Abstract
The development of resistance to carbapenems in Klebsiella pneumoniae due to the production of metallo-β-lactamases (MBLs) is a critical public health problem because carbapenems are the last-resort drugs used for treating severe infections of extended-spectrum β-lactamases (ESBLs) producing K. pneumoniae. Restoring the activity of carbapenems by the inhibition of metallo-β-lactamases is a valuable approach to combat carbapenem resistance. In this study, two well-characterized clinical multidrug and carbapenem-resistant K. pneumoniae isolates were used. The sub-inhibitory concentrations of pantoprazole and the well-reported metallo-β-lactamase inhibitor captopril inhibited the hydrolytic activities of metallo-β-lactamases, with pantoprazole having more inhibiting activities. Both drugs, when used in combination with meropenem, exhibited synergistic activities. Pantoprazole could also downregulate the expression of the metallo-β-lactamase genes blaNDM and blaVIM. A docking study revealed that pantoprazole could bind to and chelate zinc ions of New Delhi and Verona integron-encoded MBL (VIM) enzymes with higher affinity than the control drug captopril and with comparable affinity to the natural ligand meropenem, indicating the significant inhibitory activity of pantoprazole against metallo-β-lactamases. In conclusion, pantoprazole can be used in combination with meropenem as a new strategy for treating serious infections caused by metallo-β-lactamases producing K. pneumoniae.
Introduction
Klebsiella pneumoniae is a facultative anaerobic Gram-negative bacterium of the family Enterobacteriaceae. It is non-motile and capsulated (). K. pneumoniae is recognized as a significant pathogen that is responsible for a range of clinical infections affecting various organ systems (; ). Clinical manifestations often include healthcare-associated pneumonia, urinary tract infections, bloodstream infections, wound infections, meningitis, and intra-abdominal infections (). Its ability to form a protective capsule, adhere to host tissues, and produce toxins contributes to its virulence (Victor et al., 2007). K. pneumoniae shows a significant increase in antibiotic resistance by different mechanisms, with resistance to β-lactamase as a major mechanism (; ). This leads to hindering effective treatment since K. pneumoniae infections are commonly treated by β-lactamase, including carbapenems and extended-spectrum cephalosporins (; ). The emergence of multidrug-resistant strains poses a serious challenge, necessitating comprehensive innovative strategies for the development of effective treatment strategies (; ; ; ).
Carbapenems are a class of broad-spectrum cell-wall antibiotics that belong to the β-lactam group, which also includes penicillins and cephalosporins. These antibiotics are structurally related to penicillins but possess a broader spectrum of activity against various bacteria, including both Gram-positive and Gram-negative pathogens (). The key features of carbapenems include their stability against many β-lactamases and their ability to penetrate bacterial cell walls effectively (). Carbapenems are considered “last-resort” antibiotics and are often reserved for serious infections caused by multidrug-resistant bacteria, particularly Gram-negative bacilli producing extended-spectrum β-lactamases (ESBLs), AmpC or carbapenemases (Zhanel et al., 2007). They are commonly used in hospital settings for conditions such as severe pneumonia, complicated intra-abdominal infections, complicated urinary tract infections, and septicemia ().
Despite their efficacy, the emergence of carbapenem-resistant bacteria predominantly among Gram-negative bacilli has been well documented (). Among the members of Enterobacteriaceae, K. pneumoniae is the most common carbapenem-resistant Enterobacterales (CRE). CRE was announced as an urgent global public health threat (; ). Carbapenem resistance in K. pneumoniae is mediated by several mechanisms. The major mechanism is enzymatic hydrolysis by carbapenemases. Carbapenemases are grouped into A, D, and B classes. The Ambler class A includes K. pneumoniae carbapenemase (KPC), while class D includes the oxacillin enzyme (OXA) (Spagnolo et al., 2014; ). On the other hand, class B metallo-β-lactamases (MBLs) can degrade carbapenems in addition to most penicillins and cephalosporins. However, this class is stable to β-lactamase inhibitors, and they are inhibited by metal ion chelators (). MBLs include New Delhi metallo-β-lactamase (NDM-1) and Verona integron-encoded MBL (VIM) and acquire activity on imipenem (). Carbapenemase inhibitors are of much importance to restore the activity of carbapenems that are valuable in treating infections caused by K. pneumoniae because the classical β-lactamase inhibitors such as clavulanate, sulbactam, and tazobactam have no activity against K. pneumoniae carbapenemases (; ).
Pantoprazole is a proton pump inhibitor (PPI). PPIs are drugs used to treat stomach acid-related disorders such as gastric ulcer, non-erosive reflux disease, as a prophylaxis against ulcers caused by non-steroidal anti-inflammatory drugs, and in combination with antibacterials for the therapy of Helicobacter pylori (Ward and Kearns, 2013; Strand et al., 2017). In addition to their classical uses, PPIs showed other activities against different types of pathogens. They were active against bacteria such as Pseudomonas aeruginosa and Staphylococcus aureus (Vidaillac et al., 2007; ), fungi such as Candida albicans and Candida spp. (), parasites such as Entamoeba histolytica (), and viruses such as SARS-CoV-2 (COVID-19) and rhinovirus (; ). This study aimed to investigate the ability of the PPI pantoprazole as a metallo-β-lactamase inhibitor compared to the well-known inhibitor captopril (; ; ) to be used for treating CRE infections in combination with carbapenems.
Materials and methods
Bacterial isolates and chemicals
Two clinical isolates of K. pneumoniae sourced from the Microbiology and Immunology Department stock culture collection at the Faculty of Pharmacy, Zagazig University, were used. The clinical isolates were characterized using 16S rRNA gene sequencing, and the obtained results were deposited in GenBank (https://www.ncbi.nlm.nih.gov/) under accession numbers ON798797 and ON798801 (). Pantoprazole was supplied by Novartis, Egypt. Meropenem was supplied by AstraZeneca, Egypt. Captopril and dimethyl sulfoxide (DMSO) were purchased from Sigma Chemical Co. (St. Louis, MO, United States). Antibiotic disks and bacterial culture media were obtained from Oxoid, United Kingdom.
