Abstract
Background: Phaeophyceae species are enticing interest among researchers working in the nanotechnology discipline, because of their diverse biological activities such as anti-inflammatory, antioxidant, anti-microbial, and anti-tumor. In the present study, the anti-cancer properties of Polycladia crinita extract and green synthesized Polycladia crinita selenium nanoparticles (PCSeNPs) against breast cancer cell line (MDA-MB-231) and solid Ehrlich carcinoma (SEC) were investigated.
Methods: Gas chromatography–mass spectroscopy examinations of Polycladia crinita were determined and various analytical procedures, such as SEM, TEM, EDX, and XRD, were employed to characterize the biosynthesized PCSeNPs. In vitro, the anticancer activity of free Polycladia crinita and PCSeNPs was evaluated using the viability assay against MDA-MB-231, and also cell cycle analysis by flow cytometry was determined. Furthermore, to study the possible mechanisms behind the in vivo anti-tumor action, mice bearing SEC were randomly allocated into six equal groups (n = 6). Group 1: Tumor control group, group 2: free SeNPs, group 3: 25 mg/kg Polycladia crinita, group 4: 50 mg/kg Polycladia crinita, group 5: 25 mg/kg PCSeNPs, group 6: 50 mg/kg PCSeNPs.
Results: Gas chromatography–mass spectroscopy examinations of Polycladia crinita extract exposed the presence of many bioactive compounds, such as 4-Octadecenoic acid-methyl ester, Tetradecanoic acid, and n-Hexadecenoic acid. These compounds together with other compounds found, might work in concert to encourage the development of anti-tumor activities. Polycladia crinita extract and PCSeNPs were shown to inhibit cancer cell viability and early cell cycle arrest. Concentrations of 50 mg/kg of PCSeNPs showed suppression of COX-2, NF-кB, VEGF, ki-67, Notch 1, and Bcl-2 protein levels. Otherwise, showed amplification of the caspase 3, BAX, and P53 protein levels. Moreover, gene expression of caspase 3, caspase 9, Notch 1, cyclin D1, NF-кB, IL-6, and VEGF was significantly more effective with PCSeNPs than similar doses of free extract.
Conclusion: The PCSeNPs mediated their promising anti-cancerous action by enhancing apoptosis and mitigating inflammation, which manifested in promoting the total survival rate and the tumor volume decrease.
Graphical Abstract
1 Introduction
Cancer develops when the homeostatic equilibrium between cell growth and death is disturbed (). This contributes to the dysregulation of the normal cellular system for cell division, cell differentiation, and cell death, and ultimately to a group of cells that can metastasize to other vital organs, causing substantial morbidity (). Its treatment is still a matter of challenge despite the advanced understanding of the molecular basis involved. Chemotherapy and other standard cancer therapies can be effective, but they also tend to be toxic and have a deleterious effect on the health of patients. Therefore, finding alternative therapies that can eradicate cancer cells, while also having the benefit of fewer side effects that can enhance patient health needs to be urgently addressed (Moncevičiute-Eringiene, 2005; Wang J. et al., 2012; ; ).
Natural products and their derivatives are valuable resources for the discovery of novel small-molecule cancer therapy agents (). Seaweed’s natural products can be categorized as red, brown, or green algae. Within each category, there are many bioactive chemicals with various characteristics that can be utilized for biotechnological purposes (). Because seaweed has many bioactive chemicals, they are used in biomedical applications such as antibacterial (), antiviral (), anti-inflammatory, anticoagulant, and antithrombotic (Soo-Jin et al., 2005; ). Furthermore, Brown algae have antitumoral action against some cancer cell proliferation without adversely affecting healthy cells, as is the case with existing antitumoral therapies (Pádua et al., 2015; ).
Polycladia crinita is a natural brown seaweed that has proven to show anti-inflammatory, antioxidant, and anticancer activity (). Polycladia crinita extract indicated the presence of several bioactive components. Fatty acids (FA) were the primary classification for these substances (). Fatty acids reduce plasma triglyceride levels and reduce the risk of cardiovascular diseases, among other positive impacts on human health (). They also have neuroprotective properties (Wall et al., 2010), and anti-inflammatory properties (; ). Furthermore, the consumption of fatty acids may inhibit the development of malignancies by causing apoptosis and inhibiting angiogenesis (Serini et al., 2009; ). They not only have a strong safety record but also increase the efficiency of chemotherapeutic drugs and mitigate the side effects of chemotherapy or cancer (; ; Spencer et al., 2009). In addition, Fucosterol which was identified in Polycladia Crinita has shown anti-cancer properties (Siddiqui et al., 2011).
Nowadays, bioactive molecules, including natural nutritional elements and algal components allied with nanoparticles, are being investigated as potential replacements for conventional anticancer agents (Miller et al., 2019; ). For example, For example,; in HepG2 carcinoma cells, Polycladia myrica halts cellular proliferation, in addition, it showed a promising role alone or with radiation in defeating breast cancer cell progression in Ehrlich carcinoma-induced in mice ().
The fundamental unit of nanotechnology, known as a nanoparticle (NP), has at least one dimension between 1 and 100 nm. These substances are used in a variety of sectors including agricultural activities, sewage treatment, electronics, heavy metals adsorption, skincare industry, and medical practices, due to their distinctive characteristics (Palani et al., 2021; ). The fabrication of nanoparticles and nano-colloids has been achieved via biological, chemical, and physical processes ().
The biological manufacturing of nanoparticles utilizing extracts from plants and microorganisms, such as bacteria, fungi, and algae, is particularly intriguing since it protects from pressure, high temperatures, and potentially toxic reagents. Due to the capping effect of the algal extract, green-synthesized nanoparticles have a high degree of stability (; ). Additionally, the method is economical, appropriate for biological use, and ecologically beneficial (; Yazdanian et al., 2022). Algae are particularly appealing for green synthesis among the different biological processes employed for manufacturing nanoparticles because of their versatility and usability. Furthermore, a lot of chemical constituents identified in algal extracts can serve various purposes, such as reducing and/or stabilizing agents for the biosynthesis of nanoparticles (; ; ).
Selenium has attracted increasing attention in recent years due to its critical role in maintaining good health (Rayman, 2020). Selenium is essential for the metabolism of thyroid hormones and other vital metabolic activities, as well as for healthy immune system functioning. By getting integrated into antioxidant enzymes, it additionally stops cell destruction caused by oxidative stress. Numerous dangerous disorders, including malignancy, cardiovascular, and inflammation-related conditions, have been associated with selenium inadequacy (Misra et al., 2015). Nevertheless, prolonged Se supplements or greater doses may be harmful (Misra et al., 2015; Rayman et al., 2018). SeNPs have come under the spotlight recently. Reports about their synthesis and use are ongoing (). Comparing both inorganic and organic forms of selenium, SeNPs' reported toxicity was lesser ().
The most common cancer in women’s world widely is breast cancer. It hits about 24.5% of all women around the world (). Breast cancer counts as the second cause of death among women (). Above one million new cases of breast cancer are identified worldwide yearly, according to the World Health Organization, establishing significant financial, emotional, and health-related consequences (; ).
In the context of breast cancer development, Notch has been identified as one of the leading drivers of cellular proliferation and cancer progression (). It has been reported for its ability to trigger cyclin expressions, hence increasing cellular division, as well as enhancing angiogenesis and suppressing apoptosis. There is entanglement between Notch and inflammatory mediator, NF-кB, which, in turn, activates the expression of other inflammatory mediators and vascular endothelial growth factor expression (; ).
Based on all the above-mentioned evidence, there is a great interest in recognizing the potential antitumor effect of Polycladia crinita. Solid Ehrlich carcinoma (SEC) is one of the models used for breast cancer investigation due to its similarity to undifferentiated solid mass with a rapid growth rate (). Therefore, this study is the first of its kind that aimed to uncover whether the Polycladia crinita extracts have potential anticarcinogenic activity and the possible underlying mechanisms using SEC as a tumor model.
2 Materials and methods
2.1 Materials
The chemicals were all of analytical purity and were acquired from Sigma Aldrich. For the manufacture of SeNPs, sodium selenite (Na2SeO4) was employed as a precursor.
2.2 Polycladia crinita biomass collection
Polycladia crinita, a brown algae, was collected off the shore of the Gulf of Suez in Egypt. An investigator from NIOF Egypt named Dr. Fekry Mourad identified the algae. Aleem’s methods (; Vikneshan et al., 2020) were followed to identify every sample, and the data indicated above had been confirmed on the Algae Base website ().
2.3 Polycladia crinita aqueous extract preparation
The biomass of Polycladia crinita was collected, rinsed with double-distilled water to get rid of any adhered particles and sludge, and then repeatedly washed with tap water to get rid of salt. After being washed and oven-dried for 15 min at 60°C, the samples were electric mixer-ground into fine dust. About 10 g of the algal powder was added to 100 mL of distilled water, well mixed, and heated to 60°C for 2 hours with a magnetic stirrer. After centrifuging the mixture for 10 min at 1,500 rpm (), the liquid that was produced was collected.
2.4 GC-MS analysis of Polycladia crinita aqueous extract
Polycladia crinita aqueous extract was subjected to Thermo Scientific TRACE 1310 Ga Chromatograph attached with ISQ LT single quadrupole Mass Spectrometer. GC-MS analysis was performed by injecting 1 μL of sample into the column DB5-MS, 30m; 0.25 mm ID (J&W Scientific) with helium as a carrier gas (Flow rate 1 mL/min). The program was as follows: 40°C (3 min) - 280°C (5 min) at 5°C/min, −290°C (1 min) at 7.5°C/min, detector temperature, 300°C, injector temperature: 200°C, and ionization voltage:70eV. Components were identified by comparing their mass spectra with those in the database of Wiley and Nist mass spectral database.
