ORIGINAL RESEARCH article

Front. Sustain. Food Syst., 16 July 2025

Sec. Agro-Food Safety

Volume 9 - 2025 | https://doi.org/10.3389/fsufs.2025.1628211

Quality and safety of fresh sugarcane juice sold by street vendors: a growing public health concern

  • 1. Laboratory of Engineering and Applied Technologies, Higher School of Technology, Sultan Moulay Slimane University, Beni Mellal, Morocco

  • 2. Department of Biology, College of Science, Imam Mohammad Ibn Saud Islamic University (IMSIU), Riyadh, Saudi Arabia

  • 3. Department of Biology, College of Science, Qassim University, Buraydah, Saudi Arabia

  • 4. Department of Veterinary Science, University of Messina, Messina, Italy

Abstract

Sugarcane juice is a nutrient-rich beverage with numerous health benefits. However, in Morocco, the safety and quality and of fresh sugarcane juice have not been adequately assessed. To bridge this gap, a total of 100 sugarcane juice samples sold by street vendors in the city of Beni Mellal, Morocco, were collected between February and June 2024 and analyzed for key quality and safety parameters, including the evaluation of the microbiological quality and safety of fresh sugarcane juice sold in Morocco, the analysis of its physicochemical properties, and the assessment of the potential health risks linked with its consumption. Physicochemical analysis revealed a pH of 5.23 ± 0.09, total titratable acidity (TTA) of 0.16 ± 0.02% (g citric acid equivalent/100 mL), and total soluble solids (TSS) of 18.48 ± 0.69 °Brix. The juice exhibited notable bioactive properties, with total phenolic content (TPC) of 90.25 ± 8.02 mg GAE/100 mL, total flavonoid content (TFC) of 46.83 ± 8.79 mg QE/100 mL, vitamin C content of 11.25 ± 1.55 mg/100 mL, and DPPH scavenging activity with IC50 of 72.45 ± 7.07 g/L. Microbiological assessment indicated contamination with Total Aerobic Mesophilic Flora, total coliforms, fecal coliforms, yeasts and molds, staphylococci at a level of 5.79 ± 0.36, 3.78 ± 0.33, 1.67 ± 0.34, 3.73 ± 0.23, and 2.81 ± 0.23 log CFU/mL, respectively. Additionally, Escherichia coli was detected in 77% of samples and Staphylococcus aureus was found in 7% of samples, while Salmonella and Listeria monocytogenes were no detected. Antimicrobial susceptibility revealed high resistance of E. coli and S. aureus to ampicillin, penicillin, streptomycin, and tetracycline, with multidrug-resistant (MDR) profiles identified in 40.26% of E. coli and 42.86% of S. aureus isolates. Notably, 24.67% of E. coli and 42.86% of S. aureus isolates exhibited a multiple antibiotic resistance (MAR) index > 0.2, indicating a high-risk contamination source. Moreover, conventional PCR analysis revealed the presence of the sea gene in one S. aureus isolate (14.28%). Additionally, the stx1 and stx2 genes were detected in 8 (10.39%) and 5 (6.49%) E. coli isolates, respectively. In contrast, the hlyA gene was not detected in any of the E. coli isolates. Our results underscore a serious public health concern, emphasizing the urgent need for improved hygienic practices and regulatory monitoring fresh juice sold by street vendors in Morocco.

1 Introduction

Food safety has become a growing interest for both national and international authorities, as well as the global population. Consumers are increasingly demanding safe and high-quality food products (Sorbo et al., 2023). Additionally, challenges such as climate change, pollution, and the overuse of pesticides and synthetic products in agriculture have created significant obstacles. Consequently, ensuring the safety and nutritional quality of food has become a key priority for international regulatory bodies (Agrimonti et al., ; Ed-Dra et al., ). Indeed, fruit and vegetable juices are recognized as sustainable and nutrient-rich food sources, providing essential vitamins, minerals, fiber, and antioxidants (Butu and Rodino, ). Their role in enhancing wellbeing and reducing the risk of illnesses has further heightened their importance in global food systems (Renda and Söhretoglu, 2024). However, various studies have reported the implication of vegetables and fruits in many cases of foodborne outbreaks (Aiyedun et al., ). In fact, the contamination of fruits and vegetables can occur during farming practices, especially when using contaminated irrigation water (Steele and Odumeru, 2004; Gurtler and Gibson, ). Moreover, the contamination can be linked to harvest practices like contact with contaminated hands of farmers, post-harvest manipulation as well as the pressing and preparation of juices (Lenzi et al., 2021). Therefore, final products, including Fruit and vegetable juices may harbor harmful bacteria, including fecal contaminants and disease-causing pathogens such as Escherichia coli, Salmonella, and others (Lee et al., 2021; Nan et al., 2022; Neggazi et al., 2024).

Sugarcane juice, extracted from the stem of Saccharum officinarum L., is a widely consumed natural beverage appreciated worldwide for its distinctive sweetness and aroma (Dhansu et al., ). It contains a high concentration of beneficial bioactive molecules, including phenolic acid derivatives (glucosyringic acid, dihydromelilotoside, malaysin A, 2-O-caffeoylglucarate, and coumaric acid), flavones (diosmetin, luteolin, apigenin, and tricine derivatives), and dilignols (Duarte-Almeida et al., ; Rodrigues et al., 2021), making it a nutritionally valuable beverage with significant health benefits (Hewawansa et al., 2024). Traditionally, sugarcane juice has been widely applied in therapeutic practices for managing conditions including anuria, jaundice, dysuria, bleeding disorders, and urinary complications (Chinnadurai, ). However, its preparation and sale often occur in informal markets under unhygienic conditions, raising concerns about safety and microbial contamination (Panigrahi et al., 2021). This is particularly concerning in the street markets of developing countries, where the risk of contamination is significantly higher. Existing literature suggests that improper hygiene standards during processing contribute significantly to sugarcane juice contamination, the utilization of contaminated raw sugarcane, inadequate cleaning of processing equipment (e.g., presses and knives), unclean contact surfaces, vendors' hands and clothing, and airborne particles (da Costa Messias et al., ). These factors collectively pose a significant risk to sugarcane juice safety, threatening consumer health.

Importantly, a survey study on sugarcane juice sold in the streets of Punjab, Pakistan, revealed antibiotic-resistant enterobacteriaceae including E. coli, Shigella spp., and Salmonella spp., presents considerable public health challenges regarding product safety (Amjad et al., ). Similarly, a study in Brazil showed a wide contamination of sugarcane juice with total coliforms (100%) and E. coli (19.05%), with a sample was detected positive for the presence of Salmonella Typhimurium (da Costa Messias et al., ). The excessive and inappropriate application of antimicrobial compounds, especially in animal husbandry practices, has substantially contributed to the emergence of resistant microbial strains (Mandal and Mandal, 2018). These studies underscore the significant risk of microbial contamination in fresh sugarcane juice sold by street vendors.

The presence of antimicrobial-resistant and virulent pathogens in fresh products such as sugarcane juice is a major public health concern, posing significant challenges for food safety authorities. Antimicrobial resistance (AMR) allows microorganisms to withstand antimicrobial treatments, creating serious risks, particularly for vulnerable populations (Ed-Dra et al., ; Salam et al., 2023). Microorganisms can develop resistance after exposure to sublethal concentrations of antimicrobial agents in different sectors. In this regard, the overuse and misuse of antimicrobial agents, particularly in livestock farming, have accelerated development of resistance (Khmaissa et al., 2024). Additionally, exposure to environmental stressors and synthetic compounds, including pesticide residues, and environmental pollutants, can further induce AMR (Wang et al., 2023; Ifedinezi et al., 2024; Karwowska, 2024; Murray et al., 2024). Alarming research forecasts position antibiotic resistance as potentially the foremost cause of mortality worldwide within three decades, with direct AMR-related deaths potentially reaching 1.91 million per year by 2050 (95% UI, 1.56–2.26 million) and associated with 8.22 million deaths (95% UI, 6.85–9.65 million) globally (Naghavi et al., 2024). Therefore, enhanced surveillance is urgently needed, particularly for fresh food products such as juices, to help policymakers in implementing effective strategies to tackle the development and dissemination of antimicrobial resistant and virulent pathogens through the food chain.

