F110A (s.a. Figure 1). For all three mutants, significant differences were observed regarding the interaction with Lrp as assessed by β-galactosidase activity (Figure 4B).
FIGURE 4
Destruction of ppiB Leads to Sensitivity to Envelope Stress and L-Cysteine in C. difficile
As our interactomic data revealed that CdPpiB interacts with several stress response proteins, we performed a literature survey of available transcriptomic data. By this, we found that ppiB was the only PPIase of C. difficile that was significantly upregulated under cell wall stress caused by the beta-lactam amoxicillin (Emerson et al., 2008). Accordingly, we tested the susceptibility of the ΔppiB mutant in a serial dilution assay, and registered that the mutant was significantly more susceptible to amoxicillin concentrations ≥ 32 μM supporting our findings regarding the involvement of CdPpiB in stress tolerance (Figure 5).
FIGURE 5
We further went on characterizing the generated ΔppiB mutant by performing growth assays using the standard rich medium BHIS, which is supplemented with 0.5% (wt/vol) yeast extract and 0.1% (wt/vol) L-cysteine. Here, the ΔppiB mutant displayed a significantly delayed growth in BHIS medium containing L-cysteine. Slower growth in the exponential phase resulting in a later entry into stationary phase (9 h in wt vs. 12 h in ΔppiB) was observed. The final OD after 22 h, were comparable for both strains (Figure 6A). When the assays were repeated with plain BHI or with BHIS lacking L-cysteine, no difference between wild type and the ΔppiB mutant were observed. These tests identified L-cysteine as the cause for the observed phenotype. In order to verify the ppiB mutation as sole cause for the observed differences, we complemented the mutant with an intact ppiB gene in trans and brought ppiB under the control of the tetracycline promoter (Ptet) allowing fine-tuned expression under the control of anhydrotetracycline (aTc). The wild type strain and its isogenic ΔppiB mutant were transformed, and grown in the presence of different concentrations of L-cysteine (2–62 mM) in combination of increasing concentrations of aTc (3,625-400 ng/mL) (Figure 6B,C). When fully induced with 400 ng/mL, the ΔppiB mutant was able to cope with 8 mM L-cysteine, which equals to the concentration in BHIS. Its growth under full induction was significantly better compared to reduced induction with 200 ng/mL or less aTc (Figure 6B). Overexpressing ppiB in the wild type resulted in an even higher tolerance of up to 32 mM L-cysteine and a significantly better growth compared to lower induction levels. In case of 16 mM L-cysteine the wild type overexpressing ppiB reached optical densities comparable to the wild type gown at 8 mM L-cysteine without ppiB overexpression (Figure 6C). These observations corroborated the interactomic data where CysK was the major metabolic protein interacting with CdPpiB.
FIGURE 6
CdPpiB Restores CysK Activity After Heat Inactivation
One important function of PPIases is the restoration of enzyme activity after protein inactivation by unfavorable chemical or physical conditions. In our interactomic study, we identified and verified CysK, the terminal enzyme in L-cysteine biosynthesis, as an interaction partner of CdPpiB. Accordingly, we tested the influence CdPpiB on heat inactivated CysK, the last enzyme of cysteine biosynthesis. Activity of recombinantly produced CysK was measured in a photometric assay at 412 nm, and was shown to be active at 7 μM concentration. Next, CysK was mildly heat denatured at 56°C for 30 min and its enzymatic activity was measured with or without five-fold excess of CdPpiB. As expected, heat denatured CysK showed no activity. But, the addition of 35 μM CdPpiB to the reaction efficiently restored its enzymatic activity (Figure 7). This indicates that CdPpiB functionally interacts with CysK and promotes its structural stability.
FIGURE 7
Deletion of ppiB Increases Toxin Production and Cytotoxic Activity
Considering that CysK is a central enzyme in L-cysteine metabolism and that this amino acid is also a potent suppressor of toxin production, we tested the influence of CdPpiB on the cellular amounts of TcdA and TcdB under in vitro conditions (Karlsson et al., 2000; Dubois et al., 2016). We quantified both toxins in stationary cultures of wild type and the ppiB mutant using ELISA. Both toxins were found in significantly higher concentrations in the culture supernatants of the ppiB mutant. While the wild type strain revealed in average 309 ng/mL TcdA in its culture supernatant, the ppiB mutant produced 2.8-fold more TcdA (868 ng/mL) (Figure 8A). Similarly, TcdB was 2.3-fold higher concentrated in the growth supernatant of the mutant (89 ng/mL) compared to the wild type (40 ng/mL) (Figure 8B). In accordance with the amounts of toxins found in the culture supernatant, the broth from mutant growth was considerably more active at 0.1% (vol/vol) dilution, causing stronger actin depolymerization and cell rounding of NIH-3T3 cells (Figure 8C–E). Similar results were obtained for the mutant complemented with the ppiB gene in trans, however, without gene induction by aTc (Figure 8G). Wild type levels of toxins and corresponding cytotoxic effect similar to wild type were observed when the complemented mutant was induced with 400 ng/mL aTc (Figure 8H). Cells treated with supernatants from wild type bacteria overexpressing ppiB exhibited no visual abnormalities of the cellular morphology (Figure 8F). Hence, CdPpiB not only interacts with components of the L-cysteine metabolism and supports the growth in the presence of L-cysteine, but it also affects toxin production in C. difficile.