2.5 Polycladia crinita SeNPs (PCSeNPs) biosynthesis
The recovered liquid was used to reduce and stabilize SeNPs by combining the Polycladia crinita extract with 1 mM Na2Seo4 at a 1:9 ratio. The finished product’s color changed from light brown to an intense brown after being incubated in a dark, shaking environment for the whole night. This shift indicated the synthesis of PCSeNPs (). The resulting PCSeNPs were then produced by centrifugation at 10,000 rpm for 30 min, followed by a water wash, pure alcohol processing, heating to 50°C, storage in a sealed box, and use in any future assessments or study ().
2.6 Characterization of the synthesized Polycladia crinita SeNPs (PCSeNPs)
Using a UV-Vis spectrophotometer, the highest surface plasmon resonance (SPR) of the synthesized PCSeNPs was determined. Using a UV-Vis spectrophotometer (Thermo Scientific Evolution TM 300, Thermo Fisher Scientific, United States of America) to measure the absorbance spectra in the 200–800 nm region, PCSeNPs were found (). To analyze the sizes and forms of produced PCSeNPs, Transmission Electron Microscopy (TEM; JEM 2100, JEOL, Ltd., Tokyo, Japan) was employed ().
Scanning electron microscopy combined with energy-dispersive X-ray (SEM-EDX) (JSM 6490 LV, JEOL, Ltd., Tokyo, Japan) was used to analyze the PCSeNPs specimen’s elemental components (Wang et al., 2015). A 2θ degree range of 0°–80° was used to examine the X-ray diffraction (XRD) data using the XRD 6000 detector (Shimadzu Corp., Kyoto, Japan). The x-ray source was 2.2 KW Cu anode radiation, where k = 1.54184, and the operational conditions were voltage at 30 kV and current at 10 mA (Zhong et al., 2016).
2.7 In vitro study
2.7.1 Anticancer activity of P. crinita extract and PCSeNPs against breast cancer cell line (MDA-MB-231) by using the viability assay
The Breast cancer cell line (MDA-MB-231) cell line used in this study was obtained from the National Cancer Institute, Cairo, Egypt. Using corning 96-well tissue culture plates the tumor cells were suspended in the medium at a concentration of 5 × 104 cells/well and incubated in 37°C humid atmosphere with 5% carbon dioxide. Subsequent 48 h of exponential growth, the cells were incubated with Polycladia crinita extract and PCSeNPs at concentrations of 0, 3.13, 6.25, 12.5, 25 and 50 (µg ml−1, 48 h). After that, 10 µL of the 12 mM MTT stock solution (Vybrant® MTT Cell Proliferation Assay Kit, (V-13154)) was added to each well and incubated at 37°C for 4 h. Then, 50 µL of DMSO was added to each well, mixed thoroughly with the pipette, and incubated at 37°C for 10 min. The absorbance was read (540nm; microplate reader, ELx 800, Bio-Tek Instruments Inc., United States of America) (Mosmann, 1983). The inhibition value was determined using the following equation:
The rate of inhibition (%)=(A/B) × 100, where A represents the treated cell’s optical density and B the untreated cells. Furthermore, IC50 was computed by using GraphPad Prism software (San Diego, CA, United States).
2.7.2 Cell-cycle analysis
The breast cancer cell line (MDA-MB-231) cell-cycle distribution after treatment with P. crinita extract and PCSeNPs was analyzed using flow cytometric analysis on the IC50 concentrations detected by MTT assay. Following P. crinita extract and PCSeNPs stimulation of the cells, the culture media was carefully withdrawn, PBS was added, gently shaken, and then PBS was removed. One milliliter of trypsin was added, given a good shake, and allowed to digest in the incubator. Following digestion, the cells were taken out of the incubator and put in a 3 mL medium with serum to finish off the trypsin digestion. Using a pipette, the cells were resuspended and transferred to the centrifuge tube (Xie et al., 2017). Then 3 mL PBS resuspension cells were added, the supernatant was removed by spinning at 1,000 rpm at room temperature for 5 min, and the supernatant was removed by centrifugation at normal temperature for 5 minutes at 1,000 rpm. After adding 75% alcohol to revive the cells, they were kept overnight at 4°C in a refrigerator. Centrifuged at 1,000 rpm for 5 minutes at room temperature, then collected the supernatant, added PBS to wash three times, added PI staining solution, stained for 30 minutes at 37°C, and used flow cytometry to determine the cell cycle (BD Accuri™ C6 Plus Flow Cytometer) (Yakonov et al., 2021). Using Accuri™ C6 software (BD Biosciences) the percentage of cells in each cell cycle phase was determined.
2.8 In vivo study
2.8.1 Animals
Seventy female Swiss albino mice (weighing between 18 and 22 g and approximately 6–8 weeks of age) were obtained from the National Research Center (NRC) in Cairo, Egypt. Animals were kept for acclimatization (for 1 week) and supplied with filtered water and a standard pelleted diet (IBEX feed for research animals, Ibex International Co., Ltd., Cairo, Egypt). Animal handling was performed according to the guidelines for the care and use of laboratory animals approved by the research ethics committee of the Faculty of Pharmacy, Tanta University (TP/RE/11/22p-0064). To induce a tumor, the mice had been injected subcutaneously in the right flank with 1 × 106 live EAC cells (1 × 106 cells). A detectable solid tumor manifested after approximately 12 days (Shaheen and Fouda, 2018).
2.8.2 Experimental design
Mice bearing SEC were randomly allocated into six equal groups (n = 6). The animal care providers, the lab technicians, and the histopathology experts were blinded regarding which mouse received treatment and the nature of the treatment provided to the animals to avoid any biases. Group 1: Tumor control group, where mice received the vehicle, saline, group 2: mice were given free SeNPs, group 3: mice were given 25 mg/kg Polycladia crinita, group 4: mice were given 50 mg/kg Polycladia crinita, group 5: mice were given 25 mg/kg Polycladia crinita loaded on SeNPs, group 6: mice were given 50 mg/kg Polycladia crinita loaded on SeNPs. Doses were chosen based on a pilot study in addition to earlier studies on related species (Zhong et al., 2016; Siraj et al., 2021). Six intraperitoneal injections of each treatment were performed, commencing on the 12th day of SEC induction and continuing until the 28th day. Finally, all mice were euthanized, and the euthanasia was performed by cervical dislocation (CD) according to the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020 Edition). Tumors were extracted and divided into parts. One portion was preserved in 10% formalin for histopathological analysis, and the remaining portion was stored in a freezer at −80°C for additional biochemical investigations.
2.9 Measurement of survival rate
Throughout the study, the mice’s survival rate was tracked and reported using the Kaplan-Meier survival curve, which was calculated using the following formula: survival rate = number of surviving mice in a group/total number of mice during the experiment (28 days) after 1, 2, 3, and 4 weeks.
2.10 Tumor weight and volume
Tumor tissue was carefully removed after euthanasia and weighed with a precise electronic balance (ADAM®, UK). The tumor mass was measured using a Vernier digital caliper (Anyi Instrument Co., China) starting on the 12th day, and then day after day till the last day of the experiment. Then the tumor volume was calculated according to the formula: tumor volume (mm3) = 0.52 AB2, where A and B are the lengths of the minor and major axis lengths, respectively ().
2.11 Determination of VEGF, NF-кB, Notch-1, and cyclin D1 content
Enzyme-linked immunosorbent assay (ELISA) kits were purchased from Abcam and Glory Science Co. to determine the levels of VEGF and NF-кB in tumor tissues. The instructions were followed exactly as directed by the manufacturer. Also, Notch-1 and Cyclin D1 were evaluated via ELISA kits obtained from RayBiotech according to manufacturer protocol.
2.12 Determination of caspase 3, caspase 9, notch 1, cyclin D1, NF-кB, IL-6 and VEGF genes expression
The relative gene expression of caspase 3, caspase 9, Notch 1, Cyclin D1, NF-кB, IL-6, and VEGF was evaluated by qRT-PCR employing GAPDH as a housekeeping gene. The sequences of primers are listed in Table 1. The extraction of total RNA was achieved using TRIzol reagent (15,596,026) (Life Technologies, United States).