In Morocco, street food markets have experienced significant growth in recent years, playing a crucial socio-economic role by providing affordable and accessible foods to urban populations while supporting local livelihoods, particularly for low-income vendors. These vendors are often concentrated in densely populated areas, serving vulnerable groups such as children, the elderly, and low-income families. However, inadequate hygiene practices, unsafe food handling, and poor sanitation pose serious health risks, increasing the likelihood of severe foodborne illnesses, especially among immunocompromised population. Street-vended sugarcane juice has rapidly gained popularity in Morocco; however, despite its widespread consumption, no studies have assessed its microbiological quality, physicochemical properties, or associated health risks. This lack of data hinders the ability of public health authorities and consumers to make informed decisions regarding its safety. To address this gap, our study provides the first comprehensive evaluation of the quality and safety of fresh sugarcane juice sold in Morocco. The findings aim to support improved food safety regulations and enhance consumer protection.

2 Materials and methods

2.1 Sample collection

Sampling was carried out in Beni Mellal city, located in central Morocco, between February and June 2024. Sampling took place in the afternoon in crowded areas, including “Al Massira,” “Safaa,” “University Campus,” and “Central Bus Station” sites. A sample size of 100 samples was obtained for laboratory examination, with 25 samples from each site over the study period, corresponding to approximately five samples per site per month. Street vendors were randomly selected based on their presence at the time of sampling. Most vendors were mobile, except for those at “Al Massira” site, who were stationary. Each sample (~200 mL) was collected in a sterile bag and transported within 30 min at 4°C using a cooler to the Higher School of Technology of Beni Mellal. Upon arrival at the laboratory, samples were analyzed immediately, or, if necessary, stored at 4 ± 1°C and analyzed within 24 h.

2.2 Physicochemical analysis

To characterize the physiochemical properties of sugarcane juice samples, various parameters were assessed, including pH, total titratable acidity (TTA), and total soluble solids (TSS; °Brix). The pH was calculated using a digital pH meter (Milwaukee MW150, Romania) according to the standard method (ISO 1842, 1991). Before use, pH meter was calibrated using buffer solutions at pH 4.00 and pH 7.00, then a sufficient volume of the sample was prepared in a 100 mL beaker to ensure proper electrode immersion. The TSS were measured using a digital refractometer (Milwaukee MA883, Romania) following the producer's guidelines. However, TTA was determined according to the standard method AOAC 942.15 (AOAC, ) and expressed in percentage using the following formula:

Here, Vt denotes the volume of the titrant (NaOH), M is the molarity of NaOH (0.1 M), meq refers to the citric acid equivalence factor (0.070), and Vs indicates the volume of the sample analyzed. The total acidity was reported as grams of citric acid equivalents per 100 mL of sample (g CAE/100 mL).

2.3 Total phenolic, flavonoids, and vitamin C contents

Quantification of total phenolic content (TPC) in sugarcane juice was performed through the Folin-Ciocalteu assay, following established spectrophotometric protocols (Habibi et al., ). The results were reported as milligrams of gallic acid equivalents per 100 mL of juice (mg GAE/100 mL), reflecting the total phenolic content of the samples. The total flavonoid content (TFC) was determined using aluminum chloride colorimetric method, as described previously (Wu et al., 2021), and expressed in milligrams of quercetin equivalent per 100 mL of juice (mg QE/100 mL). To ensure the reliability of the results, the Folin–Ciocalteu method used for the determination of total phenolic content and the aluminum chloride colorimetric method used for the determination of total flavonoid content were validated through the preparation of standard calibration curves using gallic acid and quercetin, respectively, both exhibiting high linearity (R2 > 0.99). However, the vitamin C content was determined directly from juice samples using iodine titration method (Feszterová et al., ), Data are presented as vitamin C equivalents (mg VC/100 mL ± SD), derived from triplicate measurements of each sample.

2.4 Antioxidant activity

DPPH (1,1-diphenyl-2-picryl hydrazyl) scavenging assay was used to determine the antioxidant activity, following a previously published method (Ed-Dra et al., ). DPPH solution was prepared by dissolving 0.04 of DPPH (HiMedia, India) in 1L of methanol (HiMedia, India). Concurrently, serial 2-fold dilutions of sugarcane juice were prepared using methanol. Following this, 0.5 mL of each diluted sample was combined with an equal volume of 0.04 g/L DPPH methanolic solution and vortexed thoroughly. The reaction mixtures were then incubated in darkness at the ambient temperature (25 ± 2°C) for 30 min. Post-incubation, the absorbance (A) was recorded at 517 nm using a visible spectrophotometer (ONDA V-10 PLUS, Italy). The DPPH scavenging activity (%) was determined using the following equation:

L-ascorbic acid served as the reference antioxidant standard. The half-maximal inhibitory concentration (IC50) was derived by non-linear regression analysis of the dose-response curve (percentage inhibition vs. sample concentration), generated using Microsoft Excel (Version 16, Microsoft Corp., USA).

2.5 Microbiological analysis

To assess the microbiological quality of the analyzed samples, serial decimal dilutions were prepared by transferring 1 mL of each sample into 9 mL of sterile physiological saline solution (NaCl 9 g/L; HiMedia, India). Total Aerobic Mesophilic Flora (TAMF) was quantified by spreading 1 mL of each dilution onto Plate Count Agar (PCA; Biokar, Beauvais, France) and incubating at 30 °C for 72 h in accordance with ISO 4833-1 (2013). Total and fecal coliforms were enumerated using Violet Red Bile Agar (VRBA; Biokar), with incubation at 30 °C for 24 h for total coliforms and at 44°C for 24 h for fecal coliforms, following (ISO 4832, 2006). Yeasts and molds were counted on Chloramphenicol Glucose Agar (CGA; Biokar), with incubation at 25°C for 3–5 days as per (ISO 21527-1, 2008). Enumeration of E. coli was performed using Tryptone Bile X-glucuronide (TBX; Biokar) agar, incubated at 44°C for 24 h (ISO 16649-2, 2001). Staphylococci were assessed by surface spreading of 0.1 mL from each dilution on Baird-Parker Agar (BP; Biokar) followed by incubation at 36 °C for 48 hours according to ISO 6888-1 (2021). In addition, the presence of Listeria monocytogenes and Salmonella spp. was investigated in 25 mL of each sample following standard detection protocols previously described (Ed-Dra et al., ; Bouymajane et al., ).

2.6 Biochemical confirmation of E. coli and S. aureus isolates

Presumptive E. coli colonies, characterized by their blue-green appearance on Tryptone Bile X-glucuronide (TBX) agar, were subcultured onto Tryptone Soy Agar (TSA; Biokar, Beauvais, France) for purification. For confirmation, a single colony was transferred into indole-free peptone water (Biokar) and incubated at 36°C for 24 h. Following incubation, 0.5 mL of Kovac's reagent was added to the culture. The development of a red ring at the liquid surface indicated indole production, confirming the identity of the isolates as E. coli. Similarly, suspected Staphylococcus aureus isolates, initially identified by their black or gray colonies with clear halos on Baird-Parker agar, resulting from tellurite reduction and lecithinase activity were purified on TSA. For confirmation, a single colony was inoculated into Brain Heart Infusion (BHI) broth and incubated at 36°C for 24 h. Then, 0.1 mL of the culture was mixed with 0.3 mL of rabbit plasma (Biokar), and the tube was examined for coagulation after 4–6 h and again at 24 h. A positive coagulase reaction confirmed the isolates as S. aureus (Ed-Dra et al., ). The confirmed E. coli and S. aureus isolates were stored in 25% glycerol at −20°C until further use. The reliability of indole production test was confirmed by using E. coli ATCC 25922 as positive control and Salmonella Typhimurium ATCC 14028 as negative control; however, the reliability of coagulase test was confirmed by using S. epidermidis ATCC 12228 as negative control and S. aureus ATCC 29213 as positive control.