Susceptibility test against different antimicrobial agents
The antimicrobial susceptibility testing of the test isolates was conducted for various classes of antimicrobial agents using the disk diffusion method, adhering to the guidelines set forth by the Clinical and Laboratory Standards Institute (CLSI) (Wayne, 2018). The used disks were meropenem (MEM, 10 μg), ceftriaxone (CRO, 30 μg), piperacillin–tazobactam (TZP, 100/10 μg), cefepime (FEP, 30 μg), cefoperazone (CFP, 75 μg), aztreonam (ATM, 30 μg), gentamicin (GN, 10 μg), amikacin (AK, 30 μg), trimethoprim–sulfamethoxazole (SXT, 1.25/23.75 μg), tetracycline (TE, 30 μg), tigecycline (TGC, 15 μg), levofloxacin (LEV, 5 μg), ofloxacin (OFX, 5 μg), chloramphenicol (C, 30 μg), and azithromycin (AZM, 15 μg).
Determination of the minimum inhibitory concentration of meropenem against test isolates
The minimum inhibitory concentration (MIC) of meropenem was evaluated using the broth microdilution method according to CLSI guidelines (Thabit et al., 2022a; ). MICs were recognized as the lowest concentrations at which visible bacterial growth was inhibited.
Effect of the sub-inhibitory concentration of pantoprazole on bacterial growth
To exclude the growth-inhibiting activity of pantoprazole or captopril, the effect of a sub-inhibitory concentration of pantoprazole (2 mg/mL) and captopril (1 mg/mL) on bacterial growth was evaluated by the turbidity measurement (; ). In brief, the overnight cultures of the tested strains were diluted to obtain a turbidity equivalent to 0.5 McFarland standard, followed by 1/100 dilution in the Mueller–Hinton broth (MHB) containing pantoprazole or captopril and control MHB without the tested drugs. After incubation for 18 h at 37°C, turbidities were measured at 600 nm using a UV-vis microplate reader (Synergy HT, BioTek) and compared.
Combined disk test
To assess the potential synergy between each captopril or pantoprazole and meropenem, the combined disk test was performed (). MH agar plates were prepared containing a final concentration of 2 mg/mL pantoprazole or a final concentration of 1 mg/mL captopril, and control plates without pantoprazole were prepared. Adjusted bacterial suspensions (0.5 McFarland standard) were prepared, and 100 μL aliquots were delivered and spread on the surface of the plates. A disk containing 10 mg of meropenem was placed on the center of the test and control plates. After 18 h of incubation at 37°C, the diameters of the inhibition zone were measured and photographed.
Quantitative carbapenemase inhibition assay in the crude periplasmic extract
Crude periplasmic extracts of isolates were prepared (). A loopful of the test isolates was inoculated in 10 mL of MHB that were incubated with shaking at 37°C for 18 h. The suspensions were centrifuged to harvest the pellets that were resuspended in 0.5 mL of phosphate buffer (100 mM, pH 7.0) combined with 50 µM ZnSO4 in a microcentrifuge tube and sonicated (ultrasonic system UP100H, Hielscher Ultrasonic Technology, Teltow, Germany) at 40 W for 1.5 min, with a pulse of 0.5 s. After centrifugation, the supernatants were used to assess the meropenem hydrolysis activity in the absence or presence of pantoprazole (2 mg/mL) or captopril (1 mg/mL) at 297 nm using the UV-vis spectrophotometer (Synergy HT, BioTek) (). Then, 100 µl aliquots were transferred to a 96-well microtitre plate, and the plates were incubated with pantoprazole (2 mg/mL) in 0.5% DMSO at 37°C for 30 min. Meropenem was added (500 μg/mL), and the solutions were incubated at 37°C for 1 h. The absorbances of solutions containing pantoprazole or captopril (test) and 0.5% DMSO (vehicle control) were detected at 297 nm. The percentage of meropenem hydrolysis inhibition was calculated using the following formula:
Effect of pantoprazole on the susceptibility of bacteria to meropenem
The influence of the sub-MICs of pantoprazole or captopril on the MIC of meropenem against the tested bacterial isolates was evaluated by using the broth microdilution method as previously described (; ).
Quantitative RT-PCR of metallo-β-lactamase genes
To analyze the relative expression levels of carbapenemase genes blaNDM and blaVIM in the K. pneumoniae ON798797 strain in the absence or presence of 1 mg/mL of pantoprazole, quantitative real-time-PCR (qRT-PCR) was employed. The primers for the two metallo-β-lactamase genes were obtained from Integrated DNA Technologies (IDT) (Coralville, Iowa, United States). The sequences of the primers are listed in Table 1 (; ). The housekeeping gene rpoB was used to normalize the relative expression levels of the tested genes. The StepOne Real-Time PCR System (Applied Biosystems, United States) was utilized, and the protocol of the SensiFAST™ SYBR® Hi-ROX One-Step Kit (Bioline, United Kingdom) was followed (; ). The thermocycling conditions were as follows: 3 min at 95 °C for enzyme activation, followed by 40 cycles (denaturation for 15 s at 95 °C, annealing for 30 s at 50–60 C, and extension for 30 s at 72 °C). The relative gene expression was determined using the comparative threshold cycle method, as outlined in the reference (; ; Thabit et al., 2022b).
TABLE 1
| Primer | Sequence (5′–3′) |
|---|---|
| blaNDM F | GCACACTTCCTATCTCGACATGC |
| blaNDM R | CCATACCGCCCATCTTGTCC |
| blaVIM F | GATGGTGTTTGGTCGCATA |
| blaVIM R | CGAATGCGCAGCACCAG |
| rpoB F | AACCCGCTGTCTGAGATTAC |
| rpoB R | GGCGTTTCGATCGGACATA |
Primers used in the genotypic detection of carbapenemase genes.
In silico study
The crystal structure of hydrolase enzymes, i.e., K. pneumoniae apo NDM-1 (Protein Data Bank (PDB) ID: 3SPU) at a resolution of 2.10 Å and VIM-2 (PDB ID: 5YD7) at a resolution of 1.70 Å, was retrieved from the PDB (https://www.rcsb.org/) in PDB format. Each of the pantoprazole, captopril, and meropenem structures were drawn using MarvinSketch of Marvin Suite (http://www.chemaxon.com) to generate a three-dimensional (3D) conformer for each with the lowest energy and then saved in Mol2 format (; ; Singh et al., 2022).