TABLE 1
| Gene | Primers sequence (5′–3′) | References |
|---|---|---|
| Caspase 3 | F: GGAGTCTGACTGGAAAGCCGAA | Casp3 Mouse qPCR Primer Pair (NM_009810), MP201794, OriGene Technologies, Inc |
| R: CTTCTGGCAAGCCATCTCCTCA | ||
| Caspase 9 | F: GCTGTGTCAAGTTTGCCTACCC | Casp9 Mouse qPCR Primer Pair (NM_015733), MP201800, OriGene Technologies, Inc |
| R: CCAGAATGCCATCCAAGGTCTC | ||
| Notch 1a | F: TCAATGCCGTGGATGACCTA | Notch1 Mouse qPCR Primer Pair (NM_008714), MP209021, OriGene Technologies, Inc |
| R: CCTTGTTGGCTCCGTTCTTC | ||
| Cyclin D1 | F: GCAGAAGGAGATTGTGCCATCC | Ccnd1 Mouse qPCR Primer Pair (NM_007631), MP203092, OriGene Technologies, Inc |
| R: AGGAAGCGGTCCAGGTAGTTCA | ||
| NF-кBa | F: AGCGGGAACTGAGTGAGATGA | Zhang et al. (2022) |
| R: GCACCCAGGTTGTATCGGG | ||
| IL-6a | F: TACCACTTCACAAGTCGGAGGC | IL-6 Mouse qPCR Primer Pair (NM_031168), MP206798, OriGene Technologies, Inc |
| R: CTGCAAGTGCATCATCGTTGTTC | ||
| VEGFa | F: GTC ACT ATG CAG ATC ATG CGG A | |
| R: GTC ACT ATG CAG ATC ATG CGGA | ||
| GAPDHa | F: CATCACTGCCACCCAGAAGACTG | Gapdh Mouse qPCR Primer Pair (NM_008084), MP205604 OriGene Technologies, Inc |
| R: ATGCCAGTGAGCTTCCCGTTCAG |
Primers sequence.
Notch 1: Neurogenic locus notch homolog protein 1; NF-кB: Nuclear factor kappa B; IL-6: Interleukin 6; VEGF: vascular endothelial growth factor; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase.
The reverse transcription process was performed by QuantiTects Reverse transcription kit (Qiagen, United States). The reaction mixtures consisted of complementary DNA amplicons, primers, and Syber green master mix (Maxima SYBR Green/qPCR Master Mix, Thermo Fisher Scientific, United States). The Livak method was employed to compute the fold change in the gene expression in comparison to the control group (calibrator) ().
2.13 Histopathological examination
Sections of tumor tissue were arranged (3–5 µm thick) and stained with hematoxylin and eosin (H&E). The characteristic histopathological features were examined under light microscopy. Necrosis was graded using a scale of 1–4 points as follows: 0 indicates absence, 1 (0%–20%), 2 moderate (21%–50%), 3 marked (51%–80%), and 4 indicates a diffuse pattern, which indicates the most severe degree (81%–100%) ().
2.14 Immunohistochemical examination
The immunohistochemical staining procedure was used according to (Saber et al., 2019), for antigen retrieval, dewaxed sections were put in a citric acid buffer solution of 0.05 M, pH 6.8. The sections were then treated with 0.3% H2O2 and protein block. After that, incubated with Bax antibody (Santa Cruz, Cat: sc-7480, 1:100 dilution), caspase-3 polyclonal antibodies (Invitrogen, Cat: PA5-77887, dilution 1/100), p53 antibody (Santa Cruz, Cat: sc-126, 1:100 dilution), Bcl-2 antibody (Santa Cruz, Cat: sc-7382, 1:100 dilution), COX-2 antibody (Santa Cruz, Cat: sc-19999, 1:100 dilution), and Ki-67 (Santa Cruz, Cat: sc-23900, 1:100 dilution). Then for 30 min at 37°C with a secondary antibody linked to horseradish peroxidase. Following each process, phosphate buffer saline was applied to the slides three times. Sections were exposed for 3 min to the 3,3′-diaminobenzidine tetrahydrochloride reagent. Finally, slides were counterstained with Mayer’s hematoxylin, washed with distilled water, and mounted with DPX.
Using a digital camera attached to a microscope (Olympus CX21, Japan), slides were inspected under a microscope, and digital micrographs were taken. By using ImageJ software; version 1.54 D, Java 1.8.0_354, Positive expressions of staining intensity were measured and presented as a percentage of positive area per 6 high power fields.
2.15 Statistics
Employing the SPSS 25 software, the data were analyzed by ANOVA followed by LSD post hoc test. The data are expressed as the means ± SD and the statistical significance was set at p < 0.05.
3 Results
3.1 GC-MS analysis of Polycladia crinita extract
The GC-MS chromatogram (Figure 1A) demonstrated different bioactive compounds, counting 4-octadecenoic acid, methyl ester (66.13%), Tetradecanoic acid (60.57%), n-Hexadecenoic acid (45.66%), Octadecenoic acid (45.47%), Hexadecanoic acid, methyl ester (38.5%), Trans-13-Octadecenoic Acid (35.11%), Cis-13-Octadecenoic acid (15.88%) and Doconexent (14.68%). In addition, many other components were found and their bioactive properties are listed in Table 2.
FIGURE 1
TABLE 2
| RTa | Compound name | PAa % | MFa | MWa | Biological activity |
|---|---|---|---|---|---|
| 9.79 | Tetradecanoic acid | 8.56 | C14H28O2 | 228 | Fatty acids, antioxidant activity, and antimicrobial |
| 10.87 | Phytol | 0.69 | C20H40O | 296 | Precursor for the manufacture of synthetic forms of vitamin E and vitamin K1 |
| 10.95 | 2-Pentadecanone, 6,10,14 trimethyl | 1.43 | C18H36O | 268 | Essential oil, antioxidant activity, antimicrobial and anti-inflammation |
| 11.64 | Cyclohexanecarboxylic acid, hexadecyl ester | 2.18 | C24H46O2 | 366 | Antimicrobial |
| 12.16 | 1-Hexadecanol, 2-methyl | 0.72 | C17H36O6 | 256 | Fatty acids, antioxidant activity, and antimicrobial |
| 12.42 | Hexadecanoic acid, methyl ester | 5.93 | C17H34O2 | 270 | Fatty acids, antioxidant activity, and antimicrobial |
| 12.77 | R-Limonene | 0.62 | C10H16O3 | 184 | Antioxidant activity |
| 13.09 | Trans-13-Octadecenoic acid | 2.06 | C18H34O2 | 282 | Fatty acids, antioxidant activity, and antimicrobial |
| 13.57 | n-Hexadecenoic acid | 43.80 | C16H32O2 | 256 | |
| 15.36 | 9-Hexadecenoic acid | 0.97 | C16H30O2 | 254 | |
| 15.65 | 4-Octadecenoic acid, methyl ester | 2.98 | C19H36O2 | 296 | |
| 16.04 | Octadec-9-enoic acid | 0.61 | C18H34O2 | 282 | |
| 16.68 | Cis-13-Octadecenoic acid | 13.52 | C18H34O2 | 282 | |
| 17.03 | Octadecenoic acid | 2.52 | C18H36O2 | 284 | |
| 17.34 | Oleic Acid | 1.13 | C18H36O2 | 282 | Fatty acids, antioxidant activity, lower cholesterol, antimicrobial, and anticancer |
| 18.85 | Cis-5,8,11,14,17-Eicosapentaenoic acid | 0.67 | C20H30O2 | 302 | Synthesized from the essential fatty acid alpha-linolenic acid, regular heartbeat, and pumping function, and lessen blood clots |
| 19.97 | Fenretinide | 1.01 | C26H33NO2 | 391 | Retinoid derivative inhibits the growth of several human cancer cell lines |
| 22.05 | Falcarinol | 0.66 | C17H24O | 244 | Antimicrobial |
| 23.25 | Doconexent | 1.07 | C22H32O2 | 328 | Omega-3 fatty acid, Reduces triglycerides, is an anti-inflammatory, vasodilating, anti-arrhythmic, antioxidant, and inhibits the development and division of cancer cells as well as their ability to create new blood vessels |
| 27.93 | 4,7,10,13,16,19-Docosahexaenoic acid, methyl ester | 0.52 | C23H34O2 | 342 | Fatty acids, antioxidant activity |
GC-MS analysis of Polycladia crinita extract.
RT: retention time; PA: peak area; MF: molecular formula; MW: Molecular weight. The biological activities of different compounds were driven from the PubChem database website https://pubchem.ncbi.nlm.nih.gov/
3.2 Characterization of Polycladia crinita selenium nanoparticles (PCSeNPs)
The solution was light brown at the start of the synthesis procedure and did not alter in color. When the liquid turned dark brown after 48 h of reaction, it was visually confirmed that the sodium selenite had been reduced.
3.3 Transmission electron microscopy (TEM)
The smooth, spherical-shaped selenium nanoparticles produced by P. crinita extract’s reducing power for sodium selenite are visible in the TEM picture (Figure 1B). The selenium nanoparticles have a packed backdrop and range in size from 8.72 to 38.26 nm on average.
3.4 Scanning electron microscopy (SEM)
The formation of selenium nanostructures was further illustrated by the SEM picture showing the high-density selenium nanoparticles produced by processing P. crinita extract (Figure 1C). The selenium nanoparticles appear to range in average mean size from 17.06 to 30.01 nm.
3.5 Energy-dispersive X-ray analysis
The components and atomic content of PCSeNPs were determined using the energy-dispersive X-ray spectrometer (Figure 1D). Upon analyzing the EDX spectrum, it was determined that the mass percent of selenium was 0.26 ± 0.07, while the mass percents of oxygen and carbon were found to be the highest at 46.31 ± 0.4 and 39.96 ± 0.02, respectively. This confirms the formation of selenium nanoparticles along with the presence of numerous other elements derived from the components of the P. crinita extract, such as Mg, S, K, P, Al, Si, and Ca.
3.6 X-ray diffraction analysis
The crystallinity of phyco-synthesized SeNPs was assessed using the XRD pattern. Noisy backgrounds were shown by the data shown in (Figure 1E).