2.7 Antibiotic susceptibility assay

The isolated E. coli and S. aureus strains were tested against a panel of antimicrobial agents (Supplementary Tables S2, S3) using disc diffusion method on Muller-Hinton agar (Biokar, Beauvais, France), following the guideline of the European Committee on Antimicrobial Susceptibility Testing (EUCAST, ), and the Clinical and Laboratory Standards Institute (CLSI) (CLSI, ). Isolates with intermediate susceptibility were considered resistant for the purpose of analysis. Those exhibiting resistance to antibiotics from more than two different classes were designated as multidrug-resistant (MDR). The Multiple Antibiotic Resistance (MAR) index was computed by dividing the number of antibiotics to which the isolate was resistant by the total number of antibiotics evaluated (Ed-Dra et al., ). A MAR index >0.2 indicates that the bacterial strain likely originates from a high-risk source with frequent antibiotic exposure. In contrast, a MAR index of 0.2 or below suggests origin from environments with limited antibiotic use. For quality control purposes, S. aureus ATCC 29213 and E. coli ATCC 25922 were employed as reference strains in this study.

2.8 Virulence genes detection

Conventional PCR was used to detect specific virulence genes in the isolated E. coli and S. aureus strains. Boiling method was used for DNA extraction, involving three repeated cycles of boiling at 100°C for 10 min and freezing at −20°C for 15 min, followed by centrifugation at 12,000 × g for 5 min. The resulting supernatant containing genomic DNA was quantified using a NanoDrop spectrophotometer (Berthold Colibri LB 915, Germany). Detection of the sea gene, which encodes enterotoxin production in S. aureus isolates, as well as the stx1 (Shiga-like toxin 1), stx2 (Shiga-like toxin 2) and the hlyA (enterohemolysin) genes in E. coli isolates, was performed according previously published protocols (Table 1). PCR amplification products were analyzed by electrophoresis on a 1.2% agarose gel pre-stained with ethidium bromide. DNA fragment sizes were estimated by comparison with a molecular weight marker (GeneRuler 1 kb Plus DNA Ladder, Thermo Scientific). To ensure the reliability of virulence gene detection, sterile distilled water was used as a negative control, while E. coli ATCC 43895, which harbors the stx1, stx2, and hlyA genes, and S. aureus ATCC 13565, which harbors the sea gene, were used as positive controls.

Table 1

GenesPrimers (5-3)Size (bp)FunctionReferences
seaF: TGCAGGGAACAGCTTTAGGCAA500EnterotoxinSallam et al., 2015
R: GATTAATCCCCTCTGAACCTTCC
stx1F: ACACTGGATGATCTCAGTGG614Shiga-like toxin 1Fagan et al.,
R : CTGAATCCCCCTCCATTATG
stx2F: GTTTTTCTTCGGTATCCTATTCC484Shiga-like toxin 2Sarimehmetoglu et al., 2009
R: GATGCATCTCTGGTCATTGTATTAC
hlyAF: GCATCATCAAGCGTACGTTCC534EnterohemolysinSrivani et al., 2017
R: AATGAGCCAAGCTGGTTAAGCT

Primer sequences used for the amplification of targeted virulence genes.

2.9 Data analysis

Data were compiled and statistically analyzed using Microsoft Excel (New York, USA), with results expressed as mean ± standard deviation (SD). Graphical illustrations and Pearson correlation analysis (significance set at p < 0.05) were conducted using GraphPad Prism software (version 9; GraphPad, San Diego, CA, USA).

3 Results

3.1 Physicochemical characterization

The physicochemical properties of sugarcane juice, including pH, TTA, and TSS, were analyzed, and the results are summarized in Supplementary Table S1. The analyzed sugarcane juice samples had an average pH of 5.23 ± 0.09, with minimum and maximum values of 4.98 and 5.54, respectively, indicating a slightly acidic nature. The TTA, expressed as citric acid equivalents, averaged 0.16 ± 0.02% (g CAE/100 mL), with a minimal value of 0.11% and a maximal value of 0.21%. Additionally, the TSS content, measured in °Brix, averaged 18.48 ± 0.69 °Brix, with values ranging between 17.1 and 19.9 °Brix.

3.2 Determination of bioactive compounds

Biochemical analysis demonstrated that sugarcane juice is rich in bioactive compounds (Supplementary Table S1). The samples contained an average TPC of 90.25 ± 8.02 mg GAE/100 mL, ranging from 77.08 to 110.2 mg GAE/100 mL. Additionally, the average TFC was 46.83 ± 8.79 mg QE/100 mL, with values between 30.08 and 63.25 mg QE/100 mL. Vitamin C concentrations averaged 11.25 ± 1.55 mg/100 mL, with a range between 7.92 and 14.08 mg/100 mL. These bioactive compounds contribute to the antioxidant activity of sugarcane juice, as demonstrated by the DPPH scavenging assay, which yielded an average IC50 of 72.45 ± 7.07 g/L (ranged between 62.18 and 85.69 g/L). In comparison, the IC50 of the standard (ascorbic acid) was significantly lower at 0.045 ± 0.02 g/L. Notably, a lower IC50 value indicates higher antioxidant potential.

Additionally, Pearson correlation analysis revealed a strong correlation between the TPC and antioxidant activity (measured by IC50) (r = −0.92; 95% CI: −0.94 to −0.88; R2 = 0.84; p < 0.0001), as well as between TFC and antioxidant activity (r = −0.92; 95% CI: −0.94 to −0.88; R2 = 0.84; p < 0.0001) (Figures 1A, B).

Figure 1

3.3 Microbiological assessment

This study investigated the microbiological quality of sugarcane juice samples, with the quantitative findings illustrated in Figure 2. The mean count of Total Aerobic Mesophilic Flora (TAMF) was 5.79 ± 0.36 log CFU/mL, with observed values ranging from 4.90 to 6.43 log CFU/mL, indicating a substantial microbial load. Total coliforms (TC) exhibited an average concentration of 3.78 ± 0.33 log CFU/mL, within a range of 2.30 to 4.22 log CFU/mL. Fecal coliforms (FC) were present at an average of 1.67 ± 0.34 log CFU/mL, with counts varying between 0.70 and 2.32 log CFU/mL. Fungal contamination, represented by yeast and mold counts, showed a relatively narrow distribution, with a mean of 3.73 ± 0.23 log CFU/mL and values between 3.18 and 3.24 log CFU/mL. Staphylococci were detected at an average level of 2.81 ± 0.23 log CFU/mL, ranging from 1.78 to 3.24 log CFU/mL. Among the tested samples, E. coli was identified in 77 cases, with a mean count of 1.31 ± 0.26 log CFU/mL, and concentrations ranging from 0.48 to 1.81 log CFU/mL. Conversely, S. aureus was detected in only 7 samples, with a mean count of 1.94 ± 0.16 log CFU/mL and a range of 1.70 to 2.18 log CFU/mL. These findings underscore significant variability in microbial contamination, suggesting potential lapses in hygienic practices and the need for enhanced quality control in the preparation and distribution of sugarcane juice.

Figure 2

3.4 Antimicrobial susceptibility profiles

The isolated bacterial strains were subjected to antimicrobial susceptibility testing against a panel of antibiotics representing various classes. The outcomes of these tests are detailed in Table 2, with specific results for E. coli and S. aureus presented in Supplementary Tables S2, S3, respectively.