After the removal of all water molecules, the crystal 3D structure of the New Delhi metallo-β-lactamase enzyme underwent protonation with their standard geometry, followed by energy minimization. The dock module of Molecular Operating Environment (MOE) version MOE 2019.0102 was utilized (). The rigid binding pocket of the protein was accommodated by the three tested compounds through the flexible ligand mode. Poses were generated during the placement phase based on ligand conformations. The force field-based scoring function GBVI/WSA ΔG was employed to estimate the free energy of binding for the ligand from a specific analysis (; ; ).
Statistical analysis
All the experimental investigations were conducted in triplicates, and the mean and standard errors were calculated. One-way ANOVA statistical test, unless otherwise mentioned, was employed to attest the significance, where p < 0.05 was considered significant.
Results
Susceptibility to antibiotics
The disk diffusion method was carried out to investigate the one susceptibility profile of the test isolates (Table 2) to various antibiotics. Both the two tested K. pneumoniae isolates were multi-drug resistant (MDR), showing resistance to meropenem.
TABLE 2
| Isolate code | Anti-microbial agent | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MEM | CFP | CRO | TZP | FEP | ATM | OFX | LEV | AK | CN | TGC | TE | SXT | AZM | C | |
| ON798797 | R | R | R | R | R | R | R | R | S | S | I | R | R | R | S |
| ON798801 | R | R | R | R | R | R | R | R | R | R | I | I | R | R | R |
Antibiotic susceptibility profile of the clinical isolates of Klebsiella pneumoniae.
MEM, meropenem; CRO, ceftriaxone; TZP, piperacillin–tazobactam; FEP, cefepime; CFP, cefoperazone; ATM, aztreonam; GN, gentamicin; AK, amikacin; SXT, trimethoprim–sulfamethoxazole; TE, tetracycline; TGC, tigecycline; LEV, levofloxacin; OFX, ofloxacin; C, chloramphenicol; AZM, azithromycin.
Determination of the MICs of meropenem and pantoprazole against test isolates
The MICs of meropenem and the test drug pantoprazole against the test isolates were determined according to CLSI guidelines, and the results are shown in Table 3.
TABLE 3
| Isolate code | Minimum inhibitory concentration (MIC) | ||
|---|---|---|---|
| Meropenem | Pantoprazole | Captopril | |
| ON798797 | 256 μg/mL | 16 mg/mL | 8 mg/mL |
| ON798801 | 128 μg/mL | 16 mg/mL | 8 mg/mL |
Minimum inhibitory concentrations of meropenem and pantoprazole against tested Klebsiella pneumoniae isolates.
The effect of pantoprazole and captopril at a sub-MIC on bacterial growth and viability
To exclude the possible effect of captopril and pantoprazole on metallo-β-lactamases due to growth inhibition, the effect of the drugs on viability was investigated by measuring the turbidities of suspensions in the presence and absence of sub-minimum inhibitory concentrations (1/8 MICs) of the tested drugs (2 mg/mL pantoprazole and 1 mg/mL captopril). There were no significant differences between OD600 in control and test samples. This indicates the lack of the effect of captopril and pantoprazole on the bacterial growth (Figure 1).
FIGURE 1
Combined disk test
The possible synergy between meropenem and the tested drugs was tested by the combined disk test. The inhibition zone produced by meropenem was significantly increased from a mean diameter of 10 mm in the control plates to mean diameters of 20 mm for pantoprazole and 16 mm for captopril at 1/8 MICs (Figure 2). Importantly, pantoprazole significantly potentiates the meropenem activity compared to captopril.
FIGURE 2
Pantoprazole inhibited the hydrolytic activity of metallo-β-lactamases in the crude periplasmic extract of test isolates
The effect of both pantoprazole (2 mg/mL) and captopril (1 mg/mL) was assessed, showing that they significantly inhibited meropenem hydrolysis by carbapenemase-mediated hydrolysis of meropenem in the crude periplasmic extract of tested bacterial isolates. Pantoprazole was more active as an inhibitor of carbapenemase, showing 25% and 60% inhibition compared to captopril, which showed inhibition percentages of 20% and 50% in tested isolates ON798801 and ON798797, respectively (Figure 3).
FIGURE 3
The synergy between meropenem and tested drugs
To investigate the potential potentiation of meropenem by tested drugs, the MIC of meropenem was determined in the presence of the tested drugs. Pantoprazole at 1/8 MIC decreased the MIC of meropenem by 4-fold, a lower potentiating effect than that of captopril at 1/8 MIC (8-fold), as shown in Table 4.
TABLE 4
| Isolate code | Minimum inhibitory concentration (MIC) (µg/mL) | ||
|---|---|---|---|
| Meropenem | Meropenem + pantoprazole (2 mg/mL) | Meropenem + captopril (1 mg/mL) | |
| ON798797 | 256 | 64 | 32 |
| ON798801 | 128 | 32 | 16 |
Combined effect of meropenem with tested drugs on the susceptibility of Klebsiella pneumoniae isolates.
Pantoprazole downregulated metallo-β-lactamase genes blaVIM and blaNDM
To further confirm the metallo-β-lactamase inhibiting activity of pantoprazole at the molecular level, the relative expression of the genes blaVIM and blaNDM in the strain ON798797 was estimated in the presence and absence of pantoprazole (1 mg/mL) by quantitative real-time PCR. It was found that pantoprazole downregulated the expression of both blaVIM and blaNDM by approximately 2-fold (Figure 4).
FIGURE 4
Pantoprazole chelation of zinc ions in New Delhi metallo-β-lactamase and VIM enzymes in the in silico study
Molecular modeling simulation is traditionally carried out to explore the interactions of ligands with their respective binding sites in the crystal structures of the enzymes () Figure 5 (upper panel) shows that the docking results of pantoprazole against the crystal structure of the New Delhi metallo β-lactamase receptor displayed a unique type of halogen bonds () between the backbone of the conserved amino acid Asn220 and one of the fluorine atoms in the terminal difluoromethoxy moiety at position 5 of the benzimidazole scaffold. In addition, an arene–H-bond constructed between the non-classical Lewis base pyridine ring and the conserved amino acid Ala215 and the conspicuous hydrophobic/hydrophilic interactions expressed by cyan-shaded amino acids from the receptor side and the blue-shaded moieties from the ligand side improved the overall recognition and enhanced the ligand/receptor complex stability to score free-binding energy of −10.3401031 kcal/mol.