FIGURE 8
Discussion
The aim of this study was to gain insights into the physiological and virulence related functions of the cyclophilin CdPpiB of the nosocomial pathogen C. difficile. Our in vivo interactomics approach in combination with bacterial two hybrid testing allowed us the identification and verification of a specific set of interaction partners that are major control proteins of cell physiology and virulence. The majority of the interaction partners belonged to the category of energy and central metabolism (Table 3). Here, several functionally related proteins were identified, including LdhA, EtfA1, AcdB, EtfA3, HadA, and EtfB1. These enzymes are part of the same Stickland reaction involving L-leucine catabolism. By this, C. difficile harnesses metabolic energy from the oxidation of one equivalent of L-leucine to isovalerate, CO2 and NH4+. In return, two equivalents of L-leucine are reduced to isocapronate and NH4+ (Stickland, 1934; Britz and Wilkinson, 1982; Kim et al., 2006). This pathway is coupled via NAD+ and ferredoxin to the RNF complex responsible for proton/sodium gradient formation required for ATP generation in C. difficile (Kim et al., 2004; Aboulnaga et al., 2013).
Another group of proteins of putative interaction partners belonged to the primary carbon metabolism. These included pyruvate carboxylase Pyc, pyruvate-ferredoxin oxidoreductase Pfo, aldehyde-alcohol dehydrogenase AdhE2 and pyruvate kinase, which control the flux around the pyruvate knot of the central metabolism. On the other hand, the glyceraldehyde-3-phosphate GapA and fructose-1,6-bisphosphate aldolase represent key control points of glycolysis (Dannheim et al., 2017b). Interestingly, gapA and adhE2 were also up-regulated under cysteine rich conditions (Dubois et al., 2016; Gu et al., 2018). Thus, CdPpiB potentially controls the major fluxes of the central metabolism of C. difficile.
The second largest group of interaction partners belonged to the group of stress response, including proteins protecting against temperature, oxidative and alkaline shock. In line with this, the ΔppiB mutant was more susceptible to amoxicillin, which causes cell wall stress. This finding was also in accordance with a previous microarray study, where ppiB was significantly upregulated in amoxicillin treated C. difficile (Emerson et al., 2008). Currently, we do not know how CdPpiB may influence this phenotype. However, the well-known chaperones DnaK and GroS as well as YloU and YqhY were also upregulated in case of amoxicillin stress (Emerson et al., 2008). In S. aureus DnaK is part of the cell wall stress stimulon, and dnaK mutants have a higher susceptibility toward the beta-lactam oxacillin (Pechous et al., 2004; Singh et al., 2007). Recently, DnaK was identified as a binding partner of EcPpiB in functional complementation and co-precipitation studies in E. coli, where it positively influenced the enzymatic activity and correct localization of DnaK (Skagia et al., 2016). Hence, it is conceivable that, also in C. difficile, CdPpiB is part of the DnaK stress response network. This feature might further be supported by the interactions with YloU and YqhY, which are close homologs of the alkaline shock protein 23 (Asp23) of S. aureus that is also associated with cell envelope stress (Müller et al., 2014; Tödter et al., 2017). EcPpiB is connected to another cell envelope related phenomenon, namely, cell division by directly interacting with FtsZ and probably further client proteins (Skagia et al., 2017b). Our interactomic study did not identify FtsZ as interaction partner in C. difficile. This might indicate that cyclophilins perform species-specific duties despite their high degree of conservation.
Several oxidative stress response proteins of the group of (Rbr1, Rbr2, and Rbr3) and a desulfoferrodoxin (Dsr) were found to bind to CdPpiB. Rubrerythrins are small proteins that have NADH-dependent peroxidase activity and act in concert with rubredoxins and desulfoferrodoxins (Mishra and Imlay, 2012). The homologs of Rbr1 and Dsr are important for conferring O2-tolerance to C. acetbutylicum under the control of the transcriptional regulator PerR, which located between these two genes in C. difficile (Hillmann et al., 2008; Kawasaki et al., 2009; Dannheim et al., 2017a). As these proteins act in close vicinity for efficient electron transfer, it is likely that CdPpiB is involved in complex formation or stability supporting their physiological function. Moreover, oxidative stress genes are upregulated in the presence of L-cysteine in C. difficile (Dubois et al., 2016; Gu et al., 2018).
Two well-established virulence partners, namely the flagellar subunit FliC and the surface layer protein SlpA, were among the CdPpiB interaction partners. In case of FliC this interaction was confirmed by BACTH indicating a functional relationship between these proteins. Two oligomeric states of FliC seem to co-exist: the monomer which has been found in diverse cellular compartments and the polymeric organelle which is employed for motility, attachment and penetration (Campodónico et al., 2010). In fact, the implications of FliC monomers in invasiveness and virulence to the host are not restrained to C. difficile but apply to many other bacteria. For instance, in Pseudomonas aeruginosa or Salmonella typhimurium FliC appears to be the most prominent virulence factor in terms of inflammasome and immune response activation (Duncan and Canna, 2018; Garcia et al., 2018). Interestingly, FliC was shown to interact with DnaK in the periplasm of P. aeruginosa, and in C. difficile a ΔdnaK mutant had four-fold diminished fliC and four-fold increased groS expression (Borrero-de Acuña et al., 2016; Jain et al., 2017). This supports our idea of CdPpiB being a crucial part of the chaperone network of C. difficile.