Table 2

Antimicrobial agentsCodeE. coli(n = 77)S. aureus(n = 7)
S (%)R (%)S (%)R (%)
Amoxicillin–clavulanic acid (20–10 μg)AMC71 (92.21%)6 (7.79%)NTNT
Ampicillin (10 μg)AMP15 (19.48%)62 (80.52%)NTNT
Penicillin (10 U)PNTNT1 (14.29%)6 (85.71%)
Oxacillin (5 μg)OXNTNT7 (100%)0 (0%)
Cefoxitin (30 μg)FOX77 (100%)0 (0%)7 (100%)0 (0%)
Cefuroxime (30 μg)CXM71 (92.21%)6 (7.79%)NTNT
Ceftriaxone (30 μg)CRO77 (100%)0 (0%)NTNT
Cefotaxime (30 μg)CTX77 (100%)0 (0%)NTNT
Streptomycin (10 μg)S19 (24.68%)58 (75.32%)2 (28.57%)5 (71.43%)
Gentamicin (10 μg)GN76 (98.70%)1 (1.30%)7 (100%)0 (0%)
Kanamycin (30 μg)K74 (96.10%)3 (3.90%)7 (100%)0 (0%)
Fusidic acid (10 μg)FDNTNT7 (100%)0 (0%)
Nalidixic acid (30 μg)NA75 (97.40%)2 (2.60%)NTNT
Ciprofloxacin (5 μg)CIP75 (97.40%)2 (2.60%)6 (85.71%)1 (14.29%)
Enrofloxacin (5 μg)ENR75 (97.40%)2 (2.60%)6 (85.71%)1 (14.29%)
Erythromycin (15 μg)ENTNT7 (100%)0 (0%)
Tetracycline (30 μg)TE44 (57.14%)33 (42.86%)3 (42.86%)4 (57.14%)
Doxycycline (30 μg)DXTNTNT5 (71.43%)2 (28.57%)
Vancomycin (30 μg)VANTNT7 (100%)0 (0%)
Chloramphenicol (30 μg)C72 (93.51%)5 (6.49%)6 (85.71%)1 (14.29%)
Trimethoprim–sulfamethoxazole (1.25 μg−23.75 μg)SXT59 (76.62%)18 (23.38%)7 (100%)0 (0%)
Clindamycin (2 μg)CDNTNT7 (100%)0 (0%)
Imipenem (10 μg)IPM77 (100%)0 (0%)NTNT

Antimicrobial susceptibility of E. coli and S. aureus isolates to the tested antimicrobial agents.

NT, not tested; S, susceptible; R, resistant.

Among the E. coli isolates (n = 77), antimicrobial susceptibility testing showed a high prevalence of resistance to ampicillin (80.52%), followed by streptomycin (75.32%), tetracycline (42.86%), and trimethoprim-sulfamethoxazole (23.38%), as detailed in Table 2. All isolates were fully susceptible to cefoxitin, ceftriaxone, cefotaxime, and imipenem. The isolates were distributed across 17 distinct AMR profiles, with 31 isolates (40.26%) classified as multidrug-resistant (MDR) due to resistance to more than two antibiotic classes (Table 3). MAR index evaluation revealed that 19 isolates (24.67%) had an index >0.2, suggesting exposure to environments with frequent antibiotic usage and indicating a considerable public health risk (Supplementary Table S2).

Table 3

No. of antimicrobialsResistance profileNo. of IsolatesMAR*
080
1AMP90.06
S50.06
2AMP, S220.13
S, TE20.13
3AMP, S, TE110.19
AMP, TE, SXT10.19
4AMP, S, TE, SXT80.25
AMP, S, K, TE10.25
5AMC, AMP, CXM, S, TE10.31
AMC, AMP, S, TE, SXT10.31
6AMC, AMP, S, TE, C, SXT20.38
AMP, CXM, S, TE, C, SXT10.38
AMP, CXM, S, GN, K, TE, SXT10.38
AMC, AMP, CXM, S, TE, SXT20.38
7AMP, S, NA, CIP, ENR, TE, SXT10.44
9AMP, CXM, S, NA, CIP, ENR, TE, C, SXT10.56

Antimicrobial resistance profiles of E. coli isolates (n = 77).

*MAR, Multiple Antibiotic Resistance index; AMP, ampicillin; AMC, amoxicillin-clavulanic acid; S, streptomycin; TE, tetracycline; SXT, trimethoprim-sulfamethoxazole; K, kanamycin; GN, gentamicin; CXM, cefuroxime; C, chloramphenicol; NA, nalidixic acid; CIP, ciprofloxacin; ENR, enrofloxacin.

As for the S. aureus isolates (n = 7), resistance was most frequently observed against penicillin (85.71%), followed by streptomycin (71.43%) and tetracycline (57.14%). All isolates were susceptible to oxacillin, cefoxitin, gentamicin, kanamycin, fusidic acid, erythromycin, vancomycin, trimethoprim-sulfamethoxazole, and clindamycin (Table 2). Each of the seven isolates exhibited a unique AMR profile, with 3 isolates (42.86%) identified as MDR (Table 4). Additionally, 3 isolates (42.86%) recorded MAR indices above 0.2, indicating a potential link to high-risk contamination sources (Supplementary Table S3).

Table 4

No. of antimicrobialsResistance profileNo. of isolatesMAR*
010
1P10.06
2P, S10.13
3P, S, TE10.19
4P, S, TE, C10.25
P, S, TE, DXT10.25
6P, S, CIP, ENR, TE, DXT10.38

Antimicrobial resistance profiles of S. aureus isolates (n = 7).

*MAR, Multiple Antibiotic Resistance Index; P, penicillin; S, streptomycin; TE, tetracycline; DXT, doxycycline; C, chloramphenicol; CIP, ciprofloxacin; ENR, enrofloxacin.

3.5 Virulence genes

Virulence genes detection was performed using conventional PCR, and the results are summarized in Supplementary Tables S2, S3. Among the S. aureus isolates, the sea gene was detected in only one isolate (14.28%). For the E. coli isolates, screening for Shiga toxin genes (stx1, stx2) and hlyA revealed that 10 isolates carried at least one virulence gene. Specifically, stx1 was detected in 8 isolates (10.39%) and stx2 in 5 isolates (6.49%), while hlyA was not detected in any of the examined isolates (Figure 3). Furthermore, three E. coli isolates (3.89%) were found to harbor both stx1 and stx2 genes.

Figure 3

4 Discussion

In recent years, the consumption of fruit juices has markedly increased, driven by their high nutritional value and the growing public perception of their associated health benefits. In Morocco, sugarcane juice is a popular beverage typically extracted mechanically from cane stalks, filtered, and sold fresh by street vendors without undergoing any prior treatment. However, the absence of suitable treatment may increase the risk of microbial contamination, posing potential food safety hazards to consumers. Despite these concerns, no studies in Morocco have yet evaluated quality and safety of fresh sugarcane juice. In this regard, we conducted this study to assess the quality and safety of sugarcane juice distributed by street vendors, providing critical data to inform public health measures.

In this study, we evaluated the physicochemical characteristics of sugarcane juice sold by street vendors in Beni Mellal, Morocco. The results revealed that the analyzed samples had pH values ranging from 4.98 to 5.54, indicating a slightly acidic nature. These values align with findings from India and Pakistan, where sugarcane juice exhibited a pH of 5.2 (Kamble et al., 2021; Irshad et al., 2024), as well as with studies from Bangladesh, where pH values ranged between 4.97 and 5.35 (Akter et al., ). A study conducted in Malaysia showed slightly higher pH values with an average of 5.8 ± 0.05 (Adulvitayakorn et al., ), while a study carried out in Tanzania reported slightly lower pH values, between 4.8 and 4.9 (Issa-Zacharia and Rwabunywenge, 2023). Additionally, our findings indicated that the TTA varied from 0.11% to 0.21%, which is consistent with the results of Kamble et al. (2021) in India (0.2%) and Akter et al. () in Bangladesh (0.22–0.37%).Our study showed higher TTA values than that reported in Tanzania (average of 0.08%) (Issa-Zacharia and Rwabunywenge, 2023) and Malaysia (average of 0.032 ± 0.006%) (Adulvitayakorn et al., ), but lower than that found in Pakistan (average of 0.31%) (Irshad et al., 2024). Furthermore, the analyzed samples exhibited TSS values between 17.1 and 19.9 °Brix, with an average of 18.48 ± 0.69 °Brix. These values are comparable to those reported in India (18 °Brix) by Kamble et al. (2021), and Pakistan (18.5 °Brix) by Irshad et al. (2024). However, they are higher than those observed in Bangladesh (between 7.58 and 12.99 °Brix) (Akter et al., ) and Malaysia (10.8 ± 0.12 °Brix) (Adulvitayakorn et al., ). A study from Tanzania found TSS values between 12.2 and 22.1 °Brix (Issa-Zacharia and Rwabunywenge, 2023). These results indicate that sugarcane juice is rich in TSS, has a slightly acidic pH, and contains low TTA. While it can be considered a nutritious source for consumers, its physicochemical properties may also create a favorable environment for the growth of spoilage and pathogenic microorganisms.