FIGURE 5
Concerning captopril (middle panel), two H-bonds were built between the mercapto group of the H-bond acceptor and the sp2-hybridized oxygen atom of the carboxylic group with the backbones of the conserved H-bond donor amino acids Gly222 and Gln123, respectively, giving rise to a total binding energy of −8.00626659 kcal/mol.
Analogously, meropenem (lower panel) exhibited two H-bonds between the sp2-hybridized oxygen atom in the dimethyl carbamoyl moiety of the H-bond acceptor and the H-bond donor OH group in the carboxylic moiety at position 2 and the backbones of the conserved amino acids Ala74 and His250, respectively, ending up with a total score of free-binding energy of −10.7858448 kcal/mol.
It is noteworthy that although the three ligands are rich in H-bond acceptors and donor sites, meropenem and pantoprazole have achieved higher binding activities than captopril. This may be attributed to the steric effect, the bulkiness of the moieties, and the appropriate spacers of the two privileged ligands, meropenem and pantoprazole, that steered them to well-fit positioning inside the active site.
On the other hand, upon docking the three ligands against the crystal structure of the hydrolase enzyme VIM-2 (PDB ID: 5YD7), as shown in Figure 6, we found that pantoprazole appeared as a bidentate ligand, with two bonds with Zn++ constructed via its chelating centers; the sp2-hybridized oxygen atom of the sulfinyl moiety and sp2-hybridized nitrogen atom of the imidazole ring. Moreover, the first chelating center formed another H-bond with the side chain of the H-bond donor-conserved amino acid Tyr134, ending up with a total free-binding energy of −7.80613756 kcal/mol.
FIGURE 6
Concerning captopril, it was featured as a monodentate ligand and formed one chelating bond with Zn++ with its sp2-hybridized oxygen atom of the carboxylic group. However, the active mercapto group formed acted as an H-bond acceptor and formed an H-bond with the side chain of the conserved amino acid Arg109, giving rise to a total free-binding energy of −7.91857481 kcal/mol.
Eventually, Zn++ formed two chelating bonds with the ligand meropenem, the first with the sp2-hybridized oxygen atom of the carboxylic group and the latter with the sp3-hybridized nitrogen atom of the pyrrolidine ring. Meropenem is represented as a bidentate ligand. Furthermore, an H-bond was displayed between the terminal OH group and the side chain of the H-bond acceptor amino acid Glu79, augmenting a total free-binding energy of up to −8.91452599 kcal/mol.
Discussion
The widespread dissemination of carbapenemase-producing K. pneumoniae within the Enterobacteriaceae family undermines the effectiveness of carbapenem therapy (). Moreover, the alternative therapeutic options for serious infections caused by this bacterium are so limited because they are insensitive to almost all other classes of antimicrobial agents (; ; ). This presents a significant public health concern due to the high mortality rates associated with these infections. Currently, only a few antibiotics, such as tigecycline and polymyxins, are utilized to combat carbapenem-resistant K. pneumoniae. However, tigecycline, a broad-spectrum tetracycline derivative, faces challenges in achieving adequate concentrations in blood, respiratory, and urinary tracts, rendering it unsuitable for treating infections such as pneumonia, bacteremia, and urinary tract infections (; ). Polymyxins are cationic cyclic polypeptides of which polymyxin B and colistin are used for the therapy against Gram-negative infections (). However, colistin causes nephrotoxicity and neurotoxicity that limit its use ().
In light of the serious side effects and limitations of tigecycline and polymyxins, it is vital to search for other alternative therapeutic options. Two combinations are approved for treating carbapenemase-producing bacteria, and the first is meropenem/vaborbactam for complicated urinary tract infections in addition to pneumonia (Vázquez-Ucha et al., 2020). However, meropenem/vaborbactam is inactive against class-B or D carbapenemases (). The second combination is relebactam with imipenem. Relebactam could not inhibit class-D OXA-48 β-lactamases; however, its inhibiting activities against class-A and class-C β-lactamases are pronounced ().
In this study, two clinical K. pneumoniae isolates were found to be multidrug-resistant and meropenem-resistant. Two drugs were used, and the well-reported metallo-β-lactamase inhibitor captopril and the proton pump inhibitor pantoprazole were considered a candidate for metallo-β-lactamase inhibition. They were used at sub-inhibitory concentrations that did not affect cell growth to guarantee that any possible effect on metallo-β-lactamases is not due to the interference with cell growth. Both pantoprazole and captopril synergized meropenem when combined with it in the combined disk method, and they reduced its MIC. When investigated for their activities against the inhibition of hydrolysis of carbapenem meropenem by the carbapenemase enzyme, pantoprazole showed a higher ability than captopril to protect meropenem from hydrolysis mediated by carbapenemase. To further confirm the action of pantoprazole on metallo-β lactamases, quantitative real-time PCR was performed to investigate if pantoprazole can downregulate the genes blaNDM and blaVIM that encode for the metallo-β-lactamase enzymes. Interestingly, pantoprazole could decrease the expression of the tested genes to a significant level. The observed decrease in MBL gene expression following treatment with pantoprazole substantiates its inhibitory effect on MBL at the molecular level. This indicates that its activity is not attributed to chemical interactions or other factors but rather to the direct interaction with the genes responsible for encoding MBL enzymes. Consequently, this suggests that pantoprazole is a suitable candidate for therapeutic intervention against MBL-producing K. pneumoniae infections.