Next to some transport related proteins, very crucial factors of translational fidelity, IF-3 and RRF, were detected by interactomics. IF-3 is involved in the stabilization of the 30S ribosomal subunit, enabling mRNA binding to the 30S subunit and warranting the accuracy of the first aminoacyl-tRNA binding (Hua and Raleigh, 1998). The RRF, on the other hand, facilitates the dissociation of ribosomes from mRNA after termination of translation. RRF was together with elongation factor P one of the two highly upregulated translation factors in B. subtilis (Ohashi et al., 2003). As a foldase CdPpiB might, indeed, be in close vicinity of ribosomes and assist folding of newly synthesized proteins. However, there are currently no reports supporting this. Also, there is with trigger factor a known ribosome associated protein with a FKBP-domain that was shown to accompany proteins during their maturation following translation (Göthel et al., 1998; Kawagoe et al., 2018). This ubiquitous protein is also present in C. difficile (CDIF630erm_03607/CD630_33060) and is accordingly expected to be the major PPIase that facilitates protein folding. Nevertheless, it could be that CdPpiB does not associate with newly synthesized proteins but is involved in the recycling of translation factors for efficient ribosomal fidelity.
One of the most interesting binding partners was the transcriptional regulator Lrp. Hence, we analyzed the putative interaction between CdPpiB and Lrp in more detail and showed that this interaction depends on the PPIase active site residues. Mutating the highly conserved R50 and F109 weakened, while a F110A substitution significantly strengthened the association between both proteins. In return, out of the five proline residues of CdLrp only mutating P87 reduced the interaction of both proteins indicating a specific PPIase client protein relationship. Lrp-type proteins are global transcriptional regulators that consist of a classical N-terminal helix-turn-helix DNA-binding domain and a C-terminal substrate binding/ activation domain and typically act as specific regulators of amino acid metabolism-related genes (Brinkman et al., 2003). However, in B. subtilis LrpC, a close homolog of CdLrp, was also shown to be important for DNA-repair (López-Torrejón et al., 2006). More interestingly, deleting decR (STM0459), a very close homolog of CdLrp in Salmonella typhimurium, rendered the bacteria more susceptible to L-cysteine (Oguri et al., 2012). Hence, the cysteine-dependent phenotypes of the ΔppiB mutant might be due to the participation of CdPpiB on multiple levels ranging from gene regulation to enzymatic activity. The proline residue at position 87 is in the vicinity of the substrate binding/activation domain. Considering that peptidyl-prolyl-cis/trans-isomerization results in conformational changes in proteins, it is possible that CdPpiB assists CdLrp in changing its conformation upon binding its substrate or that it regulates the conformational equilibrium of CdLrp for a fine-tuned gene expression. Currently, only for eukaryotic PPIases examples of gene regulatory actions in the form of transcription complex stabilization or mRNA maturation are known (Hanes, 2015; Thapar, 2015). To the best of our knowledge, this is the first time a direct interaction between a PPIase and a transcriptional regulator with direct implications on gene regulation has been shown in bacteria.
Interestingly and also in accordance with the interactomic findings, the ΔppiB mutant showed two L-cysteine dependent phenotypes: a higher susceptibility toward L-cysteine and accumulation of more toxin in the supernatant. Typically added to the medium to promote growth, L-cysteine has also some detrimental effects because of the generated H2S during its degradation. As a result, deleting cysteine catabolizing genes results in decreased cysteine tolerance in bacteria (Oguri et al., 2012; Gu et al., 2017). Cysteine is also among several metabolic stimuli that inhibit toxin production in C. difficile on transcriptional level, and it does so via its degradation byproducts pyruvate and H2S (Karlsson et al., 2000; Dubois et al., 2016). That cysteine tolerance and regulation of toxin expression converges via the cysteine metabolism was recently shown in a mutant lacking the cysteine desulfhydrase CdsB. This mutant was impaired in its growth in the presence of 5 mM L-cysteine and its toxin production was unaffected by L-cysteine (Gu et al., 2017). These observations overlap with the ΔppiB mutant in our study, and are further supported by the identification of CysK as an interaction partner of CdPpiB. As a O-acetylserine sulfhydrylase CysK catalyzes the synthesis of L-cysteine from O-acetyl-L-serine and sulfide (Kredich et al., 1979). But it was also speculated that at higher L-cysteine concentrations CysK catalyzes the opposite reaction and contributes to L-cysteine degradation by desulfhydration (Auger et al., 2005; Awano et al., 2005; Dubois et al., 2016). This was further supported by the observation that in C. difficile CysK was together with CysE one of the two transcriptionally most up-regulated genes of the cysteine metabolism in L-cysteine treated C. difficile (Dubois et al., 2016; Gu et al., 2018). In our study, we showed that CdPpiB interacts with CysK and it restores the enzymatic activity of denatured CysK. Considering this and the similarities between the phenotypes, we propose that CdPpiB contributes to L-cysteine tolerance of C. difficile by stabilizing the metabolic network on the enzymatic level. Here again, a cooperative action with other chaperones cannot be excluded as dnaK and groS were also among the highly up-regulated genes in the presence of L-cysteine (Dubois et al., 2016). Furthermore, a direct or indirect influence on the transcription of toxin genes by CdPpiB cannot be excluded and would need further analysis.
Taken together, CdPpiB is a key regulator that acts at the protein folding and modification level and controls central cellular processes. We also suggest that targeting CdPpiB as a therapeutic strategy aiming at virulence reduction may prove intricate, since in the absence of PpiB the bacteria become more toxigenic. Our findings confirm the contribution of the PPIase domain to its regulatory activity. But recent findings also suggest that cyclophilin function in bacteria does not solely rely on PPIase activity (Skagia et al., 2017b; Keogh et al., 2018). Accordingly, whether the PPIase-activity itself or some domains other than the PPIase domain are crucial for a certain interaction or even biological function still need to be evaluated in the future.