The quantification of bioactive compounds revealed that sugarcane juice is rich in TPC, with values ranging from 77.08 to 110.2 mg GAE/100 mL (average of 90.25 ± 8.02 mg GAE/100 mL), and TFC, with values between 30.08 and 63.25 mg QE/100 mL (average of 46.83 ± 8.79 mg QE/100 mL). Additionally, notable amounts of vitamin C were detected, ranging from 7.92 to 14.08 mg/100 mL (average of 11.25 ± 1.55 mg/100 mL). Previous studies have also highlighted the abundance of bioactive compounds in sugarcane juice, though reported values vary. For instance, Irshad et al. (2024) documented a TPC of 48.5 mg/100 mL and a TFC of 37.61 mg/100 mL in fresh sugarcane juice. While other studies reported an average value of 374 mg/100 mL for TPC (Adulvitayakorn et al., ), and 2.60 mg/100 mL for TFC (Duarte-Almeida et al., ). Notably, the levels of vitamin C detected in this study were lower compared to the average concentration of 49.97 mg/100 mL reported by Irshad et al. (2024). Additionally, we report a strong correlation (p < 0.05) between TPC, TFC, and antioxidant activity, measured via DPPH scavenging activity, reinforcing the functional potential of sugarcane juice. The presence of these bioactive compounds' positions sugarcane juice as a nutrient-rich, health-promoting beverage with growing global demand (Arif et al., ; Hewawansa et al., 2024). Indeed, variability in bioactive compound concentrations of sugarcane juice may be attributed to factors such as environmental conditions, soil properties, extraction methods, and sugarcane varieties (Duarte-Almeida et al., ; Rodrigues et al., 2021; Hewawansa et al., 2024). Furthermore, studies indicate that bioactive compounds can degrade during storage (Irshad et al., 2024), necessitating the development of effective preservation techniques to maintain their nutritional quality for large-scale industrial applications (Adulvitayakorn et al., ; Tarafdar et al., 2021; Irshad et al., 2024).

Microbiological analysis showed that the sugarcane juice samples were highly contaminated with TAMF, TC, FC, yeasts, and molds. Additionally, 77 samples (77%) were contaminated with E. coli and 7 samples (7%) were contaminated with S. aureus. However, none of the samples studied were contaminated with Salmonella or L. monocytogenes. This contamination reflects poor hygienic conditions during the preparation and sale of the juice (da Costa Messias et al., ). The presence of FC and E. coli indicates poor hygienic practices by street vendors. Additionally, the raw material (sugarcane) may be contaminated with fecal bacteria, likely due to the use of polluted irrigation water (Akinde et al., ; Amjad et al., ), raising concerns about the potential for fecal-oral transmission of pathogens. Previous studies have reported high levels of fecal bacteria, such as E. coli, in irrigation water (Tahri et al., 2021). Consequently, the presence of fecal-origin microorganisms can lead to foodborne illnesses, typically causing self-limiting diarrhea in immunocompetent individuals but potentially severe disease in immunocompromised persons (Castro-Rosas et al., ; Chen et al., ). Moreover, S. aureus is recognized as a major foodborne pathogen that can secrete pathogenic enterotoxins like A, B, C, D, E, and others (Argudín et al., ; Ed-Dra et al., ; Grispoldi et al., ), characterized by rapid infection where symptoms like vomiting, stomach pain, and diarrhea appear after 2–6 h (Ünüvar, 2018). Thus, the detection of S. aureus in fresh sugarcane juice is a major concern for public health. Furthermore, yeast contamination can contribute to spoilage, as yeasts metabolize the sugars in the juice, leading to alcoholic fermentation and the low of organoleptic properties (Bevilacqua et al., ). Molds contaminations are also concerning, as they may result in mycotoxins production during storage, posing a significant public health risk (Nan et al., 2022; Zhang et al., 2025).

Antimicrobial susceptibility assessment revealed that both E. coli and S. aureus exhibit high resistance to penicillin-class antimicrobials (ampicillin and penicillin), streptomycin, and tetracycline. These findings align with previous studies conducted in Morocco and other regions (Tan et al., 2014; Ed-Dra et al., ; El Ftouhy et al., ), where the prolonged use of these older antimicrobial agents in human and veterinary medicine has contributed to the emergence of bacterial resistance (Xu et al., 2021). The misuse of antimicrobials, particularly in veterinary settings for prophylaxis, therapy, and growth promotion, has further exacerbated AMR (Odey et al., 2023; Tang et al., 2023). Additionally, bacterial exposure to environmental stressors can drive resistance through co-resistance mechanisms (Li et al., 2022; Wang et al., 2023). Consequently, resistant isolates may disseminate into the environment, contaminating soil, water, crops, and ultimately plant-based foods (Jung and Rubin, 2020). Our results also indicate a high prevalence of MDR, with 40.26% (31/77) of E. coli and 42.86% (3/7) of S. aureus isolates exhibiting MDR profiles. This poses significant public health concern and severely limits treatment options. Furthermore, 24.67% (19/77) of E. coli and 42.86% (3/7) of S. aureus isolates had a MAR index >0.2, suggesting that they originated from high-risk contamination sources.

Furthermore, the detection of virulence genes showed the detection of the sea gene in one S. aureus isolate (14.28%). This gene encodes staphylococcal enterotoxin A, a toxin characterized by its superantigenic properties, which induce a massive immune response (Hu et al., 2021; Zhu et al., 2023). In addition, it is highly stable under heat treatment and resistant to proteolytic enzymes, allowing it to remain active even after food processing (Zhu et al., 2023). Consequently, the presence of such toxins in food products is a significant public health concern, as they can lead to rapid and severe intoxication in consumers (Grispoldi et al., ). We also detected the presence of Shiga toxin-encoding genes stx1 and stx2 in 8 (10.39%) and 5 (6.49%) E. coli isolates, respectively, with both genes (stx1 and stx2) detected in 3 (3.89%) isolates. These genes are recognized as major virulence factors of Shiga toxin-producing E. coli (STEC), primarily associated with E. coli O157:H7 (Sarimehmetoglu et al., 2009), but also found in various non-O157 serogroups such as O26, O103, O111, and O145, among others (Hoyle et al., 2021). The presence of E. coli strains harboring these virulence factors in food products, particularly fresh juice, poses serious public health risks due to their potential to cause severe illness, including hemolytic uremic syndrome (Freedman et al., ).

Given these findings, sugarcane juice may serve as a key transmission route for MDR and virulent bacterial pathogens to humans. To mitigate this risk, effective measures must be implemented to eliminate these pathogens while preserving the nutritional quality of the product. These measures can include:

  • - Implementation of strict hygiene regulations and regular inspections for street vendors, including mandatory food safety training.

  • - Ensuring the quality of raw sugarcane by promoting the use of clean, treated irrigation water and monitoring agricultural practices to minimize fecal contamination at the source.

  • - Requiring vendors to use clean, sanitized equipment and store sugarcane and juice under proper refrigeration to limit microbial growth. In this regard, public awareness campaigns can help educate both vendors and consumers about the risks of unsafe juice consumption.

  • - Implementation and integration of routine monitoring for AMR in foodborne pathogens into national food safety programs to prevent the spread of resistant strains through the food chain.