The proposed mechanism of action of pantoprazole against metallo-β-lactamases is its ability to chelate metals. Metallo-β-lactamases have zinc ions in their active sites, which is essential for activity. As a result, the chelation of zinc can inhibit the action of metallo-β-lactamases. This was well documented in previous studies. Captopril was used in this study as a standard metallo-β-lactamase inhibitor. Captopril was previously found to inhibit metallo-β-lactamases NDM-1, VIM-1, and IMP-7 through zinc chelation by merit of its free thiol group (; ; ). Furthermore, the drug tiopronin, a medication used in the prevention of renal stones and the treatment of heavy-metal poisoning, is a good inhibitor of the metallo-β-lactamases NDM-1, VIM-1, and IMP-7 (). Pantoprazole is a benzimidazole compound. Benzimidazole compounds were previously found to chelate metal ions (; ). This was further confirmed by an in silico study that proved the possible strong binding of pantoprazole with zinc ions in the active site of the New Delhi metallo-β-lactamase enzyme. Pantoprazole showed binding affinity more or less similar to that of New Delhi metallo-β-lactamase to the natural ligand meropenem, reflecting the possibility of pantoprazole to act as a potent inhibitor of metallo-β-lactamases. This binding activity is higher than that of the previously reported metallo-β-lactamase inhibitor captopril. Moreover, pantoprazole showed a more potent chelation of zinc ions in the VIM-2 enzyme than did captopril. To summarize the results of the in silico study, successful chelating centers were found. These centers are the sp2-hybridized oxygen atom of the sulfinyl moiety and sp2-hybridized nitrogen atom of the imidazole ring in pantoprazole, the sp2-hybridized oxygen atom of the carboxylic group in captopril in addition to the sp2-hybridized oxygen atom of the carboxylic group, and the sp3-hybridized nitrogen atom of the pyrrolidine ring in meropenem. As chelation with Zn++ leads to the formation of a water-soluble complex, chelation not only impedes the catalytic role for this heavy metal to this hydrolase enzyme but also enhances the excretion of Zn++, and this is the mainstay of chelation therapy (). The overall conclusion from the docking study is that pantoprazole is a promising inhibitor of metallo-β-lactamases in terms of bulkiness, steric effect, spacers, binding mode and affinity, and the number of chelating centers. This activity is more pronounced than that of captopril.
In conclusion, pantoprazole can be used in combination with meropenem to treat serious resistant K. pneumoniae infections due to its ability to inhibit metallo-β-lactamases. However, the impact of pantoprazole was not investigated in conjunction with other carbapenems. It is reasonable to anticipate its potential effectiveness when used in combination with them. Further pharmacological studies are needed to prove its efficacy and safety before clinical application.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material; further inquiries can be directed to the corresponding author.
Author contributions
WA: formal analysis, investigation, methodology, validation, and writing–original draft. NA: funding acquisition, investigation, resources, software, and writing–original draft. AA: formal analysis, resources, software, and writing–original draft. MR: formal analysis, funding acquisition, resources, and writing–original draft. TI: software, validation, and writing–original draft. SO: software and writing–original draft. HA: conceptualization, project administration, writing–original draft, and writing–review and editing. BM: software, visualization, and writing–original draft. AS: data curation and writing–original draft. WH: conceptualization, project administration, supervision, visualization, writing–original draft, and writing–review and editing. MA-H: data curation, formal analysis, investigation, methodology, validation, visualization, and writing–original draft.
Funding
The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. The Deanship of Scientific Research (DSR) at King Abdulaziz University (KAU), Jeddah, Saudi Arabia, has funded this project, has funded under Grant No. RG-7–166-43. The authors, therefore, acknowledge the DSR for technical and financial support.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
AbbasH. A.KadryA. A.ShakerG. H.GodaR. M. (2019). Impact of specific inhibitors on metallo-β-carbapenemases detected in Escherichia coli and Klebsiella pneumoniae isolates. Microb. Pathog.132, 266–274. 10.1016/j.micpath.2019.05.022
2
Abdel-HalimM. S.AskouraM.MansourB.YahyaG.El-GaninyA. M. (2022). In vitro activity of celastrol in combination with thymol against carbapenem-resistant Klebsiella pneumoniae isolates. J. Antibiotics75, 679–690. 10.1038/s41429-022-00566-y
3
AguilaE. J. T.CuaI. H. Y. (2020). Repurposed GI drugs in the treatment of COVID-19. Dig. Dis. Sci.65, 2452–2453. 10.1007/s10620-020-06430-z
4
AkajagborD. S.WilsonS. L.Shere-WolfeK. D.DakumP.CharuratM. E.GilliamB. L. (2013). Higher incidence of acute kidney injury with intravenous colistimethate sodium compared with polymyxin B in critically ill patients at a tertiary care medical center. Clin. Infect. Dis.57, 1300–1303. 10.1093/cid/cit453
5
AlmalkiA. J.IbrahimT. S.ElhadyS. S.DarwishK. M.HegazyW. H. (2022). Repurposing α-adrenoreceptor blockers as promising anti-virulence agents in gram-negative bacteria. Antibiotics11, 178. 10.3390/antibiotics11020178
6
AlotaibiH. F.AlotaibiH.DarwishK. M.KhafagyE.-S.Abu LilaA. S.AliM. A.et al (2023). The anti-virulence activities of the antihypertensive drug propranolol in light of its anti-quorum sensing effects against Pseudomonas aeruginosa and Serratia marcescens. Biomedicines11, 3161. 10.3390/biomedicines11123161
7
AmiraM. E.AreejM. E.HematK. a.E.RamadanH. I.HebaI. A. (2016). Phenotypic and genotypic detection of-lactams resistance in Klebsiella species from Egyptian hospitals revealed carbapenem resistance by OXA and NDM genes. Afr. J. Microbiol. Res.10, 339–347. 10.5897/ajmr2015.7871
8
AskouraM.AbbasH. A.Al SadounH.AbdulaalW. H.Abu LilaA. S.AlmansourK.et al (2022). Elevated levels of IL-33, IL-17 and IL-25 indicate the progression from chronicity to hepatocellular carcinoma in hepatitis C virus patients. Pathogens11, 57. 10.3390/pathogens11010057
9
BarbourA.SchmidtS.MaB.SchiefelbeinL.RandK. H.BurkhardtO.et al (2009). Clinical pharmacokinetics and pharmacodynamics of tigecycline. Clin. Pharmacokinet.48, 575–584. 10.2165/11317100-000000000-00000
10
BenderO.ShomanM. E.AliT. F.DoganR.CelikI.MollicaA.et al (2023). Discovery of oxindole‐based FLT3 inhibitors as a promising therapeutic lead for acute myeloid leukemia carrying the oncogenic ITD mutation. Arch. Pharm.356, 2200407. 10.1002/ardp.202200407
11
BernabeuS.PoirelL.NordmannP. (2012). Spectrophotometry-based detection of carbapenemase producers among Enterobacteriaceae. Diagn Microbiol. Infect. Dis.74, 88–90. 10.1016/j.diagmicrobio.2012.05.021
12
BoonyanugomolW.KraisriwattanaK.RuksereeK.BoonsamK.NarachaiP. (2017). In vitro synergistic antibacterial activity of the essential oil from Zingiber cassumunar Roxb against extensively drug-resistant Acinetobacter baumannii strains. J. Infect. Public Health10, 586–592. 10.1016/j.jiph.2017.01.008
13
BradfordP. A. (2001). Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev.14, 933–951. 10.1128/CMR.14.4.933-951.2001
14
BreilhD.Texier-MaugeinJ.AllaouchicheB.SauxM.-C.BoselliE. (2013). Carbapenems. J. Chemother.25, 1–17. 10.1179/1973947812Y.0000000032
15
BremJ.Van BerkelS. S.ZollmanD.LeeS. Y.GileadiO.MchughP. J.et al (2016). Structural basis of metallo-β-lactamase inhibition by captopril stereoisomers. Antimicrob. agents Chemother.60, 142–150. 10.1128/AAC.01335-15
16
CavaluS.ElbaramawiS. S.EissaA. G.RadwanM. F.IbrahimS.KhafagyT.et al (2022). Characterization of the anti-biofilm and anti-quorum sensing activities of the β-adrenoreceptor antagonist atenolol against gram-negative bacterial pathogens. Int. J. Mol. Sci.23, 13088. 10.3390/ijms232113088
17
Centers for Disease Control and Prevention (2019). Antibiotic resistance threats in the United States, 2019. United States: US Department of Health and Human Services, Centers for Disease Control and Prevention.
