Abstract
Peroxisome proliferator-activated receptor gamma (PPARγ) is a ligand-activated nuclear receptor that regulates glucose and lipid metabolism. Pharmacological activators of PPARγ are being used as a treatment of obesity related disorders such as dyslipidaemia and type 2 diabetes, but questions remain open regarding the effects of PPARγ on traits related to the development of type 2 diabetes. In our study, we have analyzed the relationship of the common variant Pro12Ala in the human PPARγ2 gene with the presence of obesity and with insulin, HOMA and lipid profile in a representative sample of 6-to 8-year-old children free from the confounding factors associated with adults. We found that Ala12Ala genotype was significantly more frequent in females with obesity than in those without obesity, with Ala12Ala carriers having significantly higher weight and body mass index (BMI), however the association disappeared when adjusting by leptin concentrations. The Ala12Ala genotype was associated with significantly higher HDL-cholesterol and apoA-I levels in males but not in females, independently of BMI. In a recessive model, in females, leptin levels appeared higher in Ala12Ala carriers. Although no apparent differences were observed in any sex when analyzing insulin levels and HOMA among genotypes without adjusting, lower insulin levels and lower HOMA appeared associated with Ala12Ala carriers when adjusting for BMI and leptin levels. In summary, our data showed that leptin seems to be having an effect on the association between the PPARγ2 Pro12Ala and BMI. Besides, after controlling for BMI and leptin, a protective effect of the Ala12Ala variant of the PPARγ2 Pro12Ala polymorphism on insulin sensitivity is evident already in prepubertal children.
Introduction
The dysregulation of the homeostatic processes associated with obesity results in metabolic disorders originating atherosclerosis and type 2 diabetes. Treatment of the obesity-related complications related to type 2 diabetes is challenging. Among the genes that influence insulin sensitivity those playing a role in adipose tissue may be considered as good candidates. The peroxisome proliferator-activated receptors (PPARs) are lipid-activated transcription factors that modulate several biological processes that are altered in obesity, including lipid and glucose metabolism and overall energy homeostasis (). Among the PPAR family, PPARγ plays a central role in glucose homeostasis and adipocyte differentiation and has been related with diabetes mellitus (). In this sense, PPARγ ligands of the antidiabetic thiazolidinediones group are being used as a treatment of obesity comorbidities such as dyslipidaemia and type 2 diabetes (), but questions have arisen in this regard () as the development of these pharmacological activators of PPARγ requires a complete knowledge of the PPARγ-regulated control of glucose and lipid metabolism (). A deeper knowledge of PPARγ physiological role will contribute to better understand the functionality of these PPARγ agonists on preventing type 2 diabetes.
PPARγ2, being a thiazolidinedione receptor, plays an important role in adipocyte differentiation and gene expression (Spiegelman, 1998). The most common genetic variant in the human PPARγ2 gene is a missense mutation in the exon 2 of the gene that results in a substitution of proline by alanine in codon 12 (named Pro12Ala) (Yen et al., 1997). This variant has been found to modulate the transcriptional activity of the gene () and the Ala12 variant was initially associated with lower BMI (). However, two different meta-analyses showed that this Ala12 variant was significantly associated with higher BMI (Masud et al., 2003; Tönjes et al., 2006). On the other hand, the polymorphism has been extensively studied in relation to type 2 diabetes mellitus (). Several studies have associated the Ala12 variant with improved insulin sensitivity and a reduced risk of type 2 diabetes (; ; ; ; ; Radha et al., 2006; ), while other have failed to find any association with insulin sensitivity or type 2 diabetes or reported different findings depending if the study is performed in subjects with diabetes or control populations (Mori et al., 1998; Mancini et al., 1999; Ringel et al., 1999; Oh et al., 2000; Rosmond et al., 2003; Martínez-Gómez et al., 2011). Thus, as summarized in the Huge review and meta-analysis, there is an important heterogeneity in the extent of the association among populations (). This heterogeneity could be attributed to a different effect of PPARγ2 gene among races, gender and age or differences in BMI. In young children, the absence of exposure to many secondary factors associated with adults (smoking, alcohol, pharmacological treatments, etc.) and the lack of influence of sex hormones should permit a better analysis of the influence of these genetic determinants on the variables under study.
In the present work we analyze the relationship of the PPARγ2 Pro12Ala gene polymorphism with the presence of obesity and assess the association of the polymorphism with insulin levels, insulin sensitivity status, estimated using the homeostasis model assessment for insulin resistance (HOMA), and lipid levels in a representative sample of 6-to 8-year-old children.
Materials and Methods
Subjects
The sample included 1,254 healthy school children 6–8 years old (633 males/621 females), with an average age of 7.2 years, who participated in a voluntary survey of cardiovascular risk factors in Spain, in whom information on biochemical variables was available. Information on anthropometric variables was available in 1,000 children (499 males and 501 females). More detailed information about the design of the study is available in previous publications (). The study protocol complied with Helsinki Declaration guidelines and Spanish legal provisions governing clinical research on humans, and was approved by the Clinical Research Ethics Committee of the Instituto de Investigación Sanitaria-Fundación Jiménez Díaz (PIC016-2019 FJD). Parents of all children invited to participate in the study were required to sign a written authorization.
Anthropometric measurements: Measurements were taken with the children lightly dressed and barefoot. Height was measured to the last millimeter using a portable stadiometer and weight was recorded to the nearest 0.1 kg using a standardized electronic digital scale. From these measurements, body mass index (BMI) (weight in kilograms divided by the square of the height in meters: kg/m2) was then computed. Children were classified as having obesity if their BMI exceeded the age- and sex-specific cut-off points established for children by Cole et al. (), a classification that provides an internationally acceptable definition of obesity in children form 2–18 years.