5 Conclusions

This study demonstrated that sugarcane juice is rich in nutritional compounds, marked with the abundance of TSS, TTA, TPC, TFC, and vitamin C. Its slightly acidic pH further enhances its appeal as a favorable beverage for consumers. However, microbiological analysis revealed contamination with various microorganisms. The presence of fecal coliforms indicates poor respect for good hygienic practices and suggests potential fecal contamination sources. Moreover, the detection of MDR and virulent E. coli and S. aureus poses significant public health concerns, underscoring the need for stricter food safety measures and improved hygiene practices among street vendors. Consequently, the consumption of fresh sugarcane juice may pose a risk of foodborne illnesses, highlighting the necessity for sustainable preservation methods that reduce microbial contaminants while retaining their nutritional quality. Although our study provides valuable insights, certain limitations should be noted. Future research should broaden the scope to evaluate both the quality and microbiological safety of raw plant materials utilized in sugarcane juice preparation, alongside assessing street vendors' compliance with hygienic practices, to better identify potential risk factors associated with contamination by highly pathogenic microorganisms.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary material, further inquiries can be directed to the corresponding authors.

Author contributions

AE-D: Validation, Investigation, Formal analysis, Software, Data curation, Writing – original draft, Methodology, Conceptualization, Resources. AA: Validation, Project administration, Resources, Funding acquisition, Conceptualization, Writing – review & editing, Supervision. EA: Data curation, Writing – review & editing, Formal analysis. LN: Writing – review & editing, Investigation, Conceptualization, Methodology, Formal analysis.

Funding

The authors declare that financial support was received for the research and/or publication of this article. This work was supported and funded by the Deanship of Scientific Research at Imam Mohammad Ibn Saud Islamic University (IMSIU) (grant number IMSIU-DDRSP2501).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.

Generative AI statement

The author(s) declare that no Gen AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fsufs.2025.1628211/full#supplementary-material

References

  • 1

    AdulvitayakornS.AzhariS. H.HasanH. (2020). The effects of conventional thermal, microwave heating, and thermosonication treatments on the quality of sugarcane juice. J. Food Process. Preserv.44:e14322. 10.1111/jfpp.14322

  • 2

    AgrimontiC.LauroM.VisioliG. (2021). Smart agriculture for food quality: facing climate change in the 21st century. Crit. Rev. Food Sci. Nutr.61, 971981. 10.1080/10408398.2020.1749555

  • 3

    AiyedunS. O.OnarindeB. A.SwainsonM.DixonR. A. (2021). Foodborne outbreaks of microbial infection from fresh produce in Europe and North America: a systematic review of data from this millennium. Int. J. Food Sci. Technol.56, 22152223. 10.1111/ijfs.14884

  • 4

    AkindeS. B.SundayA. A.AdeyemiF. M.FakayodeI. B.OluwajideO. O.AdebunmiA. A.et al. (2016). Microbes in irrigation water and fresh vegetables: potential pathogenic bacteria assessment and implications for food safety. Appl. Biosaf.21, 8997. 10.1177/1535676016652231

  • 5

    AkterN.LinkonK. M. M. R.AkterM.HossainM. A.RahmanM. M.KhanT.et al. (2024). Assessment of physico-chemical and microbial quality of sugarcane juice sold by street vendors in three regions of Bangladesh. Food Nutr. Sci.15, 263276. 10.4236/fns.2024.154017

  • 6

    AmjadS.RiazS.SaleeemF. (2022). Sugarcane juice as a potential source of antibiotic resistant Salmonella spp. Pak. J. Biotechnol.19, 103112. 10.34016/pjbt.2022.19.2.103

  • 7

    AOACR. R. (2016). Official Methods of Analysis, 22nd Edn.. AOAC International. Available online at: https://www.aoac.org/official-methods-of-analysis/ (accessed March 21, 2025).

  • 8

    ArgudínM. Á.MendozaM. C.RodicioM. R. (2010). Food poisoning and Staphylococcus aureus enterotoxins. Toxins2, 17511773. 10.3390/toxins2071751

  • 9

    ArifS.BatoolA.NazirW.KhanR. S.KhalidN. (2019). Physiochemical characteristics nutritional properties and health benefits of sugarcane juice. Non Alcohol. Bever.6, 227257. 10.1016/B978-0-12-815270-6.00008-6

  • 10

    BevilacquaA.SperanzaB.CampanielloD.SinigagliaM.CorboM. R. (2013). Inactivation of spoiling yeasts of fruit juices by pulsed ultrasound. Food Bioprocess Technol.7, 21892197. 10.1007/s11947-013-1178-5

  • 11

    BouymajaneA.Rhazi FilaliF.OulghaziS.LafkihN.Ed-DraA.AboulkacemA.et al. (2021). Occurrence, antimicrobial resistance, serotyping and virulence genes of Listeria monocytogenes isolated from foods. Heliyon7:e06169. 10.1016/j.heliyon.2021.e06169

  • 12

    ButuM.RodinoS. (2019). “Fruit and vegetable-based beverage - nutritional properties and health benefits,” in Natural Beverages, eds. A. M. Grumezescu and A.M. Holban (Cambridge, MA: Academic Press), 303338. 10.1016/B978-0-12-816689-5.00011-0

  • 13

    Castro-RosasJ.Cerna-CortésJ. F.Méndez-ReyesE.Lopez-HernandezD.Gómez-AldapaC. A.Estrada-GarciaT. (2012). Presence of faecal coliforms, Escherichia coli and diarrheagenic E. coli pathotypes in ready-to-eat salads, from an area where crops are irrigated with untreated sewage water. Int. J. Food Microbiol.156, 176180. 10.1016/j.ijfoodmicro.2012.03.025

  • 14

    ChenJ.Ed-DraA.ZhouH.WuB.ZhangY.YueM. (2022). Antimicrobial resistance and genomic investigation of non-typhoidal Salmonella isolated from outpatients in Shaoxing city, China. Front. Public Health10:988317. 10.3389/fpubh.2022.988317

  • 15

    ChinnaduraiC. (2017). “Potential health benefits of sugarcane,” in Sugarcane Biotechnology: Challenges and Prospects, ed. C. Mohan (Cham: Gewerbestrasse, AG; Springer), 112. 10.1007/978-3-319-58946-6_1

  • 16

    CLSI (2020). Performance Standards for Antimicrobial Susceptibility Testing, 30th Edn. Wayne, PA: CLSI.

  • 17

    da Costa MessiasA. C. M.Resende PaixãoE. V.Santana MarquesL. T.da Silva RosaL. M.de QueirozP. H. P.da SilvaC. A. (2024). Microbiological quality of sugarcane juice sold in Goiânia/GO and risks to public health. Rev. Patol. Trop.53, 277287. 10.5216/rpt.v53i4.80867

  • 18

    DhansuP.RamB.SinghA. K.TomarS. K.KaruppaiyanR.KumarR.et al. (2023). Different treatments for sugarcane juice preservation. Foods12:311. 10.3390/foods12020311

  • 19

    Duarte-AlmeidaJ. M.SalatinoA.GenoveseM. I.LajoloF. M. (2011). Phenolic composition and antioxidant activity of culms and sugarcane (Saccharum officinarum L.) products. Food Chem.125, 660664. 10.1016/j.foodchem.2010.09.059

  • 20

    Ed-DraA.FilaliF. R.BouymajaneA.BenhallamF.El AllaouiA.ChaibaA.et al. (2018). Antibiotic Susceptibility profile of Staphylococcus aureus isolated from sausages in Meknes, Morocco. Vet. World11, 14591465. 10.14202/vetworld.2018.1459-1465

  • 21

    Ed-DraA.FilaliF. R.KarraouanB.El AllaouiA.AboulkacemA.BouchrifB. (2017). Prevalence, molecular and antimicrobial resistance of Salmonella isolated from sausages in Meknes, Morocco. Microb. Pathog.105, 340345. 10.1016/j.micpath.2017.02.042

  • 22

    Ed-DraA.FilaliF. R.KhayiS.OulghaziS.BouchrifB.El AllaouiA.et al. (2019). Antimicrobial resistance, virulence genes, and genetic diversity of Salmonella enterica isolated from sausages. Eur. J. Microbiol. Immunol.9, 5661. 10.1556/1886.2018.00035

  • 23

    Ed-DraA.FilaliF. R.PrestiV.LoZ.ekkori, B.NalboneL.ElsharkawyE. R.et al. (2021). Effectiveness of essential oil from the artemisia herba-alba aerial parts against multidrug-resistant bacteria isolated from food and hospitalized patients. Biodiversitas22, 29953005. 10.13057/biodiv/d220753

  • 24

    Ed-DraA.NalboneL.ShahatA. A.LaarajS.FarihiA.MoujaneS.et al. (2025). Antilisterial activity of Thymus vulgaris essential oil: in vitro, in situ, and in silico investigations. Microb. Pathog.204:107557. 10.1016/j.micpath.2025.107557

  • 25

    El FtouhyF. Z.HmyeneA.NacerS.KadiriA.CharratN.FagrachA.et al. (2023). Antibiotic resistance of Escherichia coli and Salmonella species isolated from table eggs in Morocco. World's Vet. J.13, 167174. 10.54203/scil.2023.wvj17

  • 26

    EUCAST (2024). European Committee on Antimicrobial Susceptibility Testing. Växjö: EUCAST.