18
ChenJ. Z.FowlerD. M.TokurikiN. (2020). Comprehensive exploration of the translocation, stability and substrate recognition requirements in VIM-2 lactamase. Elife9, e56707. 10.7554/eLife.56707
19
ChkirateK.EssassiE. M. (2022). Pyrazole and benzimidazole derivatives: chelating properties towards metals ions and their applications. Curr. Org. Chem.26, 1735–1766. 10.2174/1385272827666221216110504
20
CodjoeF. S.DonkorE. S. (2017). Carbapenem resistance: a review. Med. Sci.6, 1. 10.3390/medsci6010001
21
CornagliaG.AkovaM.AmicosanteG.CantónR.CaudaR.DocquierJ.-D.et al (2007). Metallo-beta-lactamases as emerging resistance determinants in Gram-negative pathogens: open issues. Int. J. Antimicrob. agents29, 380–388. 10.1016/j.ijantimicag.2006.10.008
22
DennyB. J.LambertP. A.WestP. W. (2002). The flavonoid galangin inhibits the L1 metallo-beta-lactamase from Stenotrophomonas maltophilia. FEMS Microbiol. Lett.208, 21–24. 10.1111/j.1574-6968.2002.tb11054.x
23
DrawzS. M.BethelC. R.DoppalapudiV. R.SheriA.PagadalaS. R. R.HujerA. M.et al (2010). Penicillin sulfone inhibitors of class D beta-lactamases. Antimicrob. agents Chemother.54, 1414–1424. 10.1128/AAC.00743-09
24
DrawzS. M.Papp-WallaceK. M.BonomoR. A. (2014). New β-lactamase inhibitors: a therapeutic renaissance in an MDR world. Antimicrob. agents Chemother.58, 1835–1846. 10.1128/AAC.00826-13
25
El-AbdA. O.BayomiS. M.El-DamasyA. K.MansourB.Abdel-AzizN. I.El-SherbenyM. A. (2022). Synthesis and molecular docking study of new thiazole derivatives as potential tubulin polymerization inhibitors. ACS omega7, 33599–33613. 10.1021/acsomega.2c05077
26
ElfakyM. A.ElbaramawiS. S.EissaA. G.IbrahimT. S.KhafagyE. S.AliM. a.M.et al (2023). Drug repositioning: doxazosin attenuates the virulence factors and biofilm formation in Gram-negative bacteria. Appl. Microbiol. Biotechnol.107, 3763–3778. 10.1007/s00253-023-12522-3
27
ElfakyM. A.ThabitA. K.EljaalyK.ZawawiA.AbdelkhalekA. S.AlmalkiA. J.et al (2022). Controlling of bacterial virulence: evaluation of anti-virulence activities of prazosin against Salmonella enterica. Antibiot. (Basel)11, 1585. 10.3390/antibiotics11111585
28
FloraS. J.PachauriV. (2010). Chelation in metal intoxication. Int. J. Environ. Res. public health7, 2745–2788. 10.3390/ijerph7072745
29
FreireA. T.MelnykV.KimM. J.DatsenkoO.DzyublikO.GlumcherF.et al (2010). Comparison of tigecycline with imipenem/cilastatin for the treatment of hospital-acquired pneumonia. Diagnostic Microbiol. Infect. Dis.68, 140–151. 10.1016/j.diagmicrobio.2010.05.012
30
García-SáezI.HopkinsJ.PapamicaelC.FranceschiniN.AmicosanteG.RossoliniG. M.et al (2003). The 1.5-A structure of Chryseobacterium meningosepticum zinc beta-lactamase in complex with the inhibitor, D-captopril. J. Biol. Chem.278, 23868–23873. 10.1074/jbc.M301062200
31
GaronzikS.LiJ.ThamlikitkulV.PatersonD.ShohamS.JacobJ.et al (2011). Population pharmacokinetics of colistin methanesulfonate and formed colistin in critically ill patients from a multicenter study provide dosing suggestions for various categories of patients. Antimicrob. agents Chemother.55, 3284–3294. 10.1128/AAC.01733-10
32
GasinkL. B.EdelsteinP. H.LautenbachE.SynnestvedtM.FishmanN. O. (2009). Risk factors and clinical impact of Klebsiella pneumoniae carbapenemase-producing K. pneumoniae. Infect. Control Hosp. Epidemiol.30, 1180–1185. 10.1086/648451
33
HatipogluO. F.YaykasliK. O.DoganM.YaykasliE.BenderO.YasarT.et al (2015). NF-[kappa] B and MAPKs are involved in resistin-caused ADAMTS-5 induction in human chondrocytes. Clin. Investigative Med. (Online)38, E248.
34
HawkeyP. M.LivermoreD. M. (2012). Carbapenem antibiotics for serious infections. Bmj344, e3236. 10.1136/bmj.e3236
35
HegazyW. a.H.SalemI. M.AlotaibiH. F.KhafagyE.-S.IbrahimD. (2022). Terazosin interferes with quorum sensing and type three secretion system and diminishes the bacterial espionage to mitigate the Salmonella typhimurium pathogenesis. Antibiotics11, 465. 10.3390/antibiotics11040465
36
ImaiK.IshibashiN.KodanaM.TarumotoN.SakaiJ.KawamuraT.et al (2019). Clinical characteristics in blood stream infections caused by Klebsiella pneumoniae, Klebsiella variicola, and Klebsiella quasipneumoniae: a comparative study, Japan, 2014–2017. BMC Infect. Dis.19, 946–1010. 10.1186/s12879-019-4498-x
37
IncC. C. G. (2016). Molecular operating environment (MOE). Montreal, QC, Canada: Chemical Computing Group Inc.
38
KangC.-I.KimS.-H.BangJ.-W.KimH.-B.KimN.-J.KimE.-C.et al (2006). Community-acquired versus nosocomial Klebsiella pneumoniae bacteremia: clinical features, treatment outcomes, and clinical implication of antimicrobial resistance. J. Korean Med. Sci.21, 816–822. 10.3346/jkms.2006.21.5.816
39
KhayatM. T.AbbasH. A.IbrahimT. S.KhayyatA. N.AlharbiM.DarwishK. M.et al (2022a). Anti-quorum sensing activities of gliptins against Pseudomonas aeruginosa and Staphylococcus aureus. Biomedicines10, 1169. 10.3390/biomedicines10051169
40
KhayatM. T.ElbaramawiS. S.NazeihS. I.SafoM. K.KhafagyE.-S.AliM. A.et al (2023). Diminishing the pathogenesis of the food-borne pathogen Serratia marcescens by low doses of sodium citrate. Biology12, 504. 10.3390/biology12040504
41
KhayatM. T.IbrahimT. S.KhayyatA. N.AlharbiM.ShaldamM. A.MohammadK. A.et al (2022b). Sodium citrate alleviates virulence in Pseudomonas aeruginosa. Microorganisms10, 1046. 10.3390/microorganisms10051046
42
KhayyatA. N.AbbasH. A.MohamedM. F. A.AsfourH. Z.KhayatM. T.IbrahimT. S.et al (2021). Not only antimicrobial: metronidazole mitigates the virulence of Proteus mirabilis isolated from macerated diabetic foot ulcer. Appl. Sci.11, 6847. 10.3390/app11156847
43
KingD.StrynadkaN. (2011). Crystal structure of New Delhi metallo-β-lactamase reveals molecular basis for antibiotic resistance. Protein Sci.20, 1484–1491. 10.1002/pro.697
44
KlinglerF.-M.WichelhausT. A.FrankD.Cuesta-BernalJ.El-DelikJ.MuLlerH. F.et al (2015). Approved drugs containing thiols as inhibitors of metallo-β-lactamases: strategy to combat multidrug-resistant bacteria. J. Med. Chem.58, 3626–3630. 10.1021/jm501844d
45
LabuteP. (2008). The generalized Born/volume integral implicit solvent model: estimation of the free energy of hydration using London dispersion instead of atomic surface area. J. Comput. Chem.29, 1693–1698. 10.1002/jcc.20933
46
LilaA. S. A.RajabA. A.AbdallahM. H.RizviS. M. D.MoinA.KhafagyE.-S.et al (2023). Biofilm lifestyle in recurrent urinary tract infections. Life13, 148. 10.3390/life13010148
47
LivakK. J.SchmittgenT. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. methods25, 402–408. 10.1006/meth.2001.1262
48
LoganL. K.WeinsteinR. A. (2017). The epidemiology of carbapenem-resistant Enterobacteriaceae: the impact and evolution of a global menace. J. Infect. Dis.215, S28–S36. 10.1093/infdis/jiw282
49
LomovskayaO.SunD.Rubio-AparicioD.NelsonK.TsivkovskiR.GriffithD. C.et al (2017). Vaborbactam: spectrum of beta-lactamase inhibition and impact of resistance mechanisms on activity in Enterobacteriaceae. Antimicrob. agents Chemother.61, e01443-17. 10.1128/AAC.01443-17
50
MahomoodallyM. F.AtalayA.PicotM. C. N.BenderO.CelebiE.MollicaA.et al (2018). Chemical, biological and molecular modelling analyses to probe into the pharmacological potential of Antidesma madagascariense Lam.: a multifunctional agent for developing novel therapeutic formulations. J. Pharm. Biomed. Analysis161, 425–435. 10.1016/j.jpba.2018.09.002
51
MansourB.El-SherbenyM. A.Al-OmaryF. A.SaberS.RamadanH. A.El-BazA. M.et al (2023). New pyrazole-clubbed pyrimidine or pyrazoline hybrids as anti-methicillin-resistant Staphylococcus aureus agents: design, synthesis, in vitro and in vivo evaluation, and molecular modeling simulation. ACS omega8, 44250–44264. 10.1021/acsomega.3c06936
52
MartinR. M.BachmanM. A. (2018). Colonization, infection, and the accessory genome of Klebsiella pneumoniae. Front. Cell. Infect. Microbiol.8, 4. 10.3389/fcimb.2018.00004
53
NazeihS. I.AliM. A.HalimA. S. A.Al-LawatiH.AbbasH. A.Al-ZharaniM.et al (2023). Relocating glyceryl trinitrate as an anti-virulence agent against Pseudomonas aeruginosa and Serratia marcescens: insights from molecular and in vivo investigations. Microorganisms11, 2420. 10.3390/microorganisms11102420
54
NordmannP.CuzonG.NaasT. (2009). The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect. Dis.9, 228–236. 10.1016/S1473-3099(09)70054-4
55
Papp-WallaceK. M.BarnesM. D.AlsopJ.TaracilaM. A.BethelC. R.BeckaS. A.et al (2018). Relebactam is a potent inhibitor of the KPC-2 β-lactamase and restores imipenem susceptibility in KPC-producing Enterobacteriaceae. Antimicrob. Agents Chemother.62, e00174-18. 10.1128/AAC.00174-18
56
Pérez-VillanuevaJ.Romo-MancillasA.Hernández-CamposA.Yépez-MuliaL.Hernández-LuisF.CastilloR. (2011). Antiprotozoal activity of proton-pump inhibitors. Bioorg. Med. Chem. Lett.21, 7351–7354. 10.1016/j.bmcl.2011.10.028
57
PoirelL.NaasT.NicolasD.ColletL.BellaisS.CavalloJ.-D.et al (2000). Characterization of VIM-2, a carbapenem-hydrolyzing metallo-beta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob. agents Chemother.44, 891–897. 10.1128/aac.44.4.891-897.2000
58
QueenanA. M.BushK. (2007). Carbapenemases: the versatile beta-lactamases. Clin. Microbiol. Rev.20, 440–458. 10.1128/CMR.00001-07
59
RajabA. A.HegazyW. A. (2023). What’s old is new again: insights into diabetic foot microbiome. World J. Diabetes14, 680–704. 10.4239/wjd.v14.i6.680
60
RappR. P.UrbanC. (2012). Klebsiella pneumoniae carbapenemases in Enterobacteriaceae: history, evolution, and microbiology concerns. Pharmacother. J. Hum. Pharmacol. Drug Ther.32, 399–407. 10.1002/j.1875-9114.2012.01035.x
61
RossoliniG. M. (2005). Acquired metallo-β-lactamases: an increasing clinical threat. The University of Chicago Press.