Biochemical Data
Fasting (12-h) venous blood samples were obtained by venipuncture into Vacutainer tubes. Once centrifuged, the fractions were separated and frozen at –70°C. Plasma cholesterol and triglycerides (TG) were measured enzymatically (Menarini Diagnostics, Italy) with an RA-1000 Autoanalyzer. The coefficients of variation of the methods were 2.06% for cholesterol determinations and 3.42% for triglyceride determinations. HDL-cholesterol (HDL-C) was also measured in the RA-1000 after precipitation of Apo B-containing lipoproteins with phosphotungstic acid and Mg (Roche Diagnostics, Spain). LDL-cholesterol (LDL-C) was calculated according to Friedewald`s formula. Plasma Apo AI and Apo B concentrations were quantified by immunonephelometry (Dade Berhing, Germany). Serum insulin concentrations were measured by RIA using a commercial kit (BI-Insulin IRMA, Bio-Rad, France). Insulin resistance was estimated using the homeostasis model assessment for insulin resistance (HOMA = fasting insulin [μU/ml] × fasting glucose [mmol/l]/22.5). Leptin concentrations were determined by ELISA using a commercially available kit (Leptin CAN-L-4260, Diagnostics Biochem Canada Inc.).
Genotype Analysis
DNA was isolated from 10-ml EDTA-blood samples by standard procedures. To determine the PPARγ2 Pro12Ala polymorphism (rs1801282), DNA was amplified in a 50 µL reaction volume containing 10 mM deoxynucleotide triphosphates, 50 mM each primer, and 50 mM MgCl. The primers used were: forward, 5′TCTGGGAGATTCTCCTATTGGC 3´; reverse, 5′CTGGAAGACAACTACAAGAG 3´. The thermal cycling conditions were denaturation at 94°C for 5 min and 30 cycles of 94°C for 30 sg, 52°C for 30 s, and 72°C for 30 s. The 154-bp amplified fragment was restricted overnight with the enzyme HhaI and 37°C, and the DNA fragments were resolved by 8% polyacrylamide gel electrophoresis.
Statistical Analysis
Statistical analyses were carried out using the IBM SPSS software package (Chicago, Illinois, Version 25.0) and GraphPad Prism statistical software (San Diego, California, Version 8). Genotypic and allelic distributions between children with and without obesity were compared using the chi-squared and Fisher´s tests. The normality of the distribution of the variables under study was examined using the Kolmogorov–Smirnov test. Differences in mean anthropometric parameters and biochemical variables between the three genotype groups were tested by the Kruskal–Wallis test. The Mann–Whitney U test was used to test for significant association under a recessive model for the Ala allele and to compare the studied variables between sex. Univariate analysis of variance was used to examine the association of the polymorphism with the biochemical variables after adjusting for the cofounder variables.
Results
Anthropometric and biochemical parameters in males and females in our study are shown in Table 1. The genotype distribution of the Pro12Ala PPARγ2 polymorphism in our cohort was as follows: 84.4% (n = 1,058) homozygote carriers of the wild-type genotype coding for proline (Pro12Pro); 14.9% (n = 187) heterozygote carriers (Pro12Ala) and 0.7% (n = 9) homozygote carriers of the alanine coding genotype (Ala12Ala). The observed genotype frequencies were in agreement with Hardy-Weinberg equilibrium. The prevalence of the Ala12 allele was 8.2%. Of the total of the children included in our study, information on anthropometric variables was available for 1,000 children. Table 2 shows the genotype distribution and allele frequency of the Pro12Ala PPARγ2 polymorphism in males and females classified according to weight category. A significant difference in the prevalence of Ala12Ala genotype was observed between females with and without obesity (6.3 and 0.2%, respectively; Fisher’s test: p = 0.003). No differences were observed in males. The analysis of the association of the genotypes with the anthropometric variables in males and females (Table 3) showed similar results. No significant differences between genotypes were observed in males, while in females Ala12Ala carriers showed significantly higher weight and BMI. However, these significant differences between mean weight and BMI among genotypes disappeared after adjusting for leptin.
TABLE 1
| Males n = 633 | Females n = 621 | P | |
|---|---|---|---|
| Age (years) | 7.2 ± 0.6 | 7.2 ± 0.6 | 0.452 |
| Weight (kg) | 26.9 ± 5.3 | 26.7 ± 5.5 | 0.545 |
| BMI (kg/m2) | 16.9 ± 2.4 | 17.0 ± 2.5 | 0.654 |
| TC (mg/dl) | 181.9 ± 26.2 | 183.8 ± 28.4 | 0.142 |
| TG (mg/dl) | 71.2 ± 25.4 | 73.9 ± 25.9 | 0.013 |
| HDL-C (mg/dl) | 60.2 ± 13.0 | 58.8 ± 13.1 | 0.036 |
| LDL-C (mg/dl) | 107.4 ± 25.4 | 110.3 ± 26.7 | 0.020 |
| Apo AI (mg/dl) | 138.3 ± 19.0 | 135.7 ± 18.9 | 0.018 |
| Apo B (mg/dl) | 68.9 ± 14.1 | 71.5 ± 14.9 | 0.000 |
| Glucose (mg/dl) | 91.6 ± 8.4 | 89.3 ± 9.5 | 0.000 |
| Insulin (μU/mL) | 3.4 ± 2.4 | 3.6 ± 2.7 | 0.084 |
| HOMA | 0.78 ± 0.58 | 0.81 ± 0.61 | 0.295 |
| Leptin (ng/ml) | 4.7 ± 6.5 | 8.7 ± 9.0 | 0.000 |
Anthropometric and biochemical characteristics (mean ± SD) of males and females.
p-values: Mann-Whitney U test.
TABLE 2
| Males | Females | |||||
|---|---|---|---|---|---|---|
| Without obesity | With obesity | Pa | Without obesity | With obesity | Pa | |
| Pro12Pro | 83.2 (380) | 81.0 (34) | ns | 84.1 (381) | 85.4 (41) | 0.003 |
| Pro12Ala | 16.0 (73) | 19.0 (8) | 15.7 (71) | 8.3 (4) | ||
| Ala12Ala | 0.9 (4) | 0.0 (0) | 0.2 (1) | 6.3 (3) | ||
| Pro | 91.14 | 90.48 | ns | 91.94 | 89.58 | ns |
| Ala | 8.86 | 9.52 | 8.06 | 10.42 | ||
PPARγ2 Pro12Ala genotype and allele frequencies (% (N)) according to weight category by sex.
p-value for comparison of Ala12Ala prevalence between subjects with and without obesity by Fisher’s test.
ns: non-significant.