  • 27

    FaganP. K.HornitzkyM. A.BettelheimK. A.DjordjevicS. P. (1999). Detection of shiga-like toxin (stx1 and stx2), intimin (eaeA), and enterohemorrhagic Escherichia coli (EHEC) hemolysin (EHEC hlyA) genes in animal feces by multiplex PCR. Appl. Environ. Microbiol.65, 868872. 10.1128/AEM.65.2.868-872.1999

  • 28

    FeszterováM.MišiakováM.KowalskaM. (2023). Bioactive vitamin C content from natural selected fruit juices. Appl. Sci.13:3624. 10.3390/app13063624

  • 29

    FreedmanS. B.van de KarN. C. A. J.TarrP. I. (2023). Shiga toxin–producing Escherichia coli and the hemolytic–uremic syndrome. N. Engl. J. Med.389, 14021414. 10.1056/NEJMra2108739

  • 30

    GrispoldiL.KaramaM.ArmaniA.HadjicharalambousC.Cenci-GogaB. T. (2021). Staphylococcus aureus enterotoxin in food of animal origin and staphylococcal food poisoning risk assessment from farm to table. Ital. J. Anim. Sci.20, 677690. 10.1080/1828051X.2020.1871428

  • 31

    GurtlerJ. B.GibsonK. E. (2022). Irrigation water and contamination of fresh produce with bacterial foodborne pathogens. Curr. Opin. Food Sci.47:100889. 10.1016/j.cofs.2022.100889

  • 32

    HabibiF.ShahidM. A.SpicerR. L.VoiniciucC.KimJ.GmitterF. G.et al. (2024). Postharvest storage temperature strategies affect anthocyanin levels, total phenolic content, antioxidant activity, chemical attributes of juice, and physical qualities of blood orange fruit. Food Chem. Adv.4:100722. 10.1016/j.focha.2024.100722

  • 33

    HewawansaU. H. A. J.HoughtonM. J.BarberE.CostaR. J. S.KitchenB.WilliamsonG. (2024). Flavonoids and phenolic acids from sugarcane: distribution in the plant, changes during processing, and potential benefits to industry and health. Compr. Rev. Food Sci. Food Saf.23:e13307. 10.1111/1541-4337.13307

  • 34

    HoyleD. V.KeithM.WilliamsonH.MacleodK.MathieH.HandelI.et al. (2021). Prevalence and epidemiology of non-O157 Escherichia coli serogroups O26, O103, O111, and O145 and shiga toxin gene carriage in Scottish Cattle, 2014–2015. Appl. Environ. Microbiol.87, 118. 10.1128/AEM.03142-20

  • 35

    HuD. L.LiS.FangR.OnoH. K. (2021). Update on molecular diversity and multipathogenicity of staphylococcal superantigen toxins. Anim. Dis.1, 115. 10.1186/s44149-021-00007-7

  • 36

    IfedineziO. V.NnajiN. D.AnumuduC. K.EkwuemeC. T.UhegwuC. C.IhenetuF. C.et al. (2024). Environmental antimicrobial resistance: implications for food safety and public health. Antibiotics13:1087. 10.3390/antibiotics13111087

  • 37

    IrshadU.ArshadM. U.ImranA.RasheedM.BansaP.Medha DeorariM.et al. (2024). Nutritional, physicochemical, and chemical characterization of carbonated sugarcane juice. J. Food22:2390006. 10.1080/19476337.2024.2390006

  • 38

    ISO 16649-2R. R. (2001). Microbiology of Food and Animal Feeding Stuffs. Horizontal Method for the Enumeration of Beta-Glucuronidase-Positive Escherichia coli. Part 2: Colony-Count Technique at 44 Degrees C Using 5-Bromo-4-Chloro-3-Indolyl Beta-D-Glucuronide. Available online at: https://www.iso.org/standard/29824.html (accessed December 15, 2024).

  • 39

    ISO 1842R. R. (1991). Fruit and Vegetable Products: Determination of pH. Geneva: International Organization for Standardization. Available online at: https://www.iso.org/standard/6500.html (accessed March 21, 2025).

  • 40

    ISO 21527-1R. R. (2008). Microbiology of Food and Animal Feeding Stuffs. Horizontal Method for the Enumeration of Yeasts and Moulds, Part 1: Colony Count Technique in Products With Water Activity Greater Than 0.95. Geneva. Available online at: https://www.iso.org/fr/standard/38275.html (accessed April 5, 2025).

  • 41

    ISO 4832R. R. (2006). Microbiology of Food and Animal Feeding Stuffs. Horizontal Method for the Enumeration of Coliforms: Colony-Count Technique. Available online at: https://www.iso.org/standard/38282.html (accessed December 15 2024).

  • 42

    ISO 4833-1R. R. (2013). Microbiology of the Food Chain. Horizontal Method for the Enumeration of Microorganisms. Part 1: Colony Count at 30°C by the Pour Plate Technique. Available online at: https://www.iso.org/standard/53728.html (accessed December 15, 2024).

  • 43

    ISO 6888-1R. R. (2021). Microbiology of the Food Chain. Horizontal Method for the Enumeration of Coagulase-Positive Staphylococci (Staphylococcus aureus and Other Species), Part 1: Method Using Baird-Parker Agar Medium. Genova. Available online at: https://www.iso.org/fr/standard/76672.html (accessed April 5, 2025).

  • 44

    Issa-ZachariaA.RwabunywengeS. P. (2023). Evaluation of bacteriological quality and safety of sugarcane juice locally processed and vended in Dar es Salaam City, Tanzania. J. Food Saf. Hyg.9, 282298. 10.18502/jfsh.v9i4.15003

  • 45

    JungD.RubinJ. E. (2020). Identification of antimicrobial resistant bacteria from plant-based food products imported into Canada. Int. J. Food Microbiol.319:108509. 10.1016/j.ijfoodmicro.2020.108509

  • 46

    KambleH. A.GatadeA. A.SahooA. K.AnnapureU. S. (2021). Effect of blanching treatment on antioxidant activity and color values of sugarcane juice. Mater. Today Proc.47, 56635667. 10.1016/j.matpr.2021.03.706

  • 47

    KarwowskaE. (2024). Antibiotic resistance in the farming environment. Appl. Sci.14:5776. 10.3390/app14135776

  • 48

    KhmaissaM.Zouari-MechichiH.SciaraG.RecordE.MechichiT. (2024). Pollution from livestock farming antibiotics an emerging environmental and human health concern: a review. J. Hazard. Mater. Adv.13:100410. 10.1016/j.hazadv.2024.100410

  • 49

    LeeS.HanA.JoS.CheonH.SongH.JangA. R.et al. (2021). Microbiological quality and safety of commercial fresh fruit and vegetable juices in Korea. LWT152:112432. 10.1016/j.lwt.2021.112432

  • 50

    LenziA.MarvasiM.BaldiA. (2021). Agronomic practices to limit pre- and post-harvest contamination and proliferation of human pathogenic Enterobacteriaceae in vegetable produce. Food Control119:107486. 10.1016/j.foodcont.2020.107486

  • 51

    LiY.Ed-DraA.TangB.KangX.MüllerA.KehrenbergC.et al. (2022). Higher tolerance of predominant Salmonella serovars circulating in the antibiotic-free feed farms to environmental stresses. J. Hazard. Mater.468:129476. 10.1016/j.jhazmat.2022.129476

  • 52

    MandalS.MandalS. (2018). Multiple antibiotic resistance indices of potential pathogenic bacteria isolated from street vended fruit and sugarcane juices, Malda Town, India. Acta Sci. Pharmaceut. Sci. 2, 8994.