Statements
Author contributions
CÜ, JBdA, LJ, DJ, and MS conceived the experiments. CÜ, MK, MB, and CP conducted the experiments. JW performed the MS/LC analysis. CÜ, MK, MB, LJ, DJ, and MS analyzed the data. CÜ, DJ, and MS drafted and finalized the manuscript. All authors reviewed and approved the final manuscript.
Funding
This work was funded by the Federal State of Lower Saxony, Niedersächsisches Vorab CDiff and CDInfect projects (VWZN2889/3215/3266) as well as by the German Research Foundation and the Open Access Publication Funds of the Technische Universität Braunschweig.
Acknowledgments
We would like to thank Drs. Rebekka Biedendieck, Sarah Wienecke, and Tobias Knuuti for pN-STREPXa1622 and their technical support regarding recombinant production in B. megaterium, and B.Sc. Lisa Maria Held for her technical support.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Footnotes
References
1
AboulnagaE.-H.PinkenburgO.SchiffelsJ.El-RefaiA.BuckelW.SelmerT. (2013). Effect of an oxygen-tolerant bifurcating butyryl coenzyme A dehydrogenase/electron-transferring flavoprotein complex from Clostridium difficile on butyrate production in Escherichia coli.J. Bacteriol.1953704–3713. 10.1128/JB.00321-13
2
AlonzoF.XayarathB.WhisstockJ. C.FreitagN. E. (2011). Functional analysis of the Listeria monocytogenes secretion chaperone PrsA2 and its multiple contributions to bacterial virulence.Mol. Microbiol.801530–1548. 10.1111/j.1365-2958.2011.07665.x
3
Anjuwon-FosterB. R.TamayoR. (2017). A genetic switch controls the production of flagella and toxins in Clostridium difficile.PLoS Genet.13:e1006701. 10.1371/journal.pgen.1006701
4
AubryA.HussackG.ChenW.KuoLeeR.TwineS. M.FultonK. M.et al (2012). Modulation of toxin production by the flagellar regulon in Clostridium difficile.Infect. Immun.803521–3532. 10.1128/IAI.00224-12
5
AugerS.GomezM. P.DanchinA.Martin-VerstraeteI. (2005). The PatB protein of Bacillus subtilis is a C-S-lyase.Biochimie87231–238. 10.1016/j.biochi.2004.09.007
6
AwanoN.WadaM.MoriH.NakamoriS.TakagiH. (2005). Identification and functional analysis of Escherichia coli cysteine desulfhydrases.Appl. Environ. Microbiol.714149–4152. 10.1128/AEM.71.7.4149-4152.2005
7
BarbutF.GariazzoB.BonnéL.LalandeV.BurghofferB.LuiuzR.et al (2007). Clinical features of Clostridium difficile-associated infections and molecular characterization of strains: results of a retrospective study, 2000-2004.Infect. Control Hosp. Epidemiol.28131–139. 10.1086/511794
8
BartlettJ. G.OnderdonkA. B.CisnerosR. L.KasperD. L. (1977). Clindamycin-associated colitis due to a toxin-producing species of Clostridium in hamsters.J. Infect. Dis.136701–705. 10.1093/infdis/136.5.701
9
BatahJ.Denève-LarrazetC.JolivotP.-A.KuehneS.CollignonA.MarvaudJ.-C.et al (2016). Clostridium difficile flagella predominantly activate TLR5-linked NF-κB pathway in epithelial cells.Anaerobe38116–124. 10.1016/j.anaerobe.2016.01.002
10
Behrens-KneipS. (2010). The role of SurA factor in outer membrane protein transport and virulence.Int. J. Med. Microbiol. IJMM300421–428. 10.1016/j.ijmm.2010.04.012
11
BiedendieckR.BorgmeierC.BunkB.StammenS.ScherlingC.MeinhardtF.et al (2011). Systems biology of recombinant protein production using Bacillus megaterium.Methods Enzymol.500165–195. 10.1016/B978-0-12-385118-5.00010-4
12
BiedendieckR.YangY.DeckwerW.-D.MaltenM.JahnD. (2007). Plasmid system for the intracellular production and purification of affinity-tagged proteins in Bacillus megaterium.Biotechnol. Bioeng.96525–537. 10.1002/bit.21145
13
Borrero-de AcuñaJ. M.JänschL.RohdeM.TimmisK. N.JahnD.JahnM. (2015). “Interatomic characterization of protein–protein interactions in membrane-associated mega-complexes,” inHydrocarbon and Lipid Microbiology Protocols Springer Protocols Handbooks, edsMcGenityT.TimmisK.NogalesB. (Berlin: Springer).