3.7 In vitro anticancer activity of free Polycladia crinita extract and PCSeNPs assessed using the viability assay against breast cancer cell line (MDA-MB-231)
Table 3 and Table 4 presented the inhibitory effect of free P. crinita extract and PCSeNPs on breast cancer cell line (MDA-MB-231) with IC50 = 45.33 ± 3.37 μg/mL and 20.62 ± 1.41 μg/mL, respectively. free P. crinita extract was used at concentrations of 0–50 μg/mL, the lowermost concentration (3.13 μg/mL) recorded the highest viability of 91.69% ± 0.82% and lower inhibition effect of 8.31% ± 0.12%, however with the highest inhibition of 52.9% ± 0.93% recorded at the highest concentration of free P. crinita extract (50 μg/mL) (Table 3).
TABLE 3
| Free P. crinita extract concentration (µg/mL) | Viability (%) | Inhibition (%) |
|---|---|---|
| 0 | 100 | 0 |
| 3.13 | 91.69 ± 0.82 | 8.31 ± 0.12 |
| 6.25 | 77.26 ± 0.77 | 22.74 ± 0.24 |
| 12.5 | 65.12 ± 0.55 | 34.89 ± 0.42 |
| 25 | 60.36 ± 0.75 | 39.63 ± 0.52 |
| 50 | 47.11 ± 0.32 | 52.9 ± 0.93 |
Activity of free Polycladia crinita extract against breast cancer cell line (MDA-MB-231, incubation for 48 h) with IC50 = 45.33 ± 3.37 μg/mL.
Data are expressed as mean ± SD, n = 3.
TABLE 4
| PCSeNPs concentration (µg/ml | Viability (%) | Inhibition (%) |
|---|---|---|
| 0 | 100 | 0 |
| 3.13 | 86.50±0.62 | 13.5±0.22 |
| 6.25 | 73.67±0.31 | 26.39±0.15 |
| 12.5 | 60.2±0.25 | 39.8±0.35 |
| 25 | 46.54±0.39 | 53.45±0.38 |
| 50 | 34.42±0.42 | 65.57±1.05 |
Activity of PCSeNPs against breast cancer cell line (MDA-MB-231, incubation for 48 h) with IC50 = 20.62 ± 1.41 μg/mL.
Data are expressed as mean ±SD, n=3.
In the same context, PCSeNPs were used also at concentrations of 0–50 μg/mL and the lowest concentration (3.13 μg/mL) recorded the highest viability of 86.50% ± 0.62% and lower inhibition effect of 13.5% ± 0.22%, while with the highest inhibition of 65.57% ± 1.05% recorded at the highest PCSeNPs (50 μg/mL) (Table 4).
3.8 In vitro cell cycle analysis of free Polycladia crinita extract and PCSeNPs using flow cytometry
The cell cycle analysis of free P. crinita extract and PCSeNPs using flow cytometry is shown in Figure 2 (A, B, and C), in different cell cycle phases (G0/G1, S, and G2/M). Treatment with free P. crinita extract indicated G2/M phase cell cycle arrest from 43.6% in untreated cells to 26.5% in the treated cells. In the same context, cells treated with PCSeNPs showed sharp G2/M phase cell cycle arrest from 43.6% in untreated cells to 3.6% in the treated cells.
FIGURE 2
3.9 Polycladia crinita SeNPs effect on survival rate and tumor weight
Mice survival rate was tracked during the experiment and reported using the Kaplan-Meier survival curve. Treatments with a high dose of the free extract showed a 22.39% increase in the survival rate, while the SeNPs loaded extract, with a higher dose, exhibited an increase of survival by 49.3%, compared to the tumor control (untreated) group at the end of the experiment (Figure 3A).
FIGURE 3
Regarding the tumor weight changes between different treated groups, the free P. crinita extract (25, 50 mg/kg) decreased, significantly, the tumor weight, compared to a tumor control group (39.7% and 52.6%, respectively). Additionally, SeNPs loaded with P. crinita extract revealed a remarkable decrease in tumor weight (58.9% and 71.5%, respectively) compared with a tumor control group. Tumor weights in a group of 50 mg/kg P. crinita selenium nanoparticles (PCSeNPs) were significantly reduced (39.9%), relative to the 50 mg/kg P. crinita group (Figure 3B).
3.10 Polycladia crinita SeNPs effect on tumor volume
The tumor volume of the untreated mice showed a gradual increase from day 12 until day 28, with a volume equal to 2,104.3 mm3. On the other hand, treating mice with the free P. crinita extract (25, 50 mg/kg) significantly decreased the tumor volume (35.6%, and 43.5%, respectively), compared to a tumor control group. Likewise, the SeNPs loaded P. crinita extract (25, 50 mg/kg) showed a significant suppression (56.03%, and 64.2%, respectively) compared to the untreated group (Figure 3C).
3.11 Polycladia crinita SeNPs effect on VEGF, NF-кB, notch 1, and cyclin D1 content
Figure 4 (A, B, C, and D) shows the effect of different treatments on the protein level of VEGF, NF-кB, Notch 1, and Cyclin D1 in tumor tissue. Groups of free P. crinita extract (25, 50 mg/kg) showed a profound decrease in VEGF protein levels (35.9% and 57.7%, respectively), compared to a tumor control group. Furthermore, groups SeNPs loaded with P. crinita extract (25, 50 mg/kg) significantly, suppressed VEGF protein levels (57.6% and 74.6%, respectively) relative to a tumor control group (Figure 4A).
FIGURE 4
Treating mice bearing SEC with free P. crinita extract (25, 50 mg/kg) revealed a sustainable decrease in NF-кB protein values (31.8% and 56.5%, respectively), following the tumor control group. Additionally, groups SeNPs loaded P. crinita extract (25, 50 mg/kg) revealed a more significant decrease in the NF-кB levels (54.3% and 76.8%), in comparison with untreated SEC-mice (tumor control group) (Figure 4B).
In the same context, Treating mice bearing SEC with free P. crinita extract (25, 50 mg/kg) revealed a sustainable decrease in Notch 1 protein values (18.4% and 51.6%, respectively), following the tumor control group. Also, groups SeNPs loaded P. crinita extract (25, 50 mg/kg) revealed a more significant decrease in the Notch 1 levels (59.7% and 68.7%), in comparison with untreated SEC-mice (tumor control group) (Figure 4C).
Furthermore, Treating mice bearing SEC with free P. crinita extract (25, 50 mg/kg) revealed a sustainable decrease in Cyclin D1 protein values (31.5% and 52.3%, respectively), following the tumor control group. In addition, groups SeNPs loaded P. crinita extract (25, 50 mg/kg) revealed a more significant decrease in the Cyclin D1 levels (54.7% and 80.8%), in comparison with untreated SEC-mice (tumor control group) (Figure 4D).
3.12 Polycladia crinita SeNPs effect on caspase 3, caspase 9, notch 1, cyclin D1, NF-кB, IL-6 and VEGF gene expression
Treating mice with P. crinita free extract (25, 50 mg/kg), revealed a remarkable enhancement in the caspase 3 gene expression (19.35%, and 33.77%, respectively) related to a tumor control group. Additionally, mice that received the SeNPs loaded with P. crinita free extract doses showed a significant increase (73%, and 90%, respectively), in comparison with the tumor control (Figure 5A).
FIGURE 5
Mice treated with P. crinita free extract (25, 50 mg/kg), exposed a significant improvement in the caspase 9 gene expression (40%, and 60%, respectively) related to a tumor control group. Additionally, mice that received the SeNPs loaded with P. crinita free extract doses showed a significant rise (100%, and 150%, respectively), in comparison with the tumor control (Figure 5B).
Regarding the gene expression of Notch1, P. crinita free extract (25, 50 mg/kg) groups significantly suppressed the change by (19.61%, and 48.04%, respectively), as relative to a tumor control group. Similarly, groups of SeNPs loaded with P. crinita extract (25, 50 mg/kg) showed Notch1 expression lessened (56.4% and 72.3%, %, respectively) when compared with a tumor control group (Figure 5C). In the context, cyclin D1 gene expression decreased after treatments with P. crinita free extract (25, 50 mg/kg) and SeNPs loaded P. crinita extract (25, 50 mg/kg) by (13, 35, 50, and 71% decrease, respectively), compared to a tumor control group (Figure 5D).
Additionally, P. crinita free extract (25, 50 mg/kg), showed a significant decrease in the NF-кB gene expression (26.36%, and 41%, respectively) related to a tumor control group. Additionally, mice that received the SeNPs loaded with P. crinita free extract doses showed a significant increase (57%, and 81%, respectively), in comparison with the tumor control (Figure 5E).
Likewise, P. crinita free extract (25, 50 mg/kg), revealed a notable decrease in the IL-6 gene expression (10%, and 20%, respectively) related to a tumor control group. Additionally, mice that received the SeNPs loaded with P. crinita free extract doses showed a significant increase (40%, and 70%, respectively), in comparison with the tumor control (Figure 5F).
Furthermore, Likewise, P. crinita free extract (25, 50 mg/kg), exposed a remarkable decrease in the VEGF gene expression (36.4%, and 54.5%, respectively) related to a tumor control group. Additionally, mice that received the SeNPs loaded with P. crinita free extract doses showed a significant increase (63.6%, and 81.8%, respectively), in comparison with the tumor control (Figure 5G).
The SeNPs formulations loaded with P. crinita free extract showed significantly more effectiveness than similar doses of free extract in all gene expression (caspase 3, caspase 9, Notch 1, Cyclin D1, NF-кB, IL-6, and VEGF).