62
SadiqS.RanaN. F.ZahidM. A.ZargahamM. K.TanweerT.BatoolA.et al (2020). Virtual screening of FDA-approved drugs against LasR of Pseudomonas aeruginosa for antibiofilm potential. Molecules25, 3723. 10.3390/molecules25163723
63
Sánchez-MorenoM. J.Fernández-BotelloA.Gómez-CocaR. B.GriesserR.OchockiJ.KotynskiA.et al (2004). Metal ion-binding properties of (1 H-Benzimidazol-2-yl-methyl) phosphonate (Bimp2-) in aqueous solution. Isomeric equilibria, extent of chelation, and a new quantification method for the chelate effect. Inorg. Chem.43, 1311–1322. 10.1021/ic030175k
64
SasakiT.YamayaM.YasudaH.InoueD.YamadaM.KuboH.et al (2005). The proton pump inhibitor lansoprazole inhibits rhinovirus infection in cultured human tracheal epithelial cells. Eur. J. Pharmacol.509, 201–210. 10.1016/j.ejphar.2004.12.042
65
SiavoshiF.TavakolianA.ForoumadiA.HosseiniN. M.MassarratS.PedramniaS.et al (2012). Comparison of the effect of non-antifungal and antifungal agents on Candida isolates from the gastrointestinal tract. Archives Iran. Med.15, 27–31.
66
SinghS.BakerQ. B.SinghD. B. (2022). Molecular docking and molecular dynamics simulation. Bioinformatics, 291–304. 10.1016/b978-0-323-89775-4.00014-6
67
SpagnoloA. M.OrlandoP.PanattoD.PerdelliF.CristinaM. L. (2014). An overview of carbapenem-resistant Klebsiella pneumoniae: epidemiology and control measures. Rev. Res. Med. Microbiol.25, 7–14. 10.1097/mrm.0b013e328365c51e
68
StrandD. S.KimD.PeuraD. A. (2017). 25 years of proton pump inhibitors: a comprehensive review. Gut liver11, 27–37. 10.5009/gnl15502
69
ThabitA. K.EljaalyK.ZawawiA.IbrahimT. S.EissaA. G.ElbaramawiS. S.et al (2022a). Muting bacterial communication: evaluation of prazosin anti-quorum sensing activities against gram-negative bacteria Pseudomonas aeruginosa, Proteus mirabilis, and Serratia marcescens. Biol. (Basel)11, 1349. 10.3390/biology11091349
70
ThabitA. K.EljaalyK.ZawawiA.IbrahimT. S.EissaA. G.ElbaramawiS. S.et al (2022b). Silencing of Salmonella typhimurium pathogenesis: atenolol acquires efficient anti-virulence activities. Microorganisms10, 1976. 10.3390/microorganisms10101976
71
Vázquez-UchaJ. C.Arca-SuárezJ.BouG.BeceiroA. (2020). New carbapenemase inhibitors: clearing the way for the β-lactams. Int. J. Mol. Sci.21, 9308. 10.3390/ijms21239308
72
VictorL. Y.HansenD. S.KoW. C.SagnimeniA.KlugmanK. P.Von GottbergA.et al (2007). Virulence characteristics of Klebsiella and clinical manifestations of K. pneumoniae bloodstream infections. Emerg. Infect. Dis.13, 986–993. 10.3201/eid1307.070187
73
VidaillacC.GuillonJ.ArpinC.Forfar-BaresI.BaB. B.GrelletJ.et al (2007). Synthesis of omeprazole analogues and evaluation of these as potential inhibitors of the multidrug efflux pump NorA of Staphylococcus aureus. Antimicrob. agents Chemother.51, 831–838. 10.1128/AAC.01306-05
74
WardR. M.KearnsG. L. (2013). Proton pump inhibitors in pediatrics: mechanism of action, pharmacokinetics, pharmacogenetics, and pharmacodynamics. Pediatr. Drugs15, 119–131. 10.1007/s40272-013-0012-x
75
WayneP. (2018). CLSI. Performance standards for antimicrobial susceptibility testing. 28th ed. CLSI supplement M100.
76
ZhanelG. G.WiebeR.DilayL.ThomsonK.RubinsteinE.HobanD. J.et al (2007). Comparative review of the carbapenems. Drugs67, 1027–1052. 10.2165/00003495-200767070-00006
Summary
Keywords
Klebsiella pneumoniae, pantoprazole, carbapenems, metallo-β-lactamase inhibitor, healthcare
Citation
Abdulaal WH, Alhakamy NA, Asseri AH, Radwan MF, Ibrahim TS, Okbazghi SZ, Abbas HA, Mansour B, Shoun AA, Hegazy WAH and Abdel-Halim MS (2024) Redirecting pantoprazole as a metallo-beta-lactamase inhibitor in carbapenem-resistant Klebsiella pneumoniae. Front. Pharmacol. 15:1366459. doi: 10.3389/fphar.2024.1366459
Received
06 January 2024
Accepted
27 February 2024
Published
12 March 2024
Volume
15 - 2024
Edited by
Sirajudheen Anwar, University of Hail, Saudi Arabia
Reviewed by
Dalal Hammoudi Halat, Qatar University, Qatar
Eslam Elsayed, University of Marburg, Germany
Onur Bender, Ankara University, Türkiye
Updates
Copyright
© 2024 Abdulaal, Alhakamy, Asseri, Radwan, Ibrahim, Okbazghi, Abbas, Mansour, Shoun, Hegazy and Abdel-Halim.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Wael A. H. Hegazy, waelmhegazy@daad-alumni.de
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.