14
Borrero-de AcuñaJ. M.RohdeM.WissingJ.JänschL.SchobertM.MolinariG.et al (2016). Protein network of the Pseudomonas aeruginosa denitrification apparatus.J. Bacteriol.1981401–1413. 10.1128/JB.00055-16
15
BouillautL.DuboisT.SonensheinA. L.DupuyB. (2015). Integration of metabolism and virulence in Clostridium difficile.Res. Microbiol.166375–383. 10.1016/j.resmic.2014.10.002
16
BrinkmanA. B.EttemaT. J. G.de VosW. M.van der OostJ. (2003). The Lrp family of transcriptional regulators.Mol. Microbiol.48287–294. 10.1046/j.1365-2958.2003.03442.x
17
BritzM. L.WilkinsonR. G. (1982). Leucine dissimilation to isovaleric and isocaproic acids by cell suspensions of amino acid fermenting anaerobes: the Stickland reaction revisited.Can. J. Microbiol.28291–300. 10.1139/m82-043
18
CampodónicoV. L.LlosaN. J.GroutM.DöringG.Maira-LitránT.PierG. B. (2010). Evaluation of flagella and flagellin of Pseudomonas aeruginosa as vaccines.Infect. Immun.78746–755. 10.1128/IAI.00806-09
19
ChandrasekaranR.LacyD. B. (2017). The role of toxins in Clostridium difficile infection.FEMS Microbiol. Rev.41723–750. 10.1093/femsre/fux048
20
DannheimH.RiedelT.Neumann-SchaalM.BunkB.SchoberI.SpröerC.et al (2017a). Manual curation and reannotation of the genomes of Clostridium difficile 630Δerm and C. difficile 630.J. Med. Microbiol.66286–293. 10.1099/jmm.0.000427
21
DannheimH.WillS. E.SchomburgD.Neumann-SchaalM. (2017b). Clostridioides difficile 630Δerm in silico and in vivo - quantitative growth and extensive polysaccharide secretion.FEBS Open Bio7602–615. 10.1002/2211-5463.12208
22
DermanY.SöderholmH.LindströmM.KorkealaH. (2015). Role of csp genes in NaCl, pH, and ethanol stress response and motility in Clostridium botulinum ATCC 3502.Food Microbiol.46463–470. 10.1016/j.fm.2014.09.004
23
DingleT. C.MulveyG. L.ArmstrongG. D. (2011). Mutagenic analysis of the Clostridium difficile flagellar proteins, FliC and FliD, and their contribution to virulence in hamsters.Infect. Immun.794061–4067. 10.1128/IAI.05305-11
24
DuboisT.Dancer-ThibonnierM.MonotM.HamiotA.BouillautL.SoutourinaO.et al (2016). Control of Clostridium difficile physiopathology in response to cysteine availability.Infect. Immun.842389–2405. 10.1128/IAI.00121-16
25
DuncanJ. A.CannaS. W. (2018). The NLRC4 Inflammasome.Immunol. Rev.281115–123. 10.1111/imr.12607
26
DupuyB.SonensheinA. L. (1998). Regulated transcription of Clostridium difficile toxin genes.Mol. Microbiol.27107–120. 10.1046/j.1365-2958.1998.00663.x
27
EmersonJ. E.StablerR. A.WrenB. W.FairweatherN. F. (2008). Microarray analysis of the transcriptional responses of Clostridium difficile to environmental and antibiotic stress.J. Med. Microbiol.57757–764. 10.1099/jmm.0.47657-0
28
GarciaM.MorelloE.GarnierJ.BarraultC.GarnierM.BurucoaC.et al (2018). Pseudomonas aeruginosa flagellum is critical for invasion, cutaneous persistence and induction of inflammatory response of skin epidermis.Virulence91163–1175. 10.1080/21505594.2018.1480830
29
GericB.RupnikM.GerdingD. N.GrabnarM.JohnsonS. (2004). Distribution of Clostridium difficile variant toxinotypes and strains with binary toxin genes among clinical isolates in an American hospital.J. Med. Microbiol.53887–894. 10.1099/jmm.0.45610-0
30
GöthelS. F.HerrlerM.MarahielM. A. (1996). Peptidyl-prolyl cis-trans isomerase of Bacillus subtilis: identification of residues involved in cyclosporin A affinity and catalytic efficiency.Biochemistry353636–3640. 10.1021/bi9520803
31
GöthelS. F.ScholzC.SchmidF. X.MarahielM. A. (1998). Cyclophilin and trigger factor from Bacillus subtilis catalyze in vitro protein folding and are necessary for viability under starvation conditions.Biochemistry3713392–13399. 10.1021/bi981253w
32
GrantS. G.JesseeJ.BloomF. R.HanahanD. (1990). Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants.Proc. Natl. Acad. Sci. U.S.A.874645–4649. 10.1073/pnas.87.12.4645
33
GuH.ShiK.LiaoZ.QiH.ChenS.WangH.et al (2018). Time-resolved transcriptome analysis of Clostridium difficile R20291 response to cysteine.Microbiol. Res.215114–125. 10.1016/j.micres.2018.07.003
34
GuH.YangY.WangM.ChenS.WangH.LiS.et al (2017). Novel cysteine desulfidase cdsb involved in releasing cysteine repression of toxin synthesis in Clostridium difficile.Front. Cell Infect. Microbiol.7:531. 10.3389/fcimb.2017.00531
35
HanesS. D. (2015). Prolyl isomerases in gene transcription.Biochim. Biophys. Acta18502017–2034. 10.1016/j.bbagen.2014.10.028
36
HeapJ. T.KuehneS. A.EhsaanM.CartmanS. T.CooksleyC. M.ScottJ. C.et al (2010). The ClosTron: mutagenesis in Clostridium refined and streamlined.J. Microbiol. Methods8049–55. 10.1016/j.mimet.2009.10.018
37
HeapJ. T.PenningtonO. J.CartmanS. T.CarterG. P.MintonN. P. (2007). The ClosTron: a universal gene knock-out system for the genus Clostridium.J. Microbiol. Methods70452–464. 10.1016/j.mimet.2007.05.021
38
HeapJ. T.PenningtonO. J.CartmanS. T.MintonN. P. (2009). A modular system for Clostridium shuttle plasmids.J. Microbiol. Methods7879–85. 10.1016/j.mimet.2009.05.004
39
HeikkinenO.SeppalaR.TossavainenH.HeikkinenS.KoskelaH.PermiP.et al (2009). Solution structure of the parvulin-type PPIase domain of Staphylococcus aureus PrsA–implications for the catalytic mechanism of parvulins.BMC Struct. Biol.9:17. 10.1186/1472-6807-9-17
40
HillmannF.FischerR.-J.Saint-PrixF.GirbalL.BahlH. (2008). PerR acts as a switch for oxygen tolerance in the strict anaerobe Clostridium acetobutylicum.Mol. Microbiol.68848–860. 10.1111/j.1365-2958.2008.06192.x
41
HopkinsR. J.WilsonR. B. (2018). Treatment of recurrent Clostridium difficile colitis: a narrative review.Gastroenterol. Rep.621–28. 10.1093/gastro/gox041
42
HuaY.RaleighD. P. (1998). On the global architecture of initiation factor IF3: a comparative study of the linker regions from the Escherichia coli protein and the Bacillus stearothermophilus protein.J. Mol. Biol.278871–878. 10.1006/jmbi.1998.1736
43
HussainH. A.RobertsA. P.MullanyP. (2005). Generation of an erythromycin-sensitive derivative of Clostridium difficile strain 630 (630Deltaerm) and demonstration that the conjugative transposon Tn916DeltaE enters the genome of this strain at multiple sites.J. Med. Microbiol.54137–141. 10.1099/jmm.0.45790-0
44
IkoloF.ZhangM.HarringtonD. J.RobinsonC.WallerA. S.SutcliffeI. C.et al (2015). Characterisation of SEQ0694 (PrsA/PrtM) of Streptococcus equi as a functional peptidyl-prolyl isomerase affecting multiple secreted protein substrates.Mol. Biosyst.113279–3286. 10.1039/c5mb00543d
45
JacobsM.AndersenJ. B.KontinenV.SarvasM. (1993). Bacillus subtilis PrsA is required in vivo as an extracytoplasmic chaperone for secretion of active enzymes synthesized either with or without pro-sequences.Mol. Microbiol.8957–966. 10.1111/j.1365-2958.1993.tb01640.x
46
JainS.SmythD.O’HaganB. M. G.HeapJ. T.McMullanG.MintonN. P.et al (2017). Inactivation of the dnaK gene in Clostridium difficile 630 Δerm yields a temperature-sensitive phenotype and increases biofilm-forming ability.Sci. Rep.7:17522. 10.1038/s41598-017-175830-9
47
JanoirC. (2016). Virulence factors of Clostridium difficile and their role during infection.Anaerobe3713–24. 10.1016/j.anaerobe.2015.10.009
48
KarlssonS.LindbergA.NorinE.BurmanL. G.AkerlundT. (2000). Toxins, butyric acid, and other short-chain fatty acids are coordinately expressed and down-regulated by cysteine in Clostridium difficile.Infect. Immun.685881–5888. 10.1128/IAI.68.10.5881-5888.2000
49
KawagoeS.NakagawaH.KumetaH.IshimoriK.SaioT. (2018). Structural insight into proline cis/trans isomerization of unfolded proteins catalyzed by the trigger factor chaperone.J. Biol. Chem.29315095–15106. 10.1074/jbc.RA118.003579
50
KawasakiS.SakaiY.TakahashiT.SuzukiI.NiimuraY. (2009). O2 and reactive oxygen species detoxification complex, composed of O2-responsive NADH:rubredoxin oxidoreductase-flavoprotein A2-desulfoferrodoxin operon enzymes, rubperoxin, and rubredoxin, in Clostridium acetobutylicum.Appl. Environ. Microbiol.751021–1029. 10.1128/AEM.01425-08
51
KeoghR. A.ZapfR. L.WiemelsR. E.WittekindM. A.CarrollR. K. (2018). The intracellular cyclophilin Ppib contributes to the virulence of Staphylococcus aureus independently of its peptidyl-prolyl cis/trans isomerase activity.Infect Immun.86:e00379-18. 10.1128/IAI.00379-18
52
KimJ.DarleyD.SelmerT.BuckelW. (2006). Characterization of (R)-2-hydroxyisocaproate dehydrogenase and a family III coenzyme A transferase involved in reduction of L-leucine to isocaproate by Clostridium difficile.Appl. Environ. Microbiol.726062–6069. 10.1128/AEM.00772-06
53
KimJ.HetzelM.BoiangiuC. D.BuckelW. (2004). Dehydration of (R)-2-hydroxyacyl-CoA to enoyl-CoA in the fermentation of alpha-amino acids by anaerobic bacteria.FEMS Microbiol. Rev.28455–468. 10.1016/j.femsre.2004.03.001
54
KredichN. M.HulanickaM. D.HallquistS. G. (1979). Synthesis of L-cysteine in Salmonella typhimurium.Ciba Found. Symp.7287–99.