3.13 Histopathological evaluation
The untreated mice showed sheets of malignant cells, many tumor giant cells with a mild area of necrosis grade 1, and mild lymphocytic infiltrate. On the other hand, treated groups showed enhancement in the histopathological changes with increased necrotic grades (Figure 6). In the same context, the necrotic area (%) was assessed in H&E and showed induction in all treated groups (Figure 6), especially with a high dose of SeNPs loaded with P. crinita free extract.
FIGURE 6
3.14 Immunohistochemical evaluation
Immunohistochemical staining for the inflammation marker (COX-2), Proliferation marker (Ki-67), and antiapoptotic marker (Bcl-2) showed intense staining in the tumor control group. On the other hand, different treatments showed a significant reduction in immunoreactivity as compared to the tumor control group (Figures 7A–C). Otherwise, apoptotic markers (caspase 3, BAX, and P53) showed a significant decline in immunoreactivity in the tumor control group, while, showed a significant strong in immunoreactivity appeared with different treatments as compared to the tumor control group (Figures 7D–F).
FIGURE 7
4 Discussion
Since Polycladia crinita is recognized as a treasure of promising bioactive compounds selenium nanoparticles show low toxicity and high biocompatibility (Shaheen and Fouda, 2018; Soliman et al., 2021). Additionally, the promising antioxidant and cytotoxic activities along with the unique physicochemical properties and kinetic stability of nano-emulsion compared to its bulk materials have directed us to investigate the possibility of using nano-emulsion as an alternative, used with low or no toxic side effects, anticancer agent for the traditional chemotherapeutics (Menon et al., 2018). The current study was conducted to evaluate the potential in vitro and in vivo the potential anti-cancer effect of polycladia crinita, as a free extract or SeNPs-loaded one. Polycladia crinita extract revealed the existence of many bioactive components such as 4-octadecenoic acid-methyl ester, tetradecanoic acid, and n-Hexadecenoic acid using GC-MS analysis. These compounds were mainly characterized as fatty acids (FA) (). Fatty acids have many beneficial effects on human health (; Serini et al., 2009; Wall et al., 2010; ; ). The biosynthesized PCSeNPs were characterized by various analytical procedures, like SEM, TEM, EDX, and XRD.
The free P. crinita extract and PCSeNPs have antitumor activity and sharp G2/M phase cell cycle arrest against the breast cancer cell line (MDA-MB-231) with special remarkably to PCSeNPs. However, there is still more to learn about the SeNPs anticancer mechanism. Nonetheless, several writers highlight the various effects of selenium nanoparticles (SeNPs) on cancer cells, including their penetration, inhibition of certain cancer-induced enzymes like EGFR, regulation of ROS production, induction of autophagy, and stimulation of cancer cell apoptosis (; ).
Here, injecting EAC cells in mice created solid tumors that increased in volume within the subsequent 2 weeks. The untreated mice developed a solid tumor that gradually increased in size and weight till the end of the experiment, which was consistent with previous research (Roelofs et al., 2014). Also, these mice showed histopathological findings revealing solid sheets of malignant cells and many tumor giant cells (). On the other side, upon receiving Polycladia crinita, either free extract or SeNPs loaded one, distinctly suppressed tumor volume and weight parallel with enhancing the animals’ survival rate. Similarly, an earlier study speculated the inhibitory effect of Polycladia myrica against cancer cells (Wang B. et al., 2012). Supporting the aforementioned findings, the histopathological examination showed shadows of necrotizing cells.
In the current study, the positive control group showed a highly expressed Ki-67 protein, an effect that was counteracted by Polycladia extract either free or nanoformulated. Our data were in line with a previously conducted study, where Ki-67 expression was profoundly inhibited after oleic acid treatment of colon cancer (). Given the presence of oleic acid as a component of Polycladia Crinita, herein, this may give a possible explanation for the effect of Polycladia on Ki-67 tissue expression. Ki-67 is frequently utilized as a proliferation marker for breast cancer since it is significantly connected with tumor cell proliferation and expansion. Also, malignant tissues with poorly differentiated tumor cells have much increased Ki-67 expression when compared to normal tissue (Wang et al., 2015; ).
Vascular endothelial growth factor (VEGF) is a master regulator of angiogenesis that is required for the viability and ruthless growth of solid tumors like breast cancer (). In breast cancer cells, there is an imbalance between angiogenesis and apoptosis (). Herein, treating SEC-bearing mice with the algae extract profoundly suppressed VEGF expression, and hence angiogenesis. Notably, the SeNPs loaded formulation showed the upper hand, in decreasing VEGF expression, over the same dose of free extract. The possible explanation here is the presence of fenretinide in Polycladia characterization, which showed in earlier studies an inhibitory effect on VEGF (Sogno et al., 2010).
Nuclear factor kappa B (NF-кB) is a transcription factor, which upon activation by ROS; regulates different processes such as pro-inflammatory, proliferation, apoptosis, and survival by mediating the expression of several molecules including cytokines (IL-6, COX-2,. etc.) (Serini et al., 2009). Thus, it has been introduced as a main target in controlling tumor growth (). In the current study, free and SeNPs loaded extract of Polycladia crinita profoundly decreased NF-ҡB expression, which might be explained by the ability of the algae to inhibit oxidative stress. These findings were confirmed by (Shaheen and Fouda, 2018), who stated the antioxidative effect of Polycladia myrica in the liver. Interestingly, the SeNPs loaded dose proved a preferable effect compared with the counterpart dose of the free extract (Menon et al., 2018), similarly (), stated that nanoformulation was superior to the free ones.
Cyclooxygenases (COXs) are crucial regulators of cell proliferation, through transforming free arachidonic acid into prostaglandin-H2 (Mukherjee et al., 2001), a precursor of other prostaglandins, which participate in immunological response, inflammation, apoptosis, and angiogenesis, all of which aid in the onset or development of cancer (Poinern, 2014). A key player in the emergence of epithelial cell carcinoma and metastasis is the inducible enzyme COX-2 (Salem and Fouda, 2021). COX-2-positive tumors are more likely to have a poorer prognosis and to be more aggressive, so many types of cancer may be controlled by selectively inhibiting COX-2 expression (Salem and Fouda, 2021). The synthesis of COX-2 is significantly regulated by the abundant and inducible cell transcription factor NF-ҡB (Vikneshan et al., 2020). Herein, COX2 expression was increased in the untreated group, while dosing mice with free or nano-loaded extracts exhibited a notable decrease in COX2 protein. Our earlier study was in agreement, where Polycladia imposed a profound suppression of COX2 expression in Carrageenan-induced paw edema (Siddiqui et al., 2011).
Apoptosis is defined as programmed cell death that, by removing unstable cells, maintains tissue stability. Caspase 3, caspase 9, P53, and BAX are the main players in the context of activating the apoptotic cascades and Bcl2 is an antiapoptotic mediator. In cancer, apoptosis is downregulated, and cell growth is increased, which drives both tumor proliferation and growth (Zhong et al., 2016). The present results confirmed this, as presented by the continuing increase of the tumor volume in the untreated group. Additionally, this group exhibited a weak gene expression of caspase 3, BAX, and p53 and strong Bcl2 expression. Treating mice with P. crinita-free extract and PCSeNPs proved its anti-proliferative action by significantly enhancing BAX, p53, and Caspase3 gene expression along with decreasing Bcl2 immunostaining expression. Research that was in agreement with ours regarding the effect of brown algae on cancer p53 expression, a study showed that Polycladia Myrica has significantly lowered p53 expression in MCF7 breast cancer cells ().
It was discovered that the expression of p53 and Ki-67 are associated with breast cancer (). It is yet unclear how p53 may impact the expression of the Ki-67 gene. Given that the Ki-67 promoter has three Sp1-binding sites and p53 reduces the transcription of genes at promoters that include Sp1-binding sites (; ). It is most probable that p53 decreases K-i67 promoter activity through Sp1-and p53-dependent pathways. There are thought to be at least two processes that control transcription. One is that the transcriptional suppression of the Ki67 promoter is impacted by the p53-binding motifs. The second involves a potential p53-Sp1 interaction at Sp1-binding sites on the Ki67 promoter.
In the present work, the tumor tissue from mice groups that received treatments manifested a significant suppression in Notch 1 gene expression and a significant decrease in NF-кB levels, an effect that was supported by previously mentioned literature, where Notch acts a vital player in multiple cellular processes including apoptosis, proliferation, and angiogenesis. In breast cancer, the Notch 1 pathway is upregulated and highly correlated with aggressiveness (). Moreover, Notch activation boosts NF-КB activity, and hence cell proliferation is improved. Remarkably, VEGF and Notch1 dynamically interact at the cellular level to control the tumor’s ability to grow and regenerate, limitlessly (Zhong et al., 2016).
The mentioned interplay between Notch1, NF-кB, and VEGF strongly presents them as distinguished targets in constricting cancer cell overgrowth and explains, logically, the concurrent increase or decrease (as in Polycladia Crinita treated groups) of these three mediators in the present study. It is worth mentioning that, to our best knowledge, this study is the first to investigate the Polycladia effect on notch1 expression in breast cancer.