TABLE 3
| Pro12Pro | Pro12Ala | Ala12Ala | Pa | Pb | |
|---|---|---|---|---|---|
| Males (n = 499) | n = 414 | n = 81 | n = 4 | ||
| Non-adjusted | |||||
| Weight (kg) | 26,8 ± 5.3 | 27.2 ± 5.6 | 28.3 ± 3.4 | 0.514 | 0.323 |
| BMI (kg/m2) | 16.9 ± 2.4 | 17.1 ± 2.5 | 16.7 ± 1.4 | 0.850 | 0.855 |
| Adjusted by leptin | |||||
| Weight (kg) | 26.6 ± 0.3 | 27.7 ± 0.6 | 28.3 ± 2.5 | 0.218 | 0.543 |
| BMI (kg/m2) | 16.8 ± 0.1 | 17.3 ± 0.3 | 17.0 ± 1.0 | 0.215 | 0.867 |
| Females (n = 501) | n = 422 | n = 75 | n = 4 | ||
| Non-adjusted | |||||
| Weight (kg) | 26.7 ± 5.4 | 26.0 ± 5.4 | 32.5 ± 5.4 | 0.041 | 0.036 |
| BMI (kg/m2) | 17.0 ± 2.6 | 16.7 ± 2.0 | 20.4 ± 2.5 | 0.049 | 0.018 |
| Adjusted by leptin | |||||
| Weight (kg) | 26.8 ± 0.3 | 25.7 ± 0.6 | 28.4 ± 2.1 | 0.143 | 0.404 |
| BMI (kg/m2) | 17.1 ± 0.1 | 16.9 ± 0.3 | 18.4 ± 0.9 | 0.265 | 0.132 |
Anthropometric parameters (mean ± SD) according to the PPARγ2 Pro12Ala genotype by sex.
p-value for comparison between groups by Kruskal-Wallis test.
p-value for comparison in a recessive model by Mann-Whitney U test.
Tables 4 and 5 show lipid levels, insulin and HOMA, as well as leptin concentrations according to the PPARγ2 Pro12Ala genotypes in males and females respectively. Significant differences (p < 0.05) among genotypes were observed for HDL-cholesterol and apo A-I in males. In a recessive model, significantly higher HDL-cholesterol and apo A-I were observed in males homozygous for the 12Ala allele. Significantly higher leptin levels were observed in females’ carriers of the Ala12Ala genotype. After adjusting for BMI, the associations of the polymorphism with the lipid parameters remained significant in males and an association of carriers of the Ala12Ala genotype with lower glucose concentrations emerged, being significant (p < 0.05) in females (data shown as supplementary data).
TABLE 4
| Pro12Pro N = 535 | Pro12Ala N = 93 | Ala12Ala N = 5 | Pa | Pb | |
|---|---|---|---|---|---|
| TC (mg/dl) | 181.5 ± 25.3 | 181.8 ± 29.4 | 219.3 ± 38.4 | 0.064 | 0.020 |
| TG (mg/dl) | 71.2 ± 26.1 | 70.6 ± 21.3 | 79.3 ± 23.6 | 0.668 | 0.387 |
| HDL-C (mg/dl) | 60.5 ± 13.2 | 57.8 ± 11.8 | 70.6 ± 9.0 | 0.016 | 0.048 |
| LDL-C (mg/dl) | 106.8 ± 24.7 | 109.8 ± 28.5 | 132.9 ± 32.5 | 0.095 | 0.051 |
| Apo AI (mg/dl) | 138.4 ± 18.9 | 136.6 ± 18.9 | 161.6 ± 14.0 | 0.015 | 0.006 |
| Apo B (mg/dl) | 68.8 ± 14.1 | 68.9 ± 14.0 | 80.1 ± 13.4 | 0.259 | 0.100 |
| Glucose (mg/dl) | 91.3 ± 8.2 | 93.2 ± 9.2 | 95.4 ± 9.3 | 0.146 | 0.403 |
| Insulin (μU/mL) | 3.3 ± 2.4 | 3.7 ± 2.3 | 3.7 ± 2.5 | 0.176 | 0.756 |
| HOMA | 0.76 ± 0.57 | 0.87 ± 0.58 | 0.89 ± 0.67 | 0.121 | 0.704 |
| Leptin (ng/ml) | 4.8 ± 6.8 | 3.9 ± 4.1 | 5.6 ± 8.3 | 0.566 | 0.828 |
Biochemical variables (mean ± SD) according to the PPARγ2 Pro12Ala genotype in males.
p-value for comparison between the three genotype groups using Kruskal-Wallis test.
p-value for comparison under a recessive model for the Ala allele using Mann-Whitney U test.
TABLE 5
| Pro12Pro N = 523 | Pro12Ala N = 94 | Ala12Ala N = 4 | Pa | Pb | |
|---|---|---|---|---|---|
| TC (mg/dl) | 184.5 ± 28.7 | 180.2 ± 26.9 | 177.4 ± 23.8 | 0.344 | 0.600 |
| TG (mg/dl) | 73.8 ± 26.8 | 73.4 ± 20.9 | 88.0 ± 22.8 | 0.255 | 0.173 |
| HDL-C (mg/dl) | 59.0 ± 13.5 | 57.8 ± 10.8 | 60.6 ± 18.0 | 0.911 | 0.806 |
| LDL-C (mg/dl) | 110.8 ± 26.7 | 107.7 ± 27.0 | 99.2 ± 16.9 | 0.410 | 0.312 |
| Apo AI (mg/dl) | 135.9 ± 19.4 | 134.8 ± 16.2 | 136.5 ± 22.8 | 0.929 | 0.892 |
| ApoB (mg/dl) | 71.7 ± 14.9 | 71.0 ± 15.3 | 64.1 ± 8.3 | 0.459 | 0.228 |
| Glucose (mg/dl) | 89.3 ± 9.7 | 89.8 ± 7.4 | 76.2 ± 20.5 | 0.253 | 0.194 |
| Insulin (μU/mL) | 3.7 ± 2.7 | 3.6 ± 2.9 | 3.7 ± 0.9 | 0.765 | 0.469 |
| HOMA | 0.81 ± 0.61 | 0.81 ± 0.64 | 0.69 ± 0.29 | 0.941 | 0.901 |
| Leptin (ng/ml) | 8.6 ± 9.1 | 8.3 ± 7.7 | 20.8 ± 13.3 | 0.024 | 0.007 |
Biochemical variables (mean ± SD) according to the PPARγ2 Pro12Ala genotype in females.