55
LaRossaR. A.Van DykT. K. (1991). Physiological roles of the DnaK and GroE stress proteins: catalysts of protein folding or macromolecular sponges?Mol. Microbiol.5529–534. 10.1111/j.1365-2958.1991.tb00724.x
56
LaursenB. S.SørensenH. P.MortensenK. K.Sperling-PetersenH. U. (2005). Initiation of protein synthesis in bacteria.Microbiol. Mol. Biol. Rev. MMBR69101–123. 10.1128/MMBR.69.1.101-123.2005
57
López-TorrejónG.Martínez-JiménezM. I.AyoraS. (2006). Role of LrpC from Bacillus subtilis in DNA transactions during DNA repair and recombination.Nucleic Acids Res.34120–129. 10.1093/nar/gkj418
58
LuskR. H.FeketyR.SilvaJ.BrowneR. A.RinglerD. H.AbramsG. D. (1978). Clindamycin-induced enterocolitis in hamsters.J. Infect. Dis.137464–475. 10.1093/infdis/137.4.464
59
MerriganM. M.VenugopalA.RoxasJ. L.AnwarF.MallozziM. J.RoxasB. A. P.et al (2013). Surface-layer protein A (SlpA) is a major contributor to host-cell adherence of Clostridium difficile.PLoS One8:e78404. 10.1371/journal.pone.0078404
60
MishraS.ImlayJ. (2012). Why do bacteria use so many enzymes to scavenge hydrogen peroxide?Arch. Biochem. Biophys.525145–160. 10.1016/j.abb.2012.04.014
61
MullaneK. (2014). Fidaxomicin in Clostridium difficile infection: latest evidence and clinical guidance.Ther. Adv. Chronic Dis.569–84. 10.1177/2040622313511285
62
MüllerM.ReißS.SchlüterR.MäderU.BeyerA.ReißW.et al (2014). Deletion of membrane-associated Asp23 leads to upregulation of cell wall stress genes in Staphylococcus aureus.Mol. Microbiol.931259–1268. 10.1111/mmi.12733
63
NotredameC.HigginsD. G.HeringaJ. (2000). T-Coffee: a novel method for fast and accurate multiple sequence alignment.J. Mol. Biol.302205–217. 10.1006/jmbi.2000.4042
64
NyströmT.NeidhardtF. C. (1993). Isolation and properties of a mutant of Escherichia coli with an insertional inactivation of the uspA gene, which encodes a universal stress protein.J. Bacteriol.1753949–3956. 10.1128/jb.175.13.3949-3956.1993
65
ObiI. R.NordfelthR.FrancisM. S. (2011). Varying dependency of periplasmic peptidylprolyl cis-trans isomerases in promoting Yersinia pseudotuberculosis stress tolerance and pathogenicity.Biochem. J.439321–332. 10.1042/BJ20110767
66
OguriT.SchneiderB.ReitzerL. (2012). Cysteine catabolism and cysteine desulfhydrase (CdsH/STM0458) in Salmonella enterica serovar typhimurium.J. Bacteriol.1944366–4376. 10.1128/JB.00729-12
67
OhashiY.InaokaT.KasaiK.ItoY.OkamotoS.SatsuH.et al (2003). Expression profiling of translation-associated genes in sporulating Bacillus subtilis and consequence of sporulation by gene inactivation.Biosci. Biotechnol. Biochem.672245–2253. 10.1271/bbb.67.2245
68
PéchinéS.BruxelleJ. F.JanoirC.CollignonA. (2018). Targeting Clostridium difficile surface components to develop immunotherapeutic strategies against Clostridium difficile infection.Front. Microbiol.9:1009. 10.3389/fmicb.2018.01009
69
PechousR.LedalaN.WilkinsonB. J.JayaswalR. K. (2004). Regulation of the expression of cell wall stress stimulon member gene msrA1 in methicillin-susceptible or -resistant Staphylococcus aureus.Antimicrob. Agents Chemother.483057–3063. 10.1128/AAC.48.8.3057-3063.2004
70
PerutkaJ.WangW.GoerlitzD.LambowitzA. M. (2004). Use of computer-designed group II introns to disrupt Escherichia coli DExH/D-box protein and DNA helicase genes.J. Mol. Biol.336421–439. 10.1016/j.jmb.2003.12.009
71
PurdyD.O’KeeffeT. A. T.ElmoreM.HerbertM.McLeodA.Bokori-BrownM.et al (2002). Conjugative transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile through circumvention of the restriction barrier.Mol. Microbiol.46439–452. 10.1046/j.1365-2958.2002.03134.x
72
RansomE. M.EllermeierC. D.WeissD. S. (2015). Use of mCherry Red fluorescent protein for studies of protein localization and gene expression in Clostridium difficile.Appl. Environ. Microbiol.811652–1660. 10.1128/AEM.03446-14
73
RaschJ.ÜnalC. M.KlagesA.KarsliÜHeinsohnN.BrouwerR. M. H. J.et al (2018). PPIases Mip and PpiB of Legionella pneumophila contribute to surface translocation, growth at suboptimal temperature and infection.Infect. Immun87: e00939-17. 10.1128/IAI.00939-17
74
RiebeO.FischerR.-J.WamplerD. A.KurtzD. M.BahlH. (2009). Pathway for H2O2 and O2 detoxification in Clostridium acetobutylicum.Microbiol. Read. Engl.15516–24. 10.1099/mic.0.022756-0
75
RupnikM.WilcoxM. H.GerdingD. N. (2009). Clostridium difficile infection: new developments in epidemiology and pathogenesis.Nat. Rev. Microbiol.7526–536. 10.1038/nrmicro2164
76
SaavedraC. P.EncinasM. V.ArayaM. A.PérezJ. M.TantaleánJ. C.FuentesD. E.et al (2004). Biochemical characterization of a thermostable cysteine synthase from Geobacillus stearothermophilus V.Biochimie86481–485. 10.1016/j.biochi.2004.06.003
77