Cyclin D1 is a well-known protooncogen whose upregulation means more progressive cancer. It acts as a cell cycle regulatory protein, which is considered one of the downstream targets of the Notch pathway in many cancers such as lung and breast ones. It is worth mentioning that NF-КB is a main mediator of cyclin D1 activity (; ). The current study revealed that the untreated mice showed highly expressed cyclin D while treatment with algae extracts profoundly inhibited cyclin D1 expression. A possible explanation could be the appearance of oleic acid, in our characterization, which was proven earlier as a defeater of hepatocellular carcinoma progression through mediating cyclin D1 expression (). To our best knowledge, this study is the first to study the effect of Polycladia crinita on breast cancer growth and the related drooping of the underlying mediators VEGF, Notch 1, NF-кB, IL-6, Cyclin D1, Caspase 9 and Caspase 3.
5 Conclusion
To the best of our knowledge, this study is the first to study the effect of Polycladia crinita on breast cancer growth and the related drooping of the underlying mediators VEGF, Notch 1, NF-кB, IL-6, cyclin D1, caspase 9 and caspase 3. Polycladia crinita extract, either free or SeNPs, exhibited an antitumoral effect against breast cancer cells of SEC mice, with the nano-formulation having the advantage of exerting a more significant impact above the free extract rival. The Polycladia crinita extract mediated its promising anticancerous action by enhancing apoptosis and mitigating inflammation via VEGF, Notch 1, NF-кB, IL-6, Cyclin D1, Caspase 9 and Caspase 3 expression/level, which manifested in promoting the total survival rate and the tumor volume decrease.
Statements
Data availability statement
The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.
Ethics statement
The animal study was approved by The study was conducted in accordance with the Declaration of Helsinki, and approved by the Research Ethics Committee of the Faculty of Pharmacy, Tanta University (REC-TP code: TP/RE/11/22p-0064). The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
BA: Formal Analysis, Funding acquisition, Investigation, Resources, Validation, Visualization, Writing–review and editing. TE-M: Conceptualization, Formal Analysis, Investigation, Resources, Validation, Visualization, Writing–review and editing. HS: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Resources, Validation, Visualization, Writing–original draft, Writing–review and editing. ME-B: Conceptualization, Formal Analysis, Investigation, Resources, Validation, Visualization, Writing–original draft, Writing–review and editing. ME-S: Formal Analysis, Investigation, Resources, Validation, Visualization, Writing–review and editing. MM: Formal Analysis, Investigation, Resources, Validation, Visualization, Writing–review and editing. ME-N: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Resources, Validation, Visualization, Writing–original draft, Writing–review and editing.
Acknowledgments
The authors extend their appreciation to the Deputyship for Research & Innovation, Ministry of Education in Saudi Arabia for funding this research work through the project number RI-44-0771.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
Abo-NeimaS. E.AhmedA. A.El-SheekhM.MakhlofM. E. M. (2023). Polycladia myrica-based delivery of selenium nanoparticles in combination with radiotherapy induces potent in vitro antiviral and in vivo anticancer activities against Ehrlich ascites tumor. Front. Mol. Biosci.12 (10), 1120422. 10.3389/fmolb.2023.1120422
2
AdhikariU.MateuC. G.ChattopadhyayK.PujolC. A.DamonteE. B.RayB. (2006). Structure and antiviral activity of sulfated fucans from Stoechospermum marginatum. Phytochemistry67 (22), 2474–2482. 10.1016/j.phytochem.2006.05.024
3
AkinteluS. A.OlugbekoS. C.FolorunsoA. S. (2020). A review on synthesis, optimization, characterization and antibacterial application of gold nanoparticles synthesized from plants. Int. Nano Lett.10 (4), 237–248. 10.1007/s40089-020-00317-7
4
AldubayanM. A.ElgharabawyR. M.AhmedA. S.ToussonE. (2019). Antineoplastic activity and curative role of avenanthramides against the growth of Ehrlich solid tumors in mice. Oxid. Med. Cell Longev.2019, 5162687. 10.1155/2019/5162687
5
AleemA. A. (1978). Contribution to the study of the marine algae of the red sea. The algae in the neighborhood of al−Ghardaqa, Egypt (cyanophyceae, chlorophyceae, and Phaeophyceae). Egypt: Boll Fac Sci King Abdulaziz University, 73–88.
6
AlmurshediA. S.El-MasryT. A.SelimH.El-SheekhM. M.MakhlofM. E. M.AldosariB. N.et al (2023). New investigation of anti-inflammatory activity of Polycladia crinita and biosynthesized selenium nanoparticles: isolation and characterization. Microb. Cell Factories22 (1), 173. 10.1186/s12934-023-02168-1
7
AminA. H.El-MissiryM. A.OthmanA. I.AliD. A.GouidaM. S.IsmailA. H. (2019). Ameliorative effects of melatonin against solid Ehrlich carcinoma progression in female mice. J. Pineal Res.67 (2), e12585. 10.1111/jpi.12585
8
AsokapandianS.SreelakshmiS.RajamanickamG. (2021). “Lipids and oils: an overview,” in Food Biopolymers: structural, functional, and nutraceutical properties. Editors GaniA.AshwarB. A. (Cham: Springer). 10.1007/978-3-030-27061-2_16
9
Badr El-dinN. K.ShabanaS. M.AbdulmajeedB. A.GhoneumM. (2020). A novel kefir product (PFT) inhibits Ehrlich ascites carcinoma in mice via induction of apoptosis and immunomodulation. BMC Complement. Med. Ther.20 (1), 127. 10.1186/s12906-020-02901-y
10
BhattacharjeeA.BasuA.BhattacharyaS. (2019). Selenium nanoparticles are less toxic than inorganic and organic selenium to mice in vivo. Nucleus62 (3), 259–268. 10.1007/s13237-019-00303-1
11
BhosaleS. H.NagleV. L.JagtapT. G. (2002). Antifouling potential of some marine organisms from India against species of Bacillus and Pseudomonas. Mar. Biotechnol. (NY)4 (2), 111–118. 10.1007/s10126-001-0087-1
12
BiJ.ChenC.SunP.TanH.FengF.ShenJ. (2019). Neuroprotective effect of omega-3 fatty acids on spinal cord injury-induced rats. Brain Behav.9 (8), e01339. 10.1002/brb3.1339
13
BukowskiK.KciukM.KontekR. (2020). Mechanisms of multidrug resistance in cancer chemotherapy. Int. J. Mol. Sci.21 (9), 3233. 10.3390/ijms21093233
14
CasulaM.SorannaD.CatapanoA. L.CorraoG. (2013). Long-term effect of high dose omega-3 fatty acid supplementation for secondary prevention of cardiovascular outcomes: a meta-analysis of randomized, placebo controlled trials [corrected]. Atheroscler. Suppl.14 (2), 243–251. 10.1016/S1567-5688(13)70005-9
15
ChenX. Y.ZhaoX.WangG. X. (2020). Review on marine carbohydrate-based gold nanoparticles represented by alginate and chitosan for biomedical application. Carbohydr. Polym.244, 116311. 10.1016/j.carbpol.2020.116311
16
CorsoC. R.StippM. C.AdamiE. R.da SilvaL. M.MariottM.de AndradeS. F.et al (2019). Salvia lachnostachys Benth has Antitumor and chemopreventive effects against solid Ehrlich carcinoma. Mol. Biol. Rep.46 (5), 4827–4841. 10.1007/s11033-019-04931-3
17
DattaD.Das DeepakK. S.ProgressB. (2022). Progress in the synthesis, characterisation, property enhancement techniques and application of gold nanoparticles: a review. Commun12 (5), 700–715. 10.1557/s43579-022-00216-2
18
DengB.KongW.SuoH.ShenX.NewtonM. A.BurkettW. C.et al (2023). Oleic acid exhibits anti-proliferative and anti-invasive activities via the PTEN/AKT/mTOR pathway in endometrial cancer. Cancers (Basel)15 (22), 5407. 10.3390/cancers15225407
19
DidžiapetrienėJ.KazbarienėB.TikuišisR.DulskasA.DabkevičienėD.LukosevičienėV.et al (2020a). Oxidant/antioxidant status of breast cancer patients in pre-and post-operative periods. Med. Kaunas.56 (2), 70. 10.3390/medicina56020070
20
DidžiapetrienėJ.KazbarienėB.TikuišisR.DulskasA.DabkevičienėD.LukosevičienėV.et al (2020b). Oxidant/antioxidant status of breast cancer patients in pre-and post-operative periods. Med. Kaunas.56 (2), 70. 10.3390/medicina56020070
21
DidžiapetrienėJ.KazbarienėB.TikuišisR.DulskasA.DabkevičienėD.LukosevičienėV.et al (2020c). Oxidant/antioxidant status of breast cancer patients in pre-and post-operative periods. Medicina (Kaunas); PK; RG 2020. Med. Kaunas.56 (2), 32054000. 10.3390/medicina56020070
22
El-AshmawyN. E.El-ZamaranyE. A.KhedrE. G.SelimH. M.KhedrN. F. (2022). Blocking of the prostaglandin E2 receptor as a therapeutic strategy for treatment of breast cancer: promising findings in a mouse model. Asian Pac J. Can. Prev.23 (11), 3763–3770. 10.31557/APJCP.2022.23.11.3763
23
El BakaryN. M.AlsharkawyA. Z.ShouaibZ. A.BarakatE. M. S. (2020). Role of bee venom and melittin on restraining angiogenesis and metastasis in γ-irradiated solid Ehrlich carcinoma-bearing mice. Integr. Can. Ther.19, 1534735420944476. 10.1177/1534735420944476
24
El-RamadyH.AbdallaN.TahaH. S.AlshaalT.El-HenawyA.FaizyS. E.-D. A.et al (2016). Selenium and nano-selenium in plant nutrition. Environ. Chem. Lett.14 (1), 123–147. 10.1007/s10311-015-0535-1
25
ElSaiedB. E. F.DiabA. M.TayelA. A.AlghuthaymiM. A.MoussaS. H. (2021). Potent antibacterial action of phycosynthesized selenium nanoparticles using Spirulina platensis extract. Green Process Synthe10 (1), 49–60. 10.1515/gps-2021-0005
26
El-SherbinyM.El-SayedR. M.HelalM. A.IbrahiemA. T.ElmahdiH. S.EladlM. A.et al (2021). Nifuroxazide mitigates angiogenesis in ehlrich's solid carcinoma: molecular docking, bioinformatic and experimental studies on inhibition of il-6/jak2/stat3 signaling. Molecules26 (22), 6858. 10.3390/molecules26226858
27
FahmyN. M.El-DinM. I. G.SalemM. M.RashedyS. H.LeeG. S.JangY. S.et al (2023). Enhanced expression of p53 and suppression of PI3K/Akt/mTOR by three red sea algal extracts: insights on their composition by LC-MS-based metabolic profiling and molecular networking. Mar. Drugs21 (7), 404. 10.3390/md21070404
28
FosslienE. (2000). Molecular pathology of cyclooxygenase-2 in neoplasia. Ann. Clin. Lab. Sci.30 (1), 3–21. PMID 10678579.
29
FoudaA.EidA. M.AbdelkareemA.SaidH. A.El-BelelyE. F.AlkhalifahD. H. M.et al (2022). Phyco-synthesized zinc oxide nanoparticles using marine macroalgae, Ulva fasciata Delile, characterization, antibacterial activity, photocatalysis, and tanning wastewater treatment. Catalysts12 (7), 756. 10.3390/catal12070756
30
GaoX.LiX.MuJ.HoC. T.SuJ.ZhangY.et al (2020). Preparation, physicochemical characterization, and anti-proliferation of selenium nanoparticles stabilized by Polyporus umbellatus polysaccharide. Int. J. Biol. Macromol.152, 605–615. 10.1016/j.ijbiomac.2020.02.199
31
GardouhA. R.AttiaM. A.EnanE. T.ElbahaieA. M.FouadR. A.El-ShafeyM.et al (2020). Synthesis and antitumor activity of doxycycline polymeric nanoparticles: effect on tumor apoptosis in solid Ehrlich carcinoma. Molecules25 (14), 3230. 10.3390/molecules25143230
32
GhedaS.NabyM. A.MohamedT.PereiraL.KhamisA. (2021). Antidiabetic and antioxidant activity of phlorotannins extracted from the brown seaweed Cystoseira compressa in streptozotocin-induced diabetic rats. Environ. Sci. Pollut. Res. Int.28 (18), 22886–22901. 10.1007/s11356-021-12347-5
33
GiulittiF.PetrungaroS.MandatoriS.TomaipitincaL.de FranchisV.D'AmoreA.et al (2021). Anti-tumor effect of oleic acid in hepatocellular carcinoma cell lines via autophagy reduction. Front. Cell Dev. Biol.5 (9), 629182. 10.3389/fcell.2021.629182
34
Globocan (2008). Cancer fact sheet. Breast cancer incidence and mortality worldwide in 2008.
35
GourA.JainN. K. (2019). Advances in green synthesis of nanoparticles. Artif. Cells Nanomed Biotechnol.47 (1), 844–851. 10.1080/21691401.2019.1577878
36
GuH.ChenX.ChenF.ZhouX.ParsaeeZ. (2018). Ultrasound-assisted biosynthesis of CuO-NPs using brown alga Cystoseira Trinodis: characterization, photocatalytic AOP, DPPH scavenging and antibacterial investigations. Ultrason. Sonochem41, 109–119. 10.1016/j.ultsonch.2017.09.006
37
HanoC.AbbasiB. H. (2021). Plant-based green synthesis of nanoparticles: production, characterization, and applications. Biomolecules12 (1), 31. 10.3390/biom12010031
38
HardmanW. E. (2002). Omega-3 fatty acids to augment cancer therapy. J. Nutr.132 (11), 3508S–12S. 10.1093/jn/132.11.3508S
39
HarrisW. S.DayspringT. D.MoranT. J. (2013). Omega-3 fatty acids and cardiovascular disease: new developments and applications. Postgrad. Med.125 (6), 100–113. 10.3810/pgm.2013.11.2717
40
HeinemannM. G.RosaC. H.RosaG. R.DiasD. (2021). Biogenic synthesis of gold and silver nanoparticles used in environmental applications: a review. Anal. Chem.30, e00129. 10.1016/j.teac.2021.e00129
41
HirmoS.UttM.RingnerM.WadströmT. (1995). Inhibition of heparan sulphate and other glycosaminoglycans binding to Helicobacter pylori by various polysulphated carbohydrates. F.E.M.S. Immunol. Med. Microbiol.10 (3-4), 301–306. 10.1111/j.1574-695X.1995.tb00048.x
42
JiangN.HuY.WangM.ZhaoZ.LiM. (2022). The Notch signaling pathway contributes to angiogenesis and tumor immunity in breast Cancer. Breast Cancer14, 291–309. 10.2147/BCTT.S376873
43
JohanningsmeierS. D.HarrisG. K. (2011). Pomegranate as a functional food and nutraceutical source. Annu. Rev. Food Sci. Technol.2, 181–201. 10.1146/annurev-food-030810-153709
44
KaragiannisG. S.ChenX.SharmaV. P.EntenbergD.CondeelisJ. S.OktayM. H.et al (2023). Cooperative NF-κB and Notch1 signaling promotes macrophage-mediated MenaINV expression in breast Cancer. Breast Can. Res.25 (1), 37, 37024946. 10.1186/s13058-023-01628-1
45
KaurK.ThombreR. (2021). Nanobiotechnology: methods, applications, and future prospects. Nanobiotechnology2021, 1–20. 10.1016/B978-0-12-822878-4.00001-8
46
KhotimchenkoM.TiastoV.KalitnikA.BegunM.KhotimchenkoR.LeontevaE.et al (2020). Antitumor potential of carrageenans from marine red algae. Carbohydr. Polym.246, 116568. 10.1016/j.carbpol.2020.116568
47
KontomanolisE. N.KalagasidouS.PouliliouS.AnthoulakiX.GeorgiouN.PapamanolisV.et al (2018). The Notch pathway in breast cancer progression. Sci. World J.2018, 2415489. 10.1155/2018/2415489
48
KyleD. J.SchaeferE.PattonG.BeiserA. (1999). Low serum docosahexaenoic acid is a significant risk factor for Alzheimer’s dementia. Lipids34 (1), S245. 10.1007/BF02562306
49
LanskyE. P.NewmanR. A. (2007). Punica granatum (pomegranate) and it is the potential for the prevention and treatment of inflamm. Cancer. J. Ethnopharmacol.109 (2), 177–206. 10.1016/j.jep.2006.09.006
50
LeaverH. A.BellH. S.RizzoM. T.IronsideJ. W.GregorA.WhartonS. B.et al (2002). Antitumour and pro-apoptotic actions of highly unsaturated fatty acids in glioma. Prostagl. Leukot. Essent. Fat. Acids66 (1), 19–29. 10.1054/PLEF.2001.0336
51
LiB.WangB.ChenM.LiG.FangM.ZhaiJ. (2015). Expression and interaction of TNF-α and VEGF in chronic stress-induced depressive rats. Exper Thera Med.10 (3), 863–868. 10.3892/etm.2015.2641
52
LiF. S.WengJ. K. (2017). Demystifying traditional herbal medicine with modern approach. Nat. Plants3, 17109. 10.1038/nplants.2017.109
53
LivakK. J.SchmittgenT. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta delta C(T)) method. Methods25 (4), 402–408. 10.1006/meth.2001.1262
54
MakhlofM. E. M.AlbalweF. M.Al-ShaikhT. M.El-SheekhM. M. (2022). Suppression effect of Ulva lactuca selenium nanoparticles (USeNPs) on HepG2 carcinoma cells resulting from degradation of epidermal growth factor receptor (EGFR) with an evaluation of its antiviral and antioxidant activities. Appl. Sci.12, 11546. 10.3390/app122211546
55
MandalP. K.RoyR. G.SamkariaA. (2022). Oxidative stress: glutathione and its potential to protect Methionine-35 of Aβ peptide from oxidation. A.C.S. Omega.7 (31), 27052–27061. 10.1021/acsomega.2c02760
56
MenonS.SanthiyaS. D.RajeshkumarR.KumarV. (2018). Selenium nanoparticles: a potent chemotherapeutic agent and an elucidation of its mechanism. Colloids Surf. B. Biointerfaces.170, 280–292. 10.1016/j.colsurfb.2018.06.006
57
MillerK. D.NogueiraL.MariottoA. B.RowlandJ. H.YabroffK. R.AlfanoC. M.et al (2019). Cancer treatment and survivorship statistics. C.A. Cancer J. Clin.69 (5), 363–385. 10.3322/caac.21565
58
MisraS.BoylanM.SelvamA.SpallholzJ. E.BjörnstedtM. (2015). Redox-active selenium compounds–from toxicity and cell death to cancer treatment. Nutrients7 (5), 3536–3556. 10.3390/nu7053536
59
Moncevičiute-EringieneE. (2005). Neoplastic growth: the consequence of evolutionary malignant resistance to chronic damage for survival of cells (review of a new theory of the origin of cancer). Med. Hypotheses65 (3), 595–604. 10.1016/j.mehy.2005.02.033
60
MosmannT. (1983). Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods.65, 55–63. 10.1016/0022-1759(83)90303-4
61
MukherjeeP.AhmadA.MandalD.SenapatiS.SainkarS. R.KhanM. I.et al (2001). Fungus-mediated synthesis of silver nanoparticles and their immobilization in the mycelial matrix: a novel biological approach to nanoparticle synthesis. Nano Lett. Lett.1 (10), 515–519. 10.1021/nl0155274
62
PáduaD.RochaE.GargiuloD.RamosA. A. (2015). Bioactive compounds from brown seaweeds: phloroglucinol, fucoxanthin, and fucoidan as promising therapeutic agents against breast Cancer. Phytochem. Lett.14, 91–98. 10.1016/j.phytol.2015.09.007
63
PalaniG.ArputhalathaA.KannanK.LakkaboyanaS. K.HanafiahM. M.KumarV.et al (2021). Current trends in the application of nanomaterials for the removal of pollutants from industrial wastewater Treatment-A review. Molecules26 (9), 2799. 10.3390/molecules26092799
64
PoinernG. E. J. (2014). A laboratory course in nanoscience and nanotechnology. Boca Raton, FL: CRC Press.
65
RaymanM. P. (2020). Selenium intake, status, and health: a complex relationship. Horm. (Athens)19 (1), 9–14. 10.1007/s42000-019-00125-5
66
RaymanM. P.WintherK. H.Pastor-BarriusoR.ColdF.ThvilumM.StrangesS.et al (2018). Effect of long-term selenium supplementation on mortality: results from a multiple-dose, randomised controlled trial. Free Radic. Biol. Med.127, 46–54. 10.1016/j.freeradbiomed.2018.02.015
67
RoelofsH. M.Te MorscheR. H.van HeumenB. W.NagengastF. M.PetersW. H. (2014). Over-expression of COX-2 mRNA in colorectal Cancer. B.M.C. Gastroenterol.14, 1. 10.1186/1471-230X-14-1
68
SaberS.KhalilR. M.AbdoW. S.NassifD.El-AhwanyE. (2019). Olmesartan ameliorates chemically induced ulcerative colitis in rats via modulating NF-κB and Nrf-2/HO-1 signaling crosstalk. Toxicol. Appl. Pharmacol.364, 120–132. 10.1016/j.taap.2018.12.020
69
SalemS. S.FoudaA. (2021). Green synthesis of metallic nanoparticles and their prospective biotechnological applications: an overview. Biol. Trace Elem. Res.199 (1), 344–370. 10.1007/s12011-020-02138-3
70
SeriniS.PiccioniE.MerendinoN.CalvielloG. (2009). Dietary polyunsaturated fatty acids as inducers of apoptosis: implications for cancer. Apoptosis14 (2), 135–152. 10.1007/s10495-008-0298-2
71
ShaheenT. I.FoudaA. (2018). Green approach for one-pot synthesis of silver nanorod using cellulose nanocrystal and their cytotoxicity and antibacterial assessment. Int. J. Biol. Macromol.106, 784–792. 10.1016/j.ijbiomac.2017.08.070
72
SiddiquiR. A.HarveyK. A.XuZ.BammerlinE. M.WalkerC.AltenburgJ. D. (2011). Docosahexaenoic acid: a natural powerful adjuvant that improves efficacy for anticancer treatment with no adverse effects. BioFactors37 (6), 399–412. 10.1002/biof.181
73
SirajA. K.ParvathareddyS. K.AnnaiyappanaiduP.AhmedS. O.SirajN.TulbahA.et al (2021). High expression of cyclin D1 is an independent marker for favorable prognosis in Middle Eastern breast Cancer. Onco Targets Ther.14, 3309–3318. 10.2147/OTT.S309091
74
SognoI.VenèR.FerrariN.De CensiA.ImperatoriA.NoonanD. M.et al (2010). Angioprevention with fenretinide: targeting angiogenesis in prevention and therapeutic strategies. Crit. Rev. Oncol. Hematol.75 (1), 2–14. 10.1016/j.critrevonc.2009.10.007
75
SolimanA. M.Abdel-LatifW.ShehataI. H.FoudaA.AbdoA. M.AhmedY. M. (2021). Green approach to overcome the resistance pattern of Candida spp. using biosynthesized silver nanoparticles fabricated by Penicillium chrysogenum F9. Biol. Trace Elem. Res.199 (2), 800–811. 10.1007/s12011-020-02188-7
76
Soo-JinH.Eun-JuP.Ki-wanL.You-JinJ. (2005). Antioxidant activities of enzymatic extracts from brown seaweeds. Biosource Technol.96, 1613–1623. 10.1016/j.biortech.2004.07.013
77
SpencerL.MannC.MetcalfeM.WebbM.PollardC.SpencerD.et al (2009). The effect of omega-3 FAs on tumour angiogenesis and their therapeutic potential. Eur. J. Cancer45 (12), 2077–2086. 10.1016/j.ejca.2009.04.026
78
VikneshanM.SaravanakumarR.MangaiyarkarasiR.RajeshkumarS.SamuelS. R.SuganyaM.et al (2020). Algal biomass as a source for novel oral nano-antimicrobial agent. Saudi J. Biol. Sci.27 (12), 3753–3758. 10.1016/j.sjbs.2020.08.022
79
WallR.RossR. P.FitzgeraldG. F.StantonC. (2010). Fatty acids from fish: the anti-inflammatory potential of long-chain omega-3 fatty acids. Nutr. Rev.68 (5), 280–289. 10.1111/j.1753-4887.2010.00287.x
80
WangB.ParobchakN.RosenT. (2012b). RelB/NF-κB2 regulates corticotropin-releasing hormone in the human placenta. Mol. Endocrinol.26 (8), 1356–1369. 10.1210/me.2012-1035
81
WangJ.LuoT.LiS.ZhaoJ. (2012a). The powerful applications of polyunsaturated fatty acids in improving the therapeutic efficacy of anticancer drugs. Expert Opin. Drug Deliv.9 (1), 1–7. 10.1517/17425247.2011.618183
82
WangW.NagS. A.ZhangR. (2015). Targeting the NF-κB signaling pathways for breast cancer prevention and therapy. Curr. Med. Chem.22 (2), 264–289. 10.2174/0929867321666141106124315
83
XieL.LuoZ.ZhaoL.ChenT. (2017). Anticancer and antiangiogenic iron (II) complexes that target thioredoxin reductase to trigger cancer cell apoptosis. J. Med. Chem.60, 202–214. 10.1021/acs.jmedchem.6b00917
84
YakonovV. A. D.MakarovA. A.DzhemilevaL. U.RamazanovI. R.MakarovaE. K.DzhemilevU. M. (2021). Natural trienoic acids as anticancer agents: first stereoselective synthesis, cell cycle analysis, induction of apoptosis, cell signaling, and mitochondrial targeting studies. Cancers13 (8), 1808. 10.3390/cancers13081808
85
YazdanianM.RostamzadehP.RahbarM.AlamM.AbbasiK.TahmasebiE.et al (2022). The potential application of green-synthesized metal nanoparticles in dentistry: a comprehensive review. Bioinorg. Chem. Appl.2022, 2311910, 2311910. 10.1155/2022/2311910
86
ZhangJ.ZhengJ.ChenH.LiX.YeC.ZhangF.et al (2022). Curcumin targeting NF-κB/ubiquitin-proteasome-system axis ameliorates muscle atrophy in triple-negative breast cancer cachexia mice. Metabol. Microb. Modu. Immuno. Mediat. Inflamm.2022, 2567150. 10.1155/2022/2567150
87
ZhongY.ShenS.ZhouY.MaoF.LinY.GuanJ.et al (2016). NOTCH1 is a poor prognostic factor for breast Cancer and is associated with breast cancer stem cells. Onco Targets Ther.9, 6865–6871. 10.2147/OTT.S109606
Summary
Keywords
anticancer, brown algae, macroalgae, selenium nanoparticles, solid Ehrlich carcinoma
Citation
Alotaibi BS, El-Masry TA, Selim H, El-Bouseary MM, El-Sheekh MM, Makhlof MEM and El-Nagar MMF (2024) New insights into the anticancer effects of Polycladia crinita aqueous extract and its selenium nanoformulation against the solid Ehrlich carcinoma model in mice via VEGF, notch 1, NF-кB, cyclin D1, and caspase 3 signaling pathway. Front. Pharmacol. 15:1345516. doi: 10.3389/fphar.2024.1345516
Received
06 December 2023
Accepted
05 February 2024
Published
16 February 2024
Volume
15 - 2024
Edited by
Ahmed Esmat Abdel Moneim, Helwan University, Egypt
Reviewed by
Xueyuan Hu, Qingdao Agricultural University, China
Enoch Obeng, Wenzhou Medical University, China
Beyza Vurusaner Aktas, New York University, United States
Updates
Copyright
© 2024 Alotaibi, El-Masry, Selim, El-Bouseary, El-Sheekh, Makhlof and El-Nagar.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Maysa M. F. El-Nagar, Maysa_elnagar@outlook.com; Maisra M. El-Bouseary, maysra_mohamed@pharm.tanta.edu.eg
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.