p-value for comparison between the three genotype groups using Kruskal-Wallis test.
p-value for comparison under a recessive model for the Ala allele using Mann-Whitney U test.
Due to the high correlation of insulin and HOMA with BMI and leptin levels, a further analysis of the association of the polymorphism with insulin and HOMA after adjusting for these cofounder factors was performed by univariate analysis of variance. As observed in Figure 1, after adjusting for BMI and leptin levels, homozygote carriers of the alanine coding genotype (Ala12Ala) showed lower insulin levels and HOMA values than heterozygote carriers (Pro12Ala) and homozygote carriers of the genotype coding for proline (Pro12Pro), reaching statistical significance for HOMA (Figure 1A). Significantly lower HOMA values were also observed in Ala12Ala carriers after adjusting by BMI and leptin when analyzing under a recessive model (Figure 1B).
FIGURE 1
Discussion
Due to the potential usefulness of activators of PPARγ as a therapeutic option for type 2 diabetes, it is important to understand the relationship of PPARγ with type 2 diabetes related traits. In this sense, the relationship of the PPARγ2 polymorphisms with obesity, insulin sensitivity and lipid profile has been extensively investigated, mainly in adults, with inconsistent results (; Mori et al., 1998; Mancini et al., 1999; Ringel et al., 1999; ; ; Oh et al., 2000; ; ; Masud et al., 2003; Rosmond et al., 2003; Radha et al., 2006; Tönjes et al., 2006; ). In this cross-sectional study, the association of Pro12Ala PPARγ2 polymorphism with obesity, plasma lipids, insulin and leptin concentrations, as well as insulin resistance estimated using the homeostasis model assessment for insulin resistance (HOMA) (Matthews et al., 1985) is investigated in a population-based sample of children in whom the effect of several factors such as sex hormones, alcohol consumption, smoking etc. that may contribute to the discrepancies observed in adults can be avoided.
We found that the frequencies of the rare Ala12 allele (8.2%) and the Ala12Ala genotype (0.7%) of this Pro12Ala variant of the PPARγ2 gene in our Spanish children population were similar to that reported for other Spanish () and Caucasian populations (; ; Meirhaeghe et al., 2000; ) and higher than in Japanese (Mori et al., 1998) and Korean populations (Oh et al., 2000). When comparing the genotype distribution between children with and without obesity we observed a significantly higher Ala12Ala prevalence in girls with obesity but no significant differences in males. A similar finding has been described in a study including 7–18 years old Italian children (), although other study in prepubertal children aged between 4 and 10 years failed to find any direct association between the polymorphism and BMI (). As reported in two meta-analyses analyzing the association of the polymorphism with BMI, although several studies failed to find any association or reported an inverse association between the 12Ala PPARγ2 variant and obesity, it seems that the Ala12 variant has been consistently associated with higher BMI (Masud et al., 2003; Tönjes et al., 2006). As described by Masud et al. in their meta-analysis, Ala12 homozygotes carriers had significantly higher mean BMI than heterozygotes and Pro12 homozygotes, and authors support the hypothesis that the polymorphism is associated with obesity and the association is consistent with a recessive model (Masud et al., 2003), suggesting that the discrepancies between studies would arise from analyzing together heterozygotes and Ala12 homozygotes. The fact that the association is evident in females and not in males suggests that other factors may be affecting the association of the Pro12Ala PPARγ2 polymorphism with anthropometric variables. PPARγ is a key regulator of adipokines production and secretion. Experimental evidence suggests that PPARγ has a direct effect on leptin gene transcription, down-regulating leptin gene expression (; Zhang et al., 1996). To our knowledge, studies analyzing the association of the polymorphism with leptin are scarce but, similar to our findings, other studies have found an association of the Ala12 variant with higher leptin levels (; Simón et al., 2002; ). It can be hypothesized that the Pro12Ala substitution may decrease the suppressing effect of PPARγ on the leptin promoter, affecting leptin concentrations. The higher leptin levels observed in females in our cohort could be contributing to the association between the polymorphism and BMI, as the significant association observed in females disappeared when adjusting by leptin.
One of the main aims of our study was to analyze the association between the Pro12Ala PPARγ2 polymorphism and insulin levels and insulin sensitivity in our children. Some studies in adults have reported an association between the Ala12 variant of PPARγ2 gene and a minor risk of diabetes and insulin resistance (; ), although some others failed to find any association (Mancini et al., 1999). Also studies in children have found an association between the polymorphism and insulin sensitivity (; Scaglioni et al., 2006; ; ), although others failed to find this association (; ; ; Stryjecki et al., 2016; ). However, most of the studies analyzed data in a dominant model (Stumvoll et al., 2001) and reported significant associations in subjects with obesity ().
In our study in children, we have found no differences in insulin levels and HOMA between genotypes when comparing between genotypes without adjusting for BMI. However, insulin levels and mostly HOMA values appeared lower in Ala12 homozygotes after adjusting for leptin concentrations. According to a recessive model analysis, similar to our results, the minor allele of the Pro12Ala PPARγ2 polymorphism has been associated with insulin levels in healthy men without obesity (). Carriers of the Ala12Ala genotype showed increased HOMA compared to individuals with Pro12Pro + Ala12Pro genotypes also in diabetic obese children (). Li et al. demonstrated significant lower fasting insulin levels and HOMA-IR with the presence of the Ala12 allele in adulthood and a similar trend, although not significant, in childhood (). Leptin levels seem to emerge again as a possible confounder factor that may contribute to the discrepancy of results among studies. In our cohort, leptin levels seem to exert an effect on the association between the polymorphism and insulin levels and HOMA. It has been suggested that PPAR ligands reduce obesity-associated comorbidities by acting on fat storage capacity of white adipose tissue and fat burning in brown adipose tissue and/or peripheral tissues (). The fact that when adjusting by leptin this favorable association of the polymorphism with insulin and HOMA emerges supports the role of PPARγ in relationship with insulin resistance already at this age. It has been shown that leptin down-regulates PPARγ mRNA levels in primary human monocyte-derived macrophages (). This reduction in PPARγ expression associated with leptin could be masking the beneficial association between PPARγ polymorphism and insulin sensitivity which appears evident when controlling by leptin concentrations.
Regarding lipid parameters, in males, we observed an association of the Pro12Ala PPARγ2 polymorphism with increased levels of HDL-cholesterol and apo A-I that seems to be independent of BMI and leptin levels. An association of the polymorphism with lower triglycerides levels has also been described in children (Muñoz-Yáñez et al., 2016). The role of PPARγ in the treatment of dyslipidaemia has been shown in clinical trials. PPARγ agonists, such as rosiglitazone or pioglitazone, have been associated with an increase in HDL cholesterol levels, but substantial differences in the association with levels of triglycerides and LDL cholesterol have been reported (Soccio et al., 2014). Pioglitazone seems to increase Apo A-I expression, due to activation of PPARα (Zhang et al., 2010), and stimulates reverse cholesterol transport (). Our data suggest that polymorphisms in the PPARγ genes may contribute to explain differences in the effect of PPARγ agonists on lipid levels due to a different functionality depending on the genotype of the activated PPARγ. In this sense, the review of Khatami et al. supports that PPAR-γ variations should be considered for thiazolidinediones response prediction ().
As a limitation to our study, we should mention that, due to the design of our study, we are not able to perform the analysis of gene expression levels of each genotype group. Further investigation is needed to clarify this aspect.
In summary, in our study we report that, already in prepubertal children, the Pro12Ala PPARγ2 polymorphism is associated with a positive effect on parameters related to type 2 diabetes mellitus: higher HDL-cholesterol and apo A-I independently of BMI and improved insulin sensitivity after adjusting for BMI and leptin levels.
Statements
Data availability statement
The raw data supporting the conclusion of this article will be made available by the authors, without undue reservation.
Ethics statement
The studies involving human participants were reviewed and approved by Clinical Research Ethics Committee of the Instituto de Investigación Sanitaria-Fundación Jiménez Díaz (ref. PIC016-2019 FJD). Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.
Author contributions
CG is responsible for the conception and design of the study. CV-V, OdD, and IP-N performed laboratory work. TG-P, CV-V, and OdD organized the database. CG and CV-V performed the statistical analysis. CG wrote the first draft of the manuscript. CV-V, OdD, IP-N, TG-P, and LS-G reviewed and edited the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Fondo de Investigación Sanitaria, grant number PI 18/01016, and by Biobank grant number FEDER RD09/0076/00101. CV-V is recipient of a research contract from Carlos III Institute of Health (pFIS).
Acknowledgments
The article is dedicated to the late Prof. Manuel de Oya as the warmest homage to his memory.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphar.2021.763853/full#supplementary-material
References
1
AltshulerD.HirschhornJ. N.KlannemarkM.LindgrenC. M.VohlM. C.NemeshJ.et al (2000). The Common PPARgamma Pro12Ala Polymorphism Is Associated with Decreased Risk of Type 2 Diabetes. Nat. Genet.26, 76–80. 10.1038/79216
2
BeamerB. A.YenC. J.AndersenR. E.MullerD.ElahiD.CheskinL. J.et al (1998). Association of the Pro12Ala Variant in the Peroxisome Proliferator-Activated Receptor-Gamma2 Gene with Obesity in Two Caucasian Populations. Diabetes47, 1806–1808. 10.2337/diabetes.47.11.1806
3
BecerE.ÇırakoğluA. (2017). Effect of the Pro12Ala Polymorphism of the Peroxisome Proliferator-Activated Receptor γ2 Gene on Lipid Profile and Adipokines Levels in Obese Subjects. Balk. J. Med. Genet.20, 71–80. 10.1515/bjmg-2017-0007
4
BordoniL.MarchegianiF.PiangerelliM.NapolioniV.GabbianelliR. (2017). Obesity-Related Genetic Polymorphisms and Adiposity Indices in a Young Italian Population. IUBMB Life69, 98–105. 10.1002/iub.1596
5
BuzzettiR.PetroneA.CaiazzoA. M.AlemannoI.ZavarellaS.CapizziM.et al (2005). PPAR-gamma2 Pro12Ala Variant Is Associated with Greater Insulin Sensitivity in Childhood Obesity. Pediatr. Res.57, 138–140. 10.1203/01.PDR.0000147728.62185.21
6
CabreroA.CuberoM.LlaveríasG.AlegretM.SánchezR.LagunaJ. C.et al (2005). Leptin Down-Regulates Peroxisome Proliferator-Activated Receptor Gamma (PPAR-Gamma) mRNA Levels in Primary Human Monocyte-Derived Macrophages. Mol. Cel. Biochem.275, 173–179. 10.1007/s11010-005-1353-8
7
CariouB.CharbonnelB.StaelsB. (2012). Thiazolidinediones and PPARγ Agonists: Time for a Reassessment. Trends Endocrinol. Metab.23, 205–215. 10.1016/j.tem.2012.03.001
8
CataldiS.CostaV.CiccodicolaA.AprileM. (2021). PPARγ and Diabetes: Beyond the Genome and towards Personalized Medicine. Curr. Diab. Rep.21, 18. 10.1007/s11892-021-01385-5
9
CecilJ. E.FischerB.DoneyA. S.HetheringtonM.WattP.WriedenW.et al (2005). The Pro12Ala and C-681G Variants of the PPARG Locus Are Associated with Opposing Growth Phenotypes in Young Schoolchildren. Diabetologia48, 1496–1502. 10.1007/s00125-005-1817-0
10
Chirita-EmandiA.MunteanuD.AndreescuN.TutacP.PaulC.VeleaI. P.et al (2019). No Clinical Utility of Common Polymorphisms in IGF1, IRS1, GCKR, PPARG, GCK1 and KCTD1 Genes Previously Associated with Insulin Resistance in Overweight Children from Romania and Moldova. J. Pediatr. Endocrinol. Metab.32, 33–39. 10.1515/jpem-2018-0288
11
ColeS. A.MitchellB. D.HsuehW. C.PinedaP.BeamerB. A.ShuldinerA. R.et al (2000a). The Pro12Ala Variant of Peroxisome Proliferator-Activated Receptor-Gamma2 (PPAR-Gamma2) Is Associated with Measures of Obesity in Mexican Americans. Int. J. Obes. Relat. Metab. Disord.24, 522–524. 10.1038/sj.ijo.0801210
12
ColeT. J.BellizziM. C.FlegalK. M.DietzW. H. (2000b). Establishing a Standard Definition for Child Overweight and Obesity Worldwide: International Survey. BMJ320, 1240–1243. 10.1136/bmj.320.7244.1240
13
CsernusK.PaulerG.ErhardtÉ.LányiÉ.MolnárD. (2015). Effects of Energy Expenditure Gene Polymorphisms on Obesity-Related Traits in Obese Children. Obes. Res. Clin. Pract.9, 133–140. 10.1016/j.orcp.2014.06.001
14
De KortS. W.Hokken-KoelegaA. C. (2010). The PPAR-Gamma Pro12Ala Polymorphism Associates with Weight Gain during GH-Treatment in Short Children Born Small for Gestational Age. Eur. J. Endocrinol.162, 49–52. 10.1530/EJE-09-0631
15
De VosP.LefebvreA. M.MillerS. G.Guerre-MilloM.WongK.SaladinR.et al (1996). Thiazolidinediones Repress Ob Gene Expression in Rodents via Activation of Peroxisome Proliferator-Activated Receptor Gamma. J. Clin. Invest.98, 1004–1009. 10.1172/JCI118860
16
DedoussisG. V.VidraN.ButlerJ.PapoutsakisC.YannakouliaM.HirschhornJ. N.et al (2009). Peroxisome Proliferator-Activated Receptor-Gamma (PPARgamma) Pro12Ala Polymorphism and Risk for Pediatric Obesity. Clin. Chem. Lab. Med.47, 1047–1050. 10.1515/CCLM.2009.242
17
DeebS. S.FajasL.NemotoM.PihlajamäkiJ.MykkänenL.KuusistoJ.et al (1998). A Pro12Ala Substitution in PPARgamma2 Associated with Decreased Receptor Activity, Lower Body Mass index and Improved Insulin Sensitivity. Nat. Genet.20, 284–287. 10.1038/3099
18
DouglasJ. A.ErdosM. R.WatanabeR. M.BraunA.JohnstonC. L.OethP.et al (2001). The Peroxisome Proliferator-Activated Receptor-Gamma2 Pro12A1a Variant: Association with Type 2 Diabetes and Trait Differences. Diabetes50, 886–890. 10.2337/diabetes.50.4.886
19
DubininaI. A.ChistiakovD. A.EreminaI. A.BrovkinA. N.ZilbermanL. I.NikitinA. G.et al (2014). Studying Progression from Glucose Intolerance to Type 2 Diabetes in Obese Children. Diabetes Metab. Syndr.8, 133–137. 10.1016/j.dsx.2014.07.002
20
EkJ.AndersenG.UrhammerS. A.HansenL.CarstensenB.Borch-JohnsenK.et al (2001). Studies of the Pro12Ala Polymorphism of the Peroxisome Proliferator-Activated Receptor-Gamma2 (PPAR-Gamma2) Gene in Relation to Insulin Sensitivity Among Glucose Tolerant Caucasians. Diabetologia44, 1170–1176. 10.1007/s001250100629
21
FlorezJ. C.JablonskiK. A.SunM. W.BayleyN.KahnS. E.ShamoonH.et al (2007). Effects of the Type 2 Diabetes-Associated PPARG P12A Polymorphism on Progression to Diabetes and Response to Troglitazone. J. Clin. Endocrinol. Metab.92, 1502–1509. 10.1210/jc.2006-2275
22
GarcésC.Gutierrez-GuisadoJ.BenaventeM.CanoB.ViturroE.OrtegaH.et al (2005). Obesity in Spanish Schoolchildren: Relationship with Lipid Profile and Insulin Resistance. Obes. Res.13, 959–963. 10.1038/oby.2005.111
23
GhoussainiM.MeyreD.LobbensS.CharpentierG.ClémentK.CharlesM. A.et al (2005). Implication of the Pro12Ala Polymorphism of the PPAR-Gamma 2 Gene in Type 2 Diabetes and Obesity in the French Population. BMC Med. Genet.6, 11. 10.1186/1471-2350-6-11
24
González SánchezJ. L.Serrano RíosM.Fernández PerezC.LaaksoM.Martínez LarradM. T. (2002). Effect of the Pro12Ala Polymorphism of the Peroxisome Proliferator-Activated Receptor Gamma-2 Gene on Adiposity, Insulin Sensitivity and Lipid Profile in the Spanish Population. Eur. J. Endocrinol.147, 495–501. 10.1530/eje.0.1470495
25
GoudaH. N.SagooG. S.HardingA. H.YatesJ.SandhuM. S.HigginsJ. P. (2010). The Association between the Peroxisome Proliferator-Activated Receptor-Gamma2 (PPARG2) Pro12Ala Gene Variant and Type 2 Diabetes Mellitus: a HuGE Review and Meta-Analysis. Am. J. Epidemiol.171, 645–655. 10.1093/aje/kwp450
26
GrossB.PawlakM.LefebvreP.StaelsB. (2017). PPARs in Obesity-Induced T2DM, Dyslipidaemia and NAFLD. Nat. Rev. Endocrinol.13, 36–49. 10.1038/nrendo.2016.135
27
HaraK.OkadaT.TobeK.YasudaK.MoriY.KadowakiH.et al (2000). The Pro12Ala Polymorphism in PPAR Gamma2 May Confer Resistance to Type 2 Diabetes. Biochem. Biophys. Res. Commun.271, 212–216. 10.1006/bbrc.2000.2605
28
HelwigU.RubinD.KioszJ.SchreiberS.FölschU. R.NothnagelM.et al (2007). The Minor Allele of the PPARgamma2 pro12Ala Polymorphism Is Associated with Lower Postprandial TAG and Insulin Levels in Non-obese Healthy Men. Br. J. Nutr.97, 847–854. 10.1017/S0007114507665179
29
JermendyA.KörnerA.KovácsM.MadácsyL.CsehK. (2011). PPAR-Gamma2 pro12Ala Polymorphism Is Associated with Post-Challenge Abnormalities of Glucose Homeostasis in Children and Adolescents with Obesity. J. Pediatr. Endocrinol. Metab.24, 55–59. 10.1515/JPEM.2011.111
30
JohanssonL. E.DanielssonP.NorgrenS.MarcusC.RidderstråleM. (2009). Interaction Between PPARG Pro12Ala and ADIPOQ G276T Concerning Cholesterol Levels in Childhood Obesity. Int. J. Pediatr. Obes.4, 119–125. 10.1080/17477160802263194
31
KhatamiF.Mohajeri-TehraniM. R.TavangarS. M. (2019). The Importance of Precision Medicine in Type 2 Diabetes Mellitus (T2DM): From Pharmacogenetic and Pharmacoepigenetic Aspects. Endocr. Metab. Immune Disord. Drug Targets19, 719–731. 10.2174/1871530319666190228102212
32
KwakB. R.MulhauptF.MachF. (2002). The Role of PPARgamma Ligands as Regulators of the Immune Response. Drug News Perspect.15, 325–332. 10.1358/dnp.2002.15.6.701652
33
LiJ.NiuX.LiJ.WangQ. (2019). Association of PPARG Gene Polymorphisms Pro12Ala with Type 2 Diabetes Mellitus: A Meta-Analysis. Curr. Diabetes Rev.15, 277–283. 10.2174/1573399814666180912130401
34
LiS.ChenW.SrinivasanS. R.BoerwinkleE.BerensonG. S. (2003). The Peroxisome Proliferator-Activated Receptor-Gamma2 Gene Polymorphism (Pro12Ala) Beneficially Influences Insulin Resistance and its Tracking from Childhood to Adulthood: the Bogalusa Heart Study. Diabetes52, 1265–1269. 10.2337/diabetes.52.5.1265
35
ManciniF. P.VaccaroO.SabatinoL.TufanoA.RivelleseA. A.RiccardiG.et al (1999). Pro12Ala Substitution in the Peroxisome Proliferator-Activated Receptor-Gamma2 Is Not Associated with Type 2 Diabetes. Diabetes48, 1466–1468. 10.2337/diabetes.48.7.1466
36
Martínez-GómezL. E.CruzM.Martínez-NavaG. A.Madrid-MarinaV.ParraE.García-MenaJ.et al (2011). A Replication Study of the IRS1, CAPN10, TCF7L2, and PPARG Gene Polymorphisms Associated with Type 2 Diabetes in Two Different Populations of Mexico. Ann. Hum. Genet.75, 612–620. 10.1111/j.1469-1809.2011.00668.x
37
MasudS.YeS.SAS Group (2003). Effect of the Peroxisome Proliferator Activated Receptor-Gamma Gene Pro12Ala Variant on Body Mass index: A Meta-Analysis. J. Med. Genet.40, 773–780. 10.1136/jmg.40.10.773
38
MatthewsD. R.HoskerJ. P.RudenskiA. S.NaylorB. A.TreacherD. F.TurnerR. C. (1985). Homeostasis Model Assessment: Insulin Resistance and Beta-Cell Function from Fasting Plasma Glucose and Insulin Concentrations in Man. Diabetologia28, 412–419. 10.1007/BF00280883
39
MeirhaegheA.FajasL.HelbecqueN.CottelD.AuwerxJ.DeebS. S.et al (2000). Impact of the Peroxisome Proliferator Activated Receptor Gamma2 Pro12Ala Polymorphism on Adiposity, Lipids and Non-Insulin-Dependent Diabetes Mellitus. Int. J. Obes. Relat. Metab. Disord.24, 195–199. 10.1038/sj.ijo.0801112
40
MoriY.Kim-MotoyamaH.KatakuraT.YasudaK.KadowakiH.BeamerB. A.et al (1998). Effect of the Pro12Ala Variant of the Human Peroxisome Proliferator-Activated Receptor Gamma 2 Gene on Adiposity, Fat Distribution, and Insulin Sensitivity in Japanese Men. Biochem. Biophys. Res. Commun.251, 195–198. 10.1006/bbrc.1998.9421
41
Muñoz-YáñezC.Pérez-MoralesR.Moreno-MacíasH.Calleros-RincónE.BallesterosG.GonzálezR. A.et al (2016). Polymorphisms FTO Rs9939609, PPARG Rs1801282 and ADIPOQ Rs4632532 and Rs182052 but Not Lifestyle Are Associated with Obesity Related-Traits in Mexican Children. Genet. Mol. Biol.39, 547–553. 10.1590/1678-4685-GMB-2015-0267
42
OhE. Y.MinK. M.ChungJ. H.MinY. K.LeeM. S.KimK. W.et al (2000). Significance of Pro12Ala Mutation in Peroxisome Proliferator-Activated Receptor-Gamma2 in Korean Diabetic and Obese Subjects. J. Clin. Endocrinol. Metab.85, 1801–1804. 10.1210/jcem.85.5.6499
43
RadhaV.VimaleswaranK. S.BabuH. N.AbateN.ChandaliaM.SatijaP.et al (2006). Role of Genetic Polymorphism Peroxisome Proliferator-Activated Receptor-Gamma2 Pro12Ala on Ethnic Susceptibility to Diabetes in South-Asian and Caucasian Subjects: Evidence for Heterogeneity. Diabetes Care29, 1046–1051. 10.2337/diacare.2951046
44
RingelJ.EngeliS.DistlerA.SharmaA. M. (1999). Pro12Ala Missense Mutation of the Peroxisome Proliferator Activated Receptor Gamma and Diabetes Mellitus. Biochem. Biophys. Res. Commun.254, 450–453. 10.1006/bbrc.1998.9962
45
RosmondR.ChagnonM.BouchardC. (2003). The Pro12Ala PPARgamma2 Gene Missense Mutation Is Associated with Obesity and Insulin Resistance in Swedish Middle-Aged Men. Diabetes Metab. Res. Rev.19, 159–163. 10.1002/dmrr.371
46
ScaglioniS.VerduciE.SalvioniM.BiondiM. L.RadaelliG.AgostoniC.et al (2006). PPAR-gamma2 Pro12Ala Variant, Insulin Resistance and Plasma Long-Chain Polyunsaturated Fatty Acids in Childhood Obesity. Pediatr. Res.60, 485–489. 10.1203/01.pdr.0000238259.41560.00
47
SimónI.VendrellJ.GutiérrezC.Fernández-RealJ. M.VendrellI.GallartL.et al (2002). Pro12Ala Substitution in the Peroxisome Proliferator-Activated Receptor-Gamma Is Associated with Increased Leptin Levels in Women with Type-2 Diabetes Mellitus. Horm. Res.58, 143–149. 10.1159/000064490
48
SoccioR. E.ChenE. R.LazarM. A. (2014). Thiazolidinediones and the Promise of Insulin Sensitization in Type 2 Diabetes. Cell Metab20, 573–591. 10.1016/j.cmet.2014.08.005
49
SpiegelmanB. M. (1998). PPAR-gamma: Adipogenic Regulator and Thiazolidinedione Receptor. Diabetes47, 507–514. 10.2337/diabetes.47.4.507
50
StryjeckiC.Peralta-RomeroJ.AlyassA.Karam-AraujoR.SuarezF.Gomez-ZamudioJ.et al (2016). Association between PPAR-Γ2 Pro12Ala Genotype and Insulin Resistance Is Modified by Circulating Lipids in Mexican Children. Sci. Rep.6, 24472. 10.1038/srep24472
51
StumvollM.WahlH. G.LöbleinK.BeckerR.MachicaoF.JacobS.et al (2001). Pro12Ala Polymorphism in the Peroxisome Proliferator-Activated Receptor-Gamma2 Gene Is Associated with Increased Antilipolytic Insulin Sensitivity. Diabetes50, 876–881. 10.2337/diabetes.50.4.876
52
TönjesA.ScholzM.LoefflerM.StumvollM. (2006). Association of Pro12Ala Polymorphism in Peroxisome Proliferator-Activated Receptor Gamma with Pre-diabetic Phenotypes: Meta-Analysis of 57 Studies on Nondiabetic Individuals. Diabetes Care29, 2489–2497. 10.2337/dc06-0513
53
YenC.-J.BeamerB. A.NegriC.SilverK.BrownK. A.YarnallD. P.et al (1997). Molecular Scanning of the Human Peroxisome Proliferator Activated Receptor γ (hPPARγ) Gene in Diabetic Caucasians: Identification of a Pro12Ala PPARγ2 Missense Mutation. Biochem. Biophysical Res. Commun.241, 270–274. 10.1006/bbrc.1997.7798
54
ZhangB.GrazianoM. P.DoebberT. W.LeibowitzM. D.White-CarringtonS.SzalkowskiD. M.et al (1996). Down-Regulation of the Expression of the Obese Gene by an Antidiabetic Thiazolidinedione in Zucker Diabetic Fatty Rats and Db/db Mice. J. Biol. Chem.271, 9455–9459. 10.1074/jbc.271.16.9455
55
ZhangL. H.KamannaV. S.GanjiS. H.XiongX. M.KashyapM. L. (2010). Pioglitazone Increases Apolipoprotein A-I Production by Directly Enhancing PPRE-Dependent Transcription in HepG2 Cells. J. Lipid Res.51, 2211–2222. 10.1194/jlr.M004481
Summary
Keywords
PPARγ2 Pro12Ala polymorphism, insulin, HOMA, obesity, body mass index (BMI), children
Citation
Vales-Villamarín C, de Dios O, Pérez-Nadador I, Gavela-Pérez T, Soriano-Guillén L and Garcés C (2021) PPARγ2 Pro12Ala Polymorphism is Associated in Children With Traits Related to Susceptibility to Type 2 Diabetes. Front. Pharmacol. 12:763853. doi: 10.3389/fphar.2021.763853
Received
24 August 2021
Accepted
10 November 2021
Published
23 November 2021
Volume
12 - 2021
Edited by
Beatriz Suarez-Alvarez, Central University Hospital of Asturias, Spain
Reviewed by
Miguel Cruz, Mexican Social Security Institute (IMSS), Mexico
Ayse Cirakoglu, Istanbul University-Cerrahpasa, Turkey
Updates
Copyright
© 2021 Vales-Villamarín, de Dios, Pérez-Nadador, Gavela-Pérez, Soriano-Guillén and Garcés.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Carmen Garcés, cgarces@fjd.es
This article was submitted to Experimental Pharmacology and Drug Discovery, a section of the journal Frontiers in Pharmacology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.