SinghV. K.UtaidaS.JacksonL. S.JayaswalR. K.WilkinsonB. J.ChamberlainN. R. (2007). Role for dnaK locus in tolerance of multiple stresses in Staphylococcus aureus.Microbiol. Read. Engl.1533162–3173. 10.1099/mic.0.2007/009506-0
78
SkagiaA.VezyriE.SigalaM.KokkinouA.KarpusasM.VenierakiA.et al (2017a). Structural and functional analysis of cyclophilin PpiB mutants supports an in vivo function not limited to prolyl isomerization activity.Genes Cells2232–44. 10.1111/gtc.12452
79
SkagiaA.ZografouC.VenierakiA.FasseasC.KatinakisP.DimouM. (2017b). Functional analysis of the cyclophilin PpiB role in bacterial cell division.Genes Cells22810–824. 10.1111/gtc.12514
80
SkagiaA.ZografouC.VezyriE.VenierakiA.KatinakisP.DimouM. (2016). Cyclophilin PpiB is involved in motility and biofilm formation via its functional association with certain proteins.Genes Cells Devoted Mol. Cell. Mech.21833–851. 10.1111/gtc.12383
81
SöderholmH.LindströmM.SomervuoP.HeapJ.MintonN.LindénJ.et al (2011). cspB encodes a major cold shock protein in Clostridium botulinum ATCC 3502.Int. J. Food Microbiol.14623–30. 10.1016/j.ijfoodmicro.2011.01.033
82
SticklandL. H. (1934). Studies in the metabolism of the strict anaerobes (genus Clostridium): the chemical reactions by which Cl. sporogenes obtains its energy.Biochem. J.281746–1759. 10.1042/bj0281746
83
TaiC. H.NalaboluS. R.JacobsonT. M.MinterD. E.CookP. F. (1993). Kinetic mechanisms of the A and B isozymes of O-acetylserine sulfhydrylase from Salmonella typhimurium LT-2 using the natural and alternative reactants.Biochemistry326433–6442. 10.1021/bi00076a017
84
TasteyreA.BarcM. C.CollignonA.BoureauH.KarjalainenT. (2001). Role of FliC and FliD flagellar proteins of Clostridium difficile in adherence and gut colonization.Infect. Immun.697937–7940. 10.1128/IAI.69.12.7937-7940.2001
85
TaylorW. R. (1986). The classification of amino acid conservation.J. Theor. Biol.119205–218. 10.1016/S0022-5193(86)80075-3
86
ThaparR. (2015). Roles of prolyl isomerases in RNA-mediated gene expression.Biomolecules5974–999. 10.3390/biom5020974
87
TheriotC. M.BowmanA. A.YoungV. B. (2016). Antibiotic-induced alterations of the gut microbiota alter secondary bile acid production and allow for Clostridium difficile spore germination and outgrowth in the large intestine.mSphere1:e00045-15. 10.1128/mSphere.00045-15
88
TödterD.GunkaK.StülkeJ. (2017). The highly conserved Asp23 family protein YqhY plays a role in lipid biosynthesis in Bacillus subtilis.Front. Microbiol.8:883. 10.3389/fmicb.2017.00883
89
ÜnalC. M.SteinertM. (2014). Microbial peptidyl-prolyl cis/trans isomerases (PPIases): virulence factors and potential alternative drug targets.Microbiol. Mol. Biol. Rev. MMBR78544–571. 10.1128/MMBR.00015-14
90
ÜnalC. M.SteinertM. (2015). FKBPs in bacterial infections.Biochim. Biophys. Acta18502096–2102. 10.1016/j.bbagen.2014.12.018
91
ÜnalC. M.SteinertM. (2016). Novel therapeutic strategies for Clostridium difficile infections.Expert Opin. Ther. Targets20269–285. 10.1517/14728222.2016.1090428
92
WaterhouseA. M.ProcterJ. B.MartinD. M. A.ClampM.BartonG. J. (2009). Jalview Version 2–a multiple sequence alignment editor and analysis workbench.Bioinformatics251189–1191. 10.1093/bioinformatics/btp033
93
WiemelsR. E.CechS. M.MeyerN. M.BurkeC. A.WeissA.ParksA. R.et al (2017). An intracellular peptidyl-prolyl cis/trans isomerase is required for folding and activity of the Staphylococcus aureus secreted virulence factor nuclease.J. Bacteriol.199:e00453-16. 10.1128/JB.00453-16
94
WittchenK. D.MeinhardtF. (1995). Inactivation of the major extracellular protease from Bacillus megaterium DSM319 by gene replacement.Appl. Microbiol. Biotechnol.42871–877. 10.1007/BF00191184
Summary
Keywords
Clostridium difficile, peptidyl-prolyl-cis/trans-isomerase (PPIase), cytotoxicity, interactomics, transcription
Citation
Ünal CM, Karagöz MS, Berges M, Priebe C, Borrero de Acuña JM, Wissing J, Jänsch L, Jahn D and Steinert M (2019) Pleiotropic Clostridioides difficile Cyclophilin PpiB Controls Cysteine-Tolerance, Toxin Production, the Central Metabolism and Multiple Stress Responses. Front. Pharmacol. 10:340. doi: 10.3389/fphar.2019.00340
Received
04 December 2018
Accepted
19 March 2019
Published
05 April 2019
Volume
10 - 2019
Edited by
Flavio Rizzolio, Università Ca’ Foscari, Italy
Reviewed by
Laura J. Blair, University of South Florida, United States; Floriana Campanile, Università degli Studi di Catania, Italy
Updates
Copyright
© 2019 Ünal, Karagöz, Berges, Priebe, Borrero de Acuña, Wissing, Jänsch, Jahn and Steinert.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Can Murat Ünal, c.uenal@tu-braunshweig.de; unal@tau.edu.tr
This article was submitted to Experimental Pharmacology and Drug Discovery, a section of the journal Frontiers in Pharmacology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.