  • 53

    MurrayL. M.HayesA.SnapeJ.Kasprzyk-HordernB.GazeW. H.MurrayA. K. (2024). Co-selection for antibiotic resistance by environmental contaminants. NPJ Antimicrob. Resist.2, 113. 10.1038/s44259-024-00026-7

  • 54

    NaghaviM.VollsetS. E.IkutaK. S.SwetschinskiL. R.GrayA. P.WoolE. E.et al. (2024). Global burden of bacterial antimicrobial resistance 1990–2021: a systematic analysis with forecasts to 2050. Lancet404, 11991226. 10.1016/S0140-6736(24)01867-1

  • 55

    NanM.XueH.BiY. (2022). Contamination, detection and control of mycotoxins in fruits and vegetables. Toxins14:309. 10.3390/toxins14050309

  • 56

    NeggaziI.Colás-MedàP.ViñasI.AlegreI. (2024). Microbiological quality and safety of non-treated fresh and squeezed juices from supermarkets in Lleida, Spain. Int. J. Food Sci. Technol.59, 47164722. 10.1111/ijfs.17198

  • 57

    OdeyT. O. J.TanimowoW. O.AfolabiK. O.JahidI. K.ReubenR. C. (2023). Antimicrobial use and resistance in food animal production: food safety and associated concerns in Sub-Saharan Africa. Int. Microbiol.27, 123. 10.1007/s10123-023-00462-x

  • 58

    PanigrahiC.ShaikhA. E. Y.BagB. B.MishraH. N.DeS. (2021). A technological review on processing of sugarcane juice: spoilage, preservation, storage, and packaging aspects. J. Food Process Eng.44:e13706. 10.1111/jfpe.13706

  • 59

    RendaG.SöhretogluD. (2024). Fruit juices: chemical compositions and health benefits. Phytochem. Rev.24, 21752202. 10.1007/S11101-024-10013-5

  • 60

    RodriguesN. P.BrochierB.de MedeirosJ. K.MarczakL. D. F.MercaliG. D. (2021). Phenolic profile of sugarcane juice: effects of harvest season and processing by ohmic heating and ultrasound. Food Chem.347:129058. 10.1016/j.foodchem.2021.129058

  • 61

    SalamM. A.Al-AminM. Y.SalamM. T.PawarJ. S.AkhterN.RabaanA. A.et al. (2023). Antimicrobial resistance: a growing serious threat for global public health. Healthcare11:1946. 10.3390/healthcare11131946

  • 62

    SallamK. I.Abd-ElghanyS. M.ElhadidyM.TamuraT. (2015). Molecular characterization and antimicrobial resistance prof ile of methicillin-resistant Staphylococcus aureus in retail chicken. J. Food Prot.78, 18791884. 10.4315/0362-028X.JFP-15-150

  • 63

    SarimehmetogluB.AksoyM. H.AyazN. D.AyazY.KupluluO.KaplanY. Z. (2009). Detection of Escherichia coli O157:H7 in ground beef using immunomagnetic separation and multiplex PCR. Food Control20, 357361. 10.1016/j.foodcont.2008.06.002

  • 64

    SorboA.ZoaniC.PasseriD. (2023). Food quality and safety: advances in analytical methods and applications. Separations10:315. 10.3390/separations10050315

  • 65

    SrivaniM.Narasimha ReddyY.SubramanyamK. V.Ramakoti ReddyM.Srinivasa RaoT. (2017). Prevalence and antimicrobial resistance pattern of Shiga toxigenic Escherichia coli in diarrheic buffalo calves. Vet. World10, 774778. 10.14202/vetworld.2017.774-778

  • 66

    SteeleM.OdumeruJ. (2004). Irrigation water as source of foodborne pathogens on fruit and vegetables. J. Food Prot.67, 28392849. 10.4315/0362-028X-67.12.2839

  • 67

    TahriL.HafianeF. Z.FekhaouiM. (2021). Prevalence and antibiotic resistance of the Escherichia coli in the groundwater (Tadla-Morocco). Groundw. Sustain. Dev.13:100572. 10.1016/j.gsd.2021.100572

  • 68

    TanS. L.LeeH. Y.MahyudinN. A. (2014). Antimicrobial resistance of Escherichia coli and Staphylococcus aureus isolated from food handler's hands. Food Control44, 203207. 10.1016/j.foodcont.2014.04.008

  • 69

    TangB.SiddiqueA.JiaC.Ed-DraA.WuJ.LinH.et al. (2023). Genome-based risk assessment for foodborne Salmonella enterica from food animals in China: aone health perspective. Int. J. Food Microbiol.390:110120. 10.1016/j.ijfoodmicro.2023.110120

  • 70

    TarafdarA.KumarY.KaurB. P.BadgujarP. C. (2021). High-pressure microfluidization of sugarcane juice: effect on total phenols, total flavonoids, antioxidant activity, and microbiological quality. J. Food Process. Preserv.45:e15428. 10.1111/jfpp.15428

  • 71

    ÜnüvarS. (2018). “Microbial foodborne diseases,” in Foodborne Diseases, eds. A. M. Holban and A. M. Grumezescu (Cambridge, MA: Academic Press), 131. 10.1016/B978-0-12-811444-5.00001-4

  • 72

    WangH.FengM.AnwarT. M.ChaiW.Ed-DraA.KangX.et al. (2023). Change in antimicrobial susceptibility of Listeria spp. in response to stress conditions. Front. Sustain. Food Syst.7:1179835. 10.3389/fsufs.2023.1179835

  • 73

    WuY.XuL.LiuX.HasanK. M. F.LiH.ZhouS.et al. (2021). Effect of thermosonication treatment on blueberry juice quality: total phenolics, flavonoids, anthocyanin, and antioxidant activity. LWT150:112021. 10.1016/j.lwt.2021.112021

  • 74

    XuY.ZhouX.JiangZ.QiY.Ed-DraA.YueM. (2021). Antimicrobial resistance profiles and genetic typing of salmonella serovars from chicken embryos in china. Antibiotics10:1156. 10.3390/antibiotics10101156

  • 75

    ZhangY.LiuC.Van Der Fels-KlerxH. J.CorrespondenceH. J.Van Der Fels-KlerxW. (2025). Occurrence, toxicity, dietary exposure, and management of Alternaria mycotoxins in food and feed: a systematic literature review. Compr. Rev. Food Sci. Food Saf.24:e70085. 10.1111/1541-4337.70085

  • 76

    ZhuZ.HuZ.LiS.FangR.OnoH. K.HuD. L. (2023). Molecular characteristics and pathogenicity of Staphylococcus aureus exotoxins. Int. J. Mol. Sci.25:395. 10.3390/ijms25010395

Summary

Keywords

Saccharum officinarum L., microbial contamination, antimicrobial resistance, virulence, Escherichia coli, Staphylococcus aureus, food safety

Citation

Ed-Dra A, Alhudhaibi AM, Abdallah EM and Nalbone L (2025) Quality and safety of fresh sugarcane juice sold by street vendors: a growing public health concern. Front. Sustain. Food Syst. 9:1628211. doi: 10.3389/fsufs.2025.1628211

Received

14 May 2025

Accepted

18 June 2025

Published

16 July 2025

Volume

9 - 2025

Edited by

M. Leonor Faleiro, University of Algarve, Portugal

Reviewed by

Agnes Kilonzo-Nthenge, Tennessee State University, United States

Chang-Sheng Dong, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, China

Updates

Copyright

*Correspondence: Abdelaziz Ed-Dra Abdulrahman Mohammed Alhudhaibi

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics