ORIGINAL RESEARCH article

Front. Cell. Infect. Microbiol., 27 January 2025

Sec. Veterinary and Zoonotic Infection

Volume 15 - 2025 | https://doi.org/10.3389/fcimb.2025.1522176

Gastrointestinal protozoa in pet cats from Anhui province: prevalence and molecular characterization

  • 1. College of Veterinary Medicine, Anhui Agricultural University, Hefei, Anhui, China

  • 2. Chongxin’an Animal Hospital, Hefei, Anhui, China

  • 3. Jiujiang District Animal Husbandry and Veterinary Service Center, Wuhu, China

Article metrics

View details

2

Citations

1,8k

Views

700

Downloads

Abstract

Introduction:

To investigate the prevalence of Tritrichomonas foetus, Pentatrichomonas hominis, Giardia intestinalis, Cryptosporidium, Microsporidium, and Sarcocystis in domestic cats in Anhui Province, China, and their potential role as zoonotic hosts for human infection, a total of 304 fecal samples from two different sources were screened for the presence of related pathogens.

Methods:

Using microscopy, along with polymerase chain reaction (PCR) or nested PCR amplification, followed by genotyping through sequence analysis.

Results:

The infection rates of T. foetus, P. hominis, G. intestinalis, Cryptosporidium, Enterocytozoon bieneusi, and Sarcocystis were 5.6%, 0%, 1.7%, 0.7%, 2.6%, and 0%, respectively. The evolutionary relationships and genetic characteristics of G. intestinalis based on the GDH gene, Cryptosporidium based on the SSU rRNA gene, and E. bieneusi based on the ITS sequence were assessed: five cases of G. intestinalis were identified, with four belonging to assemblage F and one to zoonotic assemblage B, two Cryptosporidium cases were identified as Cryptosporidium felis, and all eight E. bieneusi cases were identified as belonging to group 1, with three cases being genotype D, three EbpA, and two EbpC.

Discussion:

Age, neutering status, and deworming were identified as potential risk factors. Further analysis revealed that diarrhea, as a clinical symptom, could serve as an indicator for pathogen infection. Although the pathogen infection rates detected in this study were relatively low, their zoonotic transmission potential cannot be ignored. Therefore, special attention should be paid, and it is essential to establish targeted prevention plans.

1 Introduction

The health of pets has becoming a significant concern as the pet industry continues to grow. Among companion animals, cats are particularly vulnerable to gastrointestinal parasitic infections, which threaten their health and pose zoonotic risks to humans (Morelli et al., 2021). Common parasites include trichomonads, Giardia intestinalis, Cryptosporidium, Microsporidium, and Sarcocystis (Lappin, 2005). These parasites are distributed globally and can cause chronic diarrhea and other gastrointestinal symptoms, mainly through the ingestion of contaminated food or water (Ryu et al., 2007; Rosypal et al., 2012; Li et al., 2019b; Itoh et al., 2020; Strazdaitė-Žielienė et al., 2022).

Trichomonads, such as Tritrichomonas foetus and Pentatrichomonas hominis, are important pathogens causing chronic diarrhea in cats, especially in the young or immunocompromised individuals (Levy et al., 2003). Both species have been reported to infect humans, emphasizing their zoonotic potential (Maritz et al., 2014). Similarly, G. intestinalis exhibits host specificities, predominantly infecting cats through assemblage F. Zoonotic assemblages A and B have also been identified (Heyworth, 2016). Among Cryptosporidium species in cats, host-specific strains like Cryptosporidium felis coexist with zoonotic species such as Cryptosporidium parvum and Cryptosporidium hominis (Önder et al., 2021). These species often cause self-limiting diarrhea; however, transmission from companion animals can lead to secondary infections, which may become severe or life-threatening, particularly in immunocompromised individuals (Li et al., 2021; Jiang et al., 2023). Microsporidium species, particularly Enterocytozoon bieneusi, are increasingly recognized for their zoonotic importance (Santín and Fayer, 2011) and are considered among the most frequently diagnosed species in human infections (Karim et al., 2014). Group 1 genotypes often infect both humans and cats, while other groups exhibit higher host specificity (Xu et al., 2016). Although Sarcocystis infections in cats are less frequently reported, cats act as definitive hosts for various species, underscoring their role in potential disease transmission (Kirkpatrick and Dubey, 1987).

Although many global studies have examined feline parasitic infections, systematic epidemiological data specific to China remain scarce, particularly regarding their zoonotic potential. This study focuses on assessing the prevalence of gastrointestinal parasites in cat fecal samples from 12 cities in Anhui Province. The results aim to enhance understanding of the epidemiology of these infections and their risks to human health, providing valuable insights to inform public health measures and reduce the likelihood of zoonotic transmission.

2 Materials and methods

2.1 Ethical approval

This study adhered to the Guide for the Care and Use of Laboratory Animals set forth by the Ministry of Health, China. The protocol received approval from the Research Ethics Committee of the Anhui Agricultural University (number AHAUB2022020). All cat owners participating in this study were informed and consented to the examination. Throughout the sample collection process, measures were taken to minimize any stress or stimulation experienced by the animals.

2.2 Sample collection and microscopic examination

During from July to December 2023, fecal samples from 304 pet cats (Table 1) were collected from 11 veterinary clinics and 3 licensed catteries in 12 cities of Anhui Province, China (Figure 1). The samples were stored in ice boxes and transported to the Veterinary Parasite Laboratory, College of Animal Science and Technology at Anhui Agricultural University in Hefei. All feces samples were kept at 4°C until processing within one week. The sample information included gender, age, neuter status (analyzed among individuals older than 6 months), deworming status, and health conditions (diarrhea, weight loss, vomiting and anorexia).

Table 1

RegionsNo. SamplesPositive samples and infection rates
T. foetusP. hominisG. intestinalisC. felisE. bieneusiSarcocystis
Anqing242 (8.3%)0001 (4.2%)0
Bengbu20000000
Chuzhou353 (8.6%)00000
Fuyang251 (4.0%)0002 (8.0%)0
Hefei506 (12.0%)02(4.0%)2 (4.0%)4 (8.0%)0
Huangshan26002 (7.7%)000
Huaibei21000000
Huainan231 (4.3%)0001 (4.3%)0
Ma’ansahn20000000
Suzhou192 (10.5%)00000
Wuhu211 (4.8%)01 (4.8%)000
Xuancheng201 (5.0%)00000
Total30417 (5.6%)05 (1.6%)2 (0.7%)8 (2.6%)0

Cities and the number of collected cat fecal samples in Anhui Province, China, along with positive samples and corresponding infection rates for each city.

Figure 1

A small amount of feces was directly smeared onto a slide, mixed with a few drops of phosphate-buffered saline (PBS) using a clean toothpick to ensure even dispersion, and then covered with a cover slip. Subsequently, the smears were examined under a microscope using bright-field microscopy at magnifications of 100× and 400×.

2.3 DNA extraction and PCR detection

According to the manufacturer’s instructions, genomic DNA was extracted from approximately 200 mg of fecal samples using the TIANamp Stool DNA Kit (TIANGEN Biotech Co., Ltd., Beijing, China) and stored at -20°C for subsequent PCR detection.

Specific target genes of T. foetus, P. hominis, G. intestinalis, Cryptosporidium, E. bieneusi, and Sarcocystis were amplified to determine the presence of pathogenic infections through PCR or nested PCR. The primer sequences, product lengths, and annealing temperatures are listed in Table 2. After amplification, the PCR products were validated by agarose gel electrophoresis.

Table 2

SpeciesTarget genePrimerSequence (5’-3’)Cycling conditionsSize(bp)Ref.
T. foetus5.8S rRNA and ITS1/ITS2TFR3CGGGTCTTCCTATATGAGACAGAACC25s/94°C, 25s/56°C, 60s/72°C, 34cycles347(Felleisen et al., 1998)
TFR4CCTGCCGTTGGATCAGTTTCGTTAA
P. hominis18S rRNATh3TGTAAACGATGCCGACAGAG60s/95°C, 60s/64°C, 2min/72°C, 35cycles339(Gookin et al., 2007)
Th5CAACACTGAAGCCAATGCGAG
G. intestinalisGDHGDH1ATCTTCGAGAGGATGCTTGAG25s/94°C, 25s/58°C, 60s/72°C, 35cycles778(Homan et al., 1998.)
GDH4AGTACGCGACGCTGGGATACT
Cryptosporidium18S rRNAcry18SF1TTCTAGAGCTAATACATGCGPCR1,PCR2:
45s/94°C, 45s/55°C, 60s/72°C, 35cycles
820(Xiao et al., 2004)
cry18SR1CCCATTTCCTTCGAAACAGGA
cry18SF2GGAAGGGTTGTATTATTAGATAAAG
cry18SR2AAGGAGTAAGGAACAACCTCCA
E. bieneusiITSEBITS3GGTCATAGGGATGAAGAGPCR1:30s/94°C, 30s/57°C, 40s/72°C, 34cycles
PCR2:30s/94°C, 30s/55°C, 40s/72°C, 34cycles
392(Karim et al., 2015)
EBITS4TTCGAGTTCTTTCGCGCTC
EBITS1GCTCTGAATATCTATGGCT
EBITS2.4ATCGCCGACGGATCCAAGTG
Sarcocystis18S rRNA1LCCATGCATGTCTAAGTATAAGCPCR1,PCR2:
40s/94°C, 30s/50°C, 60s/72°C, 35cycles
960(Lau et al., 2013)
1HTATCCCCATCACGATGCATAC
3LCTAGTGATTGGAATGATGGG
2HACCTGTTATTGCCTCAAACTTC

Primer names and sequences for the detection of T. foetus and other protozoan molecular identification, along with PCR cycling conditions.

2.4 Cloning construction and sequencing

PCR-positive products were purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme Biotech Co., Ltd., Nanjing, China), following the manufacturer’s instructions. The purified products were cloned into the pCE2 TA/Blunt-Zero vector from the 5 min TA/Blunt-Zero Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing, China). The recombinant vectors were then transformed into Escherichia coli DH5α competent cells (Tolobio, Shanghai, China). Selective cloning was performed on Luria-Bertani (LB) agar plates containing ampicillin resistance. Positive clones were identified by PCR, and at least three positive clones corresponding to each PCR product were sequenced to confirm the sequence (Tsingke, Nanjing, China).

2.5 Sequence and phylogenetic analyses

All positive sequences obtained by sequencing underwent molecular analysis and genetic identification to determine species. Nucleotide sequences were assembled and edited using the Lasergene program (DNASTAR, Inc, Madison, WI, USA). BLAST analysis was performed on the nucleotide sequences in the GenBank database. Phylogenetic relationships among species were evaluated using the Neighbor-Joining (NJ) method in MEGA 11 (https://www.megasoftware.net/), with branch reliability assessed by 1000 bootstrap replicates. Phylogenetic trees representing the evolutionary relationships of the species were subsequently constructed.

The obtained sequences were submitted to GenBank under the following accession numbers: T. foetus rRNA/ITS sequences: PP999319–PP999335, G. intestinalis GDH sequences: PQ084557–PQ084561, Cryptosporidium 18S rRNA sequences: PQ008240–PQ008241, E. bieneusi 18S rRNA sequences: PQ008242–PQ008246, PQ411259-PQ411261.

2.6 Statistical analysis

Statistical analyses were conducted using GraphPad Prism version 9.5 (GraphPad Software, San Diego, CA, USA). Fisher’s exact test was employed to compare infection rates across various categorical variables, including age, sex, neuter status, deworming history, and clinical symptoms (such as diarrhea, weight loss, vomiting and anorexia). The association between these factors and gastrointestinal parasite infection was further assessed by calculating the odds ratio (OR) with a 95% confidence interval (CI), which provided an estimate of the relative risk of infection for each factor. Statistical significance was set at p < 0.05 for all tests.

All statistical analyses were two-tailed, and care was taken to address potential biases due to small sample sizes or uneven distributions across groups. This method ensured that the identified risk factors were valid and offered meaningful insights into the relationship between these factors and pathogen infection.

3 Results

3.1 Prevalence of gastrointestinal protozoan infections – microscopy and PCR results

All collected fecal samples (n=304) were examined using both microscopy and PCR techniques. Microscopy identified 12 cases of Giardia-like parasites. Based on previously recorded clinical symptoms, all 12 cases presented with recurrent diarrhea. According to the PCR results, 17 cases of T. foetus (5.6%), 5 cases of G. intestinalis (1.6%), 2 cases of Cryptosporidium (0.7%), and 8 cases of E. bieneusi (2.6%) were identified, while P. hominis and Sarcocystis were not detected (Table 1). Among these, there were two cases of mixed infection with T. foetus and G. intestinalis, originating from Hefei and Wuhu, respectively. The detection rate of T. foetus was highest in Hefei (12%, 6/50; p=0.04), and the highest detection rate of G. intestinalis was found in Huangshan (7.7%, 2/26; p=0.06). The detection rates of E. bieneusi were highest in Fuyang (8%, 2/25; p=0.13) and Hefei (8%, 4/50; p=0.03), while the only two cases of Cryptosporidium were detected in Hefei.

The infection rates of pathogens in cats of different ages, sexes, neutering status, and deworming conditions are shown in Table 3. The detection rate varied by age. According to the age group data, the detection rate in cats under 6 months (<6 months: 20.7%, 12/58; p=0.005) was significantly higher than in those aged 6-12 months (10.6%, 13/123; p=0.84) and over 12 months (>12 months: 4.1%, 5/123; p=0.16). The data for gender groups did not show a significant difference (p>0.05). The data for neutering status showed differences, with a higher detection rate in the non-neutered group (14.1%, 11/89; p=0.04). Similarly, there were differences in deworming conditions, with the detection rate in the untreated group (30.8%, 16/52) being significantly higher than in the treated group (5.6%, 14/252) (p<0.0001).

Table 3

VariableNo. SamplesGastrointestinal protozoa
No. Positive (%)OR (95%CI)p-value
Age
<6 months5812 (20.7%)3.30 (1.5-7.4)0.005**
6-12 months12313 (10.6%)1.14 (0.5-2.4)0.84
≥12 months1235 (4.1%)0.45 (0.2-1.2)0.16
Gender
Male15517 (11.0%)1.29 (0.6-2.7)0.57
Female14913 (8.7%)0.78 (0.4-1.6)
Neutered
Yes1577 (4.7%)0.33 (0.1-0.9)0.04*
No8911 (14.1%)3.02 (1.1-7.8)
Deworming
Yes25214 (5.6%)0.13 (0.1-0.3)<0.0001****
No5216 (30.8%)7.56 (3.3-16.5)

Infection of the pathogen in different cats.

When p<0.05 and OR>1, potential risk factors for infection are considered to exist.

* indicates statistical significance; ** indicates high statistical significance; **** indicates very high statistical significance.

Moreover, the odds ratio data (Table 3) showed that cats under 6 months of age (<6 months: OR=3.30, p=0.005) were more susceptible to pathogen infection, indicating the susceptibility of cats in this age group. Non-neutered cats (OR=3.02, p=0.04) also had a significantly higher susceptibility to infection compared to other cats. The untreated group (OR=7.56, p<0.0001) also demonstrated a significant risk of pathogen transmission among domestic cats.

3.2 Association between gastrointestinal parasites and clinical symptoms

Among the 304 collected samples, there were 62 cats (Table 4) exhibiting clinical symptoms, with 30 cases (48.4%) testing positive for pathogens, including two cases of mixed infection. Odds ratio data analysis was conducted to determine the risk factors associated with the transmission of gastrointestinal protozoa. Specifically, diarrhea (60.6%, 20/33; OR=2.92, p=0.047) may be a significant risk factor for infection and can also serve as an important indicator of gastrointestinal parasite infection.

Table 4

Clinical symptomNo. SamplesGastrointestinal protozoa
No. Positive (%)OR (95%CI)p-value
diarrhea3320 (60.6%)2.92 (1.0-8.4)0.047*
weight loss83 (37.5%)0.60 (0.1-2.7)0.71
vomiting135 (38.6%)0.60 (0.2-2.0)0.54
anorexia82 (25.0%)0.31 (0.1-1.4)0.26
Total6230 (48.4%)

Association between gastrointestinal parasites and clinical symptoms.

When p<0.05 and OR>1, potential risk factors for infection are considered to exist.

* indicates statistical significance.

3.3 Cryptosporidium species in cats

DNA sequencing and sequence analysis of the 18s rRNA PCR products from two Cryptosporidium-positive samples revealed that both belong to C. felis (Table 5, Figure 2). The nucleotide sequence with GenBank accession number PQ008240 showed 100% identity to the sequence with accession number JN833576. The positive isolate was detected in Shanghai. Notably, isolates with over 95% identity have records of human hosts. The nucleotide sequence with accession number PQ008241 exhibited 96.6% identity to the sequence with accession number OL615019 (Köseoğlu et al., 2022). This isolate was obtained from the feces of a stray cat in Izmir, Turkey, and based on phylogenetic tree analysis, the sample shows significant divergence.

Table 5

CitySourceaAgebGenderG. intestinalisCryptosporidiumE. bieneusi
HefeiVC2 MFemaleC. felis
HefeiVC8 MMaleC. felis
HefeiVC18 MMaleAssemblage: F
HefeiVC3 MMaleAssemblage: F
WuhuLC11 MMaleAssemblage:B
HuangshanVC5 MFemaleAssemblage: F
HuangshanVC8 MFemaleAssemblage: F
FuyangLC7 MFemaleEbpA
HefeiVC9 MFemaleEbpC
HefeiVC5 MFemaleD
HuainanVC15 MFemaleD
HefeiVC4 MMaleD
HefeiVC7 MMaleEbpC
BengbuVC10 MMaleEbpA
FuyangLC4 MMaleEbpA

Species of Cryptosporidium, genotypes of E. bieneusi, and assemblages of G. intestinalis isolates determined by PCR and sequence analysis in each positive animal.

a

VC, veterinary clinic; LC, licensed cattery.

b

M, month.

Figure 2

3.4 Genotypes and phylogeny of E. bieneusi in cats

DNA sequencing and sequence analysis of the ITS PCR products from 8 E. bieneusi positive samples revealed the presence of three known genotypes: D, EbpA, and EbpC (Table 5). Among them, EbpA is considered to be associated with genotype D. The genotypes D and EbpC differ in the ITS sequence by 1 to 6 single nucleotide polymorphisms (SNPs). The number of detected cases for genotype D and EbpA is the same (n=3), while EbpC has a detection count of (n=2).

Phylogenetic analysis of all E. bieneusi ITS genotypes identified in this study shows that genotypes D (subgroup 1a), EbpC (1e), and EbpA (1e) are classified into the first group of zoonotic pathogens (Figure 3).

Figure 3

3.5 Genetic assemblages of G. intestinalis in cats

All five positive G. intestinalis PCR products were successfully sequenced at the GDH locus. Through BLAST analysis, comparisons were made with sequences in the GenBank database, identifying that G. intestinalis belongs to Assemblages B and F (Figure 4). Among them, Assemblage B is a zoonotic genetic composition, while Assemblage F exhibits notable host specificity. The sources, ages, and genders of the positive animals are shown in Table 5.

Figure 4

4 Discussion

This is the first report describing the prevalence and genetic characteristics of gastrointestinal parasites in cats from Anhui Province, China, primarily detecting six pathogens: T. foetus, P. hominis, G. intestinalis, Cryptosporidium, E. bieneusi, and Sarcocystis. Apart from P. hominis and Sarcocystis, the remaining pathogens were all detected. The prevalence of infection in the cats investigated in Anhui Province in this study was 9.9% (30/304), with two cases of mixed infections involving T. foetus and G. intestinalis.

T. foetus is the most common parasite causing diarrhea in cats (Xenoulis et al., 2013), with reports from various countries and regions around the world (Yao and Köster, 2015). However, epidemiological studies of T. foetus in China are limited (Köster et al., 2015). In this study, PCR detection of its conserved sequence revealed a detection rate of 5.6% (Felleisen et al., 1998), making it the most common parasite observed in this study, a rate similar to that observed in Japan (8.8%) (Doi et al., 2012). Notably, there were two cases of mixed infection with G. intestinalis, both cats being under 1 year of age and having a history of diarrhea. In this study, P. hominis was not detected. Cases of P. hominis infection in cats are indeed rare (Romatowski, 2000; Bouzid et al., 2015), but its potential risk as a zoonotic disease cannot be ignored.

G. intestinalis infections in cats have been reported in many countries and regions, including Heilongjiang, Henan, Shanghai, and Guangdong in China (Bouzid et al., 2015; Li et al., 2015; Xu et al., 2016; Pan et al., 2018; Li et al., 2024). In this study, the infection rate was 1.6%. Sequence analysis identified one isolate as assemblage B, and the other four as assemblage F. Consistently, assemblage F is the most common genotype found in cats (Feng and Xiao, 2011). As G. intestinalis is recognized as a zoonotic pathogen, its zoonotic potential and the contribution of animal sources to the human disease burden are particularly important. One isolate in this study belonged to assemblage B, which aligns with reports of human infections and may represent a novel subtype within sub-assemblage BIV (Abe and Teramoto, 2012). At the same time, although assemblage F exhibits host specificity to cats, there is still a risk of human infection in areas with poor sanitary conditions (Pipiková et al., 2020).

Global epidemiological surveys on Cryptosporidium are numerous, with infection rates ranging from 0.6% to 40.8% (Meng et al., 2021). In China, detailed reports on the prevalence and genetic characteristics of Cryptosporidium in cats are only available for Heilongjiang, Henan, Shanghai, and Guangdong (Li et al., 2015; Xu et al., 2016; Li et al., 2019a, 2024). In this study, the infection rate of Cryptosporidium in cats was 0.7%, with both cases detected in Hefei. Previous reports also indicated an infection rate of 3.3% in cats in Hefei (Li et al., 2019c), which is similar to the detection rate of 4% in Hefei cats in this study. The isolates in this study were identified as C. felis, the most common species found in cats, but in some developing countries, there are widespread cases of human infections (Xiao, 2010).

Microsporidiosis in cats is an emerging zoonotic public health issue that has gained some attention globally in recent years (Meng et al., 2021). In this study, the infection rate of this pathogen was 2.6%, and phylogenetic analysis showed that all eight positive isolates belonged to zoonotic Assemblage 1. In China, the transmission of this pathogen is highly prevalent in water sources (especially wastewater), providing an important medium for the survival and spread of spores, whether through direct drinking water or indirectly through irrigation, food washing, or bathing water (Qiu et al., 2019). Therefore, the management of water sources and sanitation measures in daily life are particularly important. The global burden of microsporidiosis in cats is significant, and the lack of sufficient research in developing countries indicates that greater attention should be given to the prevalence of microsporidiosis in cats.

Reports of Sarcocystis in cat feces are rare. A retrospective analysis of related infections in North America found an infection rate of only 0.1% (Nagamori et al., 2020). In this study, no cases of Sarcocystis infection in cats’ feces were detected. Sarcocystosis infections exhibit complete enzootic stability in most parts of the world (Rommel, 1985). Domestic cats serve as definitive hosts for several Sarcocystosis species, such as Sarcocystis felis, and wild felids are also commonly infected (Cañón-Franco et al., 2016). Although cats are not as frequently associated with human infections as other definitive hosts, their role in the zoonotic Sarcocystis species life cycle should not be overlooked (Fayer et al., 2015).

Meanwhile, we analyzed some related risk factors for infection, and statistical analysis revealed that age, neutering status, and deworming were potential risk factors with statistically significant differences, which align with expectations. Young hosts are more susceptible to infections due to weakened immunity, increasing their infection risks. In this study, there were four cases from veterinary clinics involving rescued stray kittens all exhibited clinical symptoms of emaciation and parasitic infections, highlighting the higher risk faced by young cats in harsh environments. Neutering, as the primary intervention for most pet cats (Barrios et al., 2023), has previously been identified as a potential risk factor for infection (Colella et al., 2022), possibly due to reduced external exposure behavior in neutered cats (Mohamed et al., 2013). However, due to the small sample size and lack of behavioral data, we cannot conclusively determine whether neutering directly leads to a higher or lower infection rate. Interestingly, our three cases all come from catteries, all of which provided fecal samples testing positive for pathogen infections. Housing conditions and management practices in catteries may increase the risk of infection to some extent (Gookin et al., 2004). Gastrointestinal parasitic infections in cats are often accompanied by clinical symptoms such as diarrhea, emaciation, vomiting, and anorexia (Abbas et al., 2022). In this study, we found that diarrhea frequently indicated the potential presence of parasitic infection. Some samples exhibited extreme emaciation, which drew our attention, and subsequent tests confirmed parasitic infections. Although statistical analysis did not show significant differences, the fact that parasites extract nutrients from the host’s gastrointestinal tract to sustain their own life activities, leading emaciation (Xenoulis et al., 2013), suggests that emaciation may also indicate a possible infection.

The value of cats as pets has been extensively studied, and their interactions with humans have gained significant attention (Turner, 2017; Hart et al., 2018). Therefore, we cannot ignore their potential role as intermediate hosts for the transmission of parasites. However, this study only involved collecting fecal samples from pet cats, and no samples were collected from the owners. Consequently, there is a lack of molecular evidence to assess the potential transmission risk between pet cats and humans. Unfortunately, as the number of samples from stray cats was very limited, it was also difficult to make reliable comparisons regarding the risk factors in different environments.

This study also detected genetic combinations of pathogens that pose a risk of human infection, highlighting the importance of monitoring zoonotic transmission. Pet owners should establish targeted prevention plans, paying attention to outdoor exposure to reduce the likelihood of infection. Additionally, regular monitoring, eliminating exposure to infectious sources, and isolating sick animals remain effective methods for reducing the spread of pathogens.

5 Conclusion

This study identifies the prevalence of T. foetus, P. hominis, G. intestinalis, Cryptosporidium, E. bieneusi, and Sarcocystis in pet cats in Anhui Province, along with their phylogenetic characteristics. Although the prevalence is low, zoonotic combinations were detected. Key risk factors include young age, lack of neutering, and absence of deworming. Given the close contact between pet cats and humans, infection risks for cat owners may rise. Targeted management strategies are essential to reduce environmental contamination and safeguard both pet and public health. Further large-scale studies, including stray cats, are needed to evaluate the zoonotic risks of these pathogens.

Statements

Data availability statement

The original contributions presented in the study are publicly available. This data can be found at: https://www.ncbi.nlm.nih.gov/nuccore/; T. foetus rRNA/ITS sequences: PP999319–PP999335, G. intestinalis GDH sequences: PQ084557–PQ084561, Cryptosporidium 18S rRNA sequences: PQ008240–PQ008241, E. bieneusi 18S rRNA sequences: PQ008242–PQ008246, PQ411259–PQ411261.

Ethics statement

The animal studies were approved by Institutional Animal Care and Use Committee (IACUC), Anhui Agriculture University. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.

Author contributions

HZ: Data curation, Investigation, Writing – original draft. XT: Investigation, Writing – review & editing. ZM: Investigation, Writing – review & editing. TZ: Writing – review & editing. FW: Resources, Writing – review & editing. QW: Resources, Writing – review & editing. CY: Conceptualization, Funding acquisition, Methodology, Project administration, Writing – review & editing. CH: Conceptualization, Funding acquisition, Methodology, Project administration, Writing – review & editing.

Funding

The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This research was supported by the National Natural Science Foundation of China (No. 31972728), the Natural Science Research Project for Anhui Universities (No. 2024AH050434), the Quality Engineering Project of Anhui Agricultural University (No. 2023aujyxm003), and the Case Library for ‘Small Animal Disease Diagnosis and Treatment’ of the Master’s Degree in Veterinary Medicine at Anhui Agricultural University (No. yj223901).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Abbreviations

PCR, polymerase chain reaction; PBS, phosphate-buffered saline; NJ, Neighbor-Joining; OR, odds ratio; CI, confidence interval; MCL, Maximum Composite Likelihood.

References

  • 1

    AbbasI.Al-ArabyM.ElmishmishyB.El-AlfyE.-S. (2022). Gastrointestinal parasites of cats in Egypt: high prevalence high zoonotic risk. BMC Veterinary Res.18, 420. doi: 10.1186/s12917-022-03520-0

  • 2

    AbeN.TeramotoI. (2012). Molecular evidence for person-to-person transmission of a novel subtype in Giardia duodenalis assemblage B at the rehabilitation institution for developmentally disabled people. Parasitol. Res.110, 1025–1028. doi: 10.1007/s00436-011-2564-4

  • 3

    BarriosF.SuárezG.UdellM. A.R.DamiánJ. P. (2023). Characterization of the domestic cat population of Uruguay: breeds, coat colors, hair length, lifestyle, sex and spay/neuter status according to guardian report. Animals13, 1963. doi: 10.3390/ani13121963

  • 4

    BouzidM.HalaiK.JeffreysD.HunterP. R. (2015). The prevalence of Giardia infection in dogs and cats, a systematic review and meta-analysis of prevalence studies from stool samples. Veterinary Parasitol.207, 181–202. doi: 10.1016/j.vetpar.2014.12.011

  • 5

    Cañón-FrancoW. A.López-OrozcoN.ChristoffA. U.De CastilhoC. S.De AraújoF. A.VermaS. K.et al. (2016). Molecular and morphologic characterization of Sarcocystis felis (Apicomplexa: Sarcocystidae) in South American wild felids from Brazil. Veterinary Parasitol.217, 15–20. doi: 10.1016/j.vetpar.2015.12.025

  • 6

    ColellaV.WongnakP.TsaiY.-L.NguyenV.-L.TanD. Y.TongK. B.Y.et al. (2022). Human social conditions predict the risk of exposure to zoonotic parasites in companion animals in East and Southeast Asia. Commun. Med.2, 144. doi: 10.1038/s43856-022-00210-8

  • 7

    DoiJ.HirotaJ.MoritaA.FukushimaK.KamijyoH.OhtaH.et al. (2012). Intestinal Tritrichomonas suis (=T. foetus) Infection in Japanese Cats. J. Veterinary Med. Sci.74, 413–417. doi: 10.1292/jvms.11-0171

  • 8

    FayerR.EspositoD. H.DubeyJ. P. (2015). Human infections with Sarcocystis species. Clin. Microbiol. Rev.28, 295–311. doi: 10.1128/CMR.00113-14

  • 9

    FelleisenR. S.J.LambeletN.BachmannP.NicoletJ.MüllerN.GottsteinB. (1998). Detection of Tritrichomonas foetus by PCR and DNA Enzyme Immunoassay Based on rRNA Gene Unit Sequences. J. Clin. Microbiol.36, 513–519. doi: 10.1128/JCM.36.2.513-519.1998

  • 10

    FengY.XiaoL. (2011). Zoonotic potential and molecular epidemiology of. Giardia Species Giardiasis. Clin. Microbiol. Rev.24, 110–140. doi: 10.1128/CMR.00033-10

  • 11

    GookinJ. L.StaufferS. H.LevyM. G. (2007). Identification of Pentatrichomonas hominis in feline fecal samples by polymerase chain reaction assay. Veterinary Parasitol.145, 11–15. doi: 10.1016/j.vetpar.2006.10.020

  • 12

    GookinJ. L.StebbinsM. E.HuntE.BurloneK.FultonM.HochelR.et al. (2004). Prevalence of and risk factors for feline Tritrichomonas foetus and Giardia infection. J. Clin. Microbiol.42, 2707–2710. doi: 10.1128/JCM.42.6.2707-2710.2004

  • 13

    HartL. A.HartB. L.ThigpenA. P.WillitsN. H.LyonsL. A.HundenskiS. (2018). Compatibility of cats with children in the family. Front. Veterinary Sci.5. doi: 10.3389/fvets.2018.00278

  • 14

    HeyworthM. F. (2016). Giardia duodenalis genetic assemblages and hosts. Parasite23, 13. doi: 10.1051/parasite/2016013

  • 15

    HomanW. L.GilsingM.LimperL.van KnapenF. (1998). Characterization of Giardia duodenalis by polymerase-chain-reaction fingerprinting. Parasitol. Res.84, 707–714. doi: 10.1007/s004360050474

  • 16

    ItohN.IijimaY.OguraI.YonekuraN.KameshimaS.KimuraY. (2020). Molecular prevalence of trichomonad species from pet shop puppies and kittens in Japan. Rev. Bras. Parasitologia Veterinária29, e014820. doi: 10.1590/s1984-29612020098

  • 17

    JiangY.LiuL.YuanZ.LiuA.CaoJ.ShenY. (2023). Molecular identification and genetic characteristics of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in human immunodeficiency virus/acquired immunodeficiency syndrome patients in Shanghai, China. Parasites Vectors16, 53. doi: 10.1186/s13071-023-05666-8

  • 18

    KarimMd R.DongH.LiT.YuF.LiD.ZhangL.et al. (2015). Predomination and new genotypes of Enterocytozoon bieneusi in captive nonhuman primates in zoos in China: High genetic diversity and zoonotic significance. PloS One10, e0117991. doi: 10.1371/journal.pone.0117991

  • 19

    KarimMd R.DongH.YuF.JianF.ZhangL.WangR.et al. (2014). Genetic diversity in Enterocytozoon bieneusi isolates from dogs and cats in China: Host specificity and public health implications. J. Clin. Microbiol.52, 3297–3302. doi: 10.1128/JCM.01352-14

  • 20

    KirkpatrickC. E.DubeyJ. P. (1987). Enteric coccidial infections. Veterinary Clinics North America: Small Anim. Pract.17, 1405–1420. doi: 10.1016/S0195-5616(87)50009-2

  • 21

    KöseoğluA. E.CanH.KarakavukM.GüvendiM.Değirmenci DöşkayaA.ManyatsiP. B.et al. (2022). Molecular prevalence and subtyping of Cryptosporidium spp. in fecal samples collected from stray cats in İzmir, Turkey. BMC Veterinary Res.18, 89. doi: 10.1186/s12917-022-03190-y

  • 22

    KösterL. S.ChowC.YaoC. (2015). Trichomonosis in cats with diarrhoea in Hong Kong, China, between 2009 and 2014. J. Feline Med. Surg. Open Rep.1, 2055116915623561. doi: 10.1177/2055116915623561

  • 23

    LappinM. R. (2005). Enteric protozoal diseases. Veterinary Clinics North America: Small Anim. Pract.35, 81–88. doi: 10.1016/j.cvsm.2004.08.004

  • 24

    LauY. L.ChangP. Y.SubramaniamV.NgY. H.MahmudR.AhmadA. F.et al. (2013). Genetic assemblage of Sarcocystis spp. in Malaysian snakes. Parasites Vectors6, 257. doi: 10.1186/1756-3305-6-257

  • 25

    LevyM. G.GookinJ. L.PooreM.BirkenheuerA. J.DykstraM. J.LitakerR.W. (2003). Tritrichomonas foetus and not pentatrichomonas hominis is the etiologic agent of feline trichomonal diarrhea. J. Parasitol.89, 99–104. doi: 10.1645/0022-3395(2003)089[0099:TFANPH]2.0.CO;2

  • 26

    LiJ.DanX.ZhuK.LiN.GuoY.ZhengZ.et al. (2019a). Genetic characterization of Cryptosporidium spp. and Giardia duodenalis in dogs and cats in Guangdong, China. Parasites Vectors12, 571. doi: 10.1186/s13071-019-3822-z

  • 27

    LiW.FengY.SantinM. (2019b). Host specificity of Enterocytozoon bieneusi and public health implications. Trends Parasitol.35, 436–451. doi: 10.1016/j.pt.2019.04.004

  • 28

    LiW.LiY.SongM.LuY.YangJ.TaoW.et al. (2015). Prevalence and genetic characteristics of Cryptosporidium, Enterocytozoon bieneusi and Giardia duodenalis in cats and dogs in Heilongjiang province, China. Veterinary Parasitol.208, 125–134. doi: 10.1016/j.vetpar.2015.01.014

  • 29

    LiW.LiuX.GuY.LiuJ.LuoJ. (2019c). Prevalence of Cryptosporidium, Giardia, Blastocystis, and trichomonads in domestic cats in East China. J. Veterinary Med. Sci.81, 890–896. doi: 10.1292/jvms.19-0111

  • 30

    LiJ.RyanU.GuoY.FengY.XiaoL. (2021). Advances in molecular epidemiology of cryptosporidiosis in dogs and cats. Int. J. Parasitol.51, 787–795. doi: 10.1016/j.ijpara.2021.03.002

  • 31

    LiL.SuiY.LiX.SongP.ChenG.LiuH.et al. (2024). Molecular characterization of Cryptosporidium spp. and Giardia duodenalis in pet cats in Henan Province, central China. Acta Tropica254, 107188. doi: 10.1016/j.actatropica.2024.107188

  • 32

    MaritzJ. M.LandK. M.CarltonJ. M.HirtR. P. (2014). What is the importance of zoonotic trichomonads for human health? Trends Parasitol.30, 333–341. doi: 10.1016/j.pt.2014.05.005

  • 33

    MengX.-Z.LiM.-Y.LyuC.QinY.-F.ZhaoZ.-Y.YangX.-B.et al. (2021). The global prevalence and risk factors of Cryptosporidium infection among cats during 1988–2021: A systematic review and meta-analysis. Microbial Pathogenesis158, 105096. doi: 10.1016/j.micpath.2021.105096

  • 34

    MohamedA. S.GlickmanL. T.CampJ. W.LundE.MooreG. E. (2013). Prevalence and risk factors for Giardia spp. infection in a large national sample of pet dogs visiting veterinary hospitals in the United States, (2003–2009). Veterinary Parasitol.195, 35–41. doi: 10.1016/j.vetpar.2012.12.049

  • 35

    MorelliS.DiakouA.Di CesareA.ColomboM.TraversaD. (2021). Canine and feline parasitology: Analogies, differences, and relevance for human health. Clin. Microbiol. Rev.34, e00266–e00220. doi: 10.1128/CMR.00266-20

  • 36

    NagamoriY.PaytonM. E.LooperE.AppleH.JohnsonE. M. (2020). Retrospective survey of parasitism identified in feces of client-owned cats in North America from 2007 through 2018. Veterinary Parasitol.277, 109008. doi: 10.1016/j.vetpar.2019.109008

  • 37

    ÖnderZ.YetişmişG.PekmezciD.Delibaşı KökçüN.PekmezciGökmenZ.ÇiloğluA.et al. (2021). Investigation of zoonotic Cryptosporidium and Giardia intestinalis species and genotypes in cats (felis catus). Turkish J. Parasitol.45, 252–256. doi: 10.4274/tpd.galenos.2021.46320

  • 38

    PanW.WangM.AbdullahiA. Y.FuY.YanX.YangF.et al. (2018). Prevalence and genotypes of Giardia lamblia from stray dogs and cats in Guangdong, China. Veterinary Parasitology: Regional Stud. Rep.13, 30–34. doi: 10.1016/j.vprsr.2018.03.012

  • 39

    PipikováJ.PapajováI.MajláthováV.ŠoltysJ,BystrianskaJ.SchusterováI.et al. (2020). First report on Giardia duodenalis assemblage F in Slovakian children living in poor environmental conditions. J. Microbiology Immunol. Infection53, 148–156. doi: 10.1016/j.jmii.2018.04.007

  • 40

    QiuL.XiaW.LiW.PingJ.DingS.LiuH. (2019). The prevalence of microsporidia in China : A systematic review and meta-analysis. Sci. Rep.9, 3174. doi: 10.1038/s41598-019-39290-3

  • 41

    RomatowskiJ. (2000). Pentatrichomonas hominis infection in four kittens. J. Am. Veterinary Med. Assoc.216, 1270–1272. doi: 10.2460/javma.2000.216.1270

  • 42

    RommelM. (1985). Sarcocystosis of domestic animals and humans. In Pract.7, 158–160. doi: 10.1136/inpract.7.5.158

  • 43

    RosypalA. C.RipleyA.Stockdale WaldenH. D.BlagburnB. L.GrantD. C.LindsayD. S. (2012). Survival of a feline isolate of Tritrichomonas foetus in water, cat urine, cat food and cat litter. Veterinary Parasitol.185, 279–281. doi: 10.1016/j.vetpar.2011.11.003

  • 44

    RyuH.AlumA.MenaK. D.AbbaszadeganM. (2007). Assessment of the risk of infection by Cryptosporidium and Giardia in non-potable reclaimed water. Water Sci. Technol.55, 283–290. doi: 10.2166/wst.2007.047

  • 45

    SantínM.FayerR. (2011). Microsporidiosis: Enterocytozoon bieneusi in domesticated and wild animals. Res. Veterinary Sci.90, 363–371. doi: 10.1016/j.rvsc.2010.07.014

  • 46

    Strazdaitė-ŽielienėŽ.BaranauskaitėA.ButkauskasD.ServienėE.PrakasP. (2022). Molecular identification of parasitic protozoa Sarcocystis in water samples. Veterinary Sci.9, 412. doi: 10.3390/vetsci9080412

  • 47

    TurnerD. C. (2017). A review of over three decades of research on cat-human and human-cat interactions and relationships. Behav. Processes141, 297–304. doi: 10.1016/j.beproc.2017.01.008

  • 48

    XenoulisP. G.LopinskiD. J.ReadS. A.SuchodolskiJ. S.SteinerJörgM. (2013). Intestinal Tritrichomonas foetus infection in cats: a retrospective study of 104 cases. J. Feline Med. Surg.15, 1098–1103. doi: 10.1177/1098612X13495024

  • 49

    XiaoL. (2010). Molecular epidemiology of cryptosporidiosis: an update. Experimental Parasitology.124 (1), 8. doi: 10.1016/j.exppara.2009.03.018

  • 50

    XiaoL.FayerR.RyanU.UptonS. J. (2004). Cryptosporidium taxonomy: recent advances and implications for public health. Clin. Microbiol. Rev.17, 72–97. doi: 10.1128/CMR.17.1.72-97.2004

  • 51

    XuH.JinY.WuW.LiP.WangL.LiN.et al. (2016). Genotypes of Cryptosporidium spp., Enterocytozoon bieneusi and Giardia duodenalis in dogs and cats in Shanghai, China. Parasites Vectors9, 121. doi: 10.1186/s13071-016-1409-5

  • 52

    YaoC.KösterL. S. (2015). Tritrichomonas foetus infection, a cause of chronic diarrhea in the domestic cat. Veterinary Res.46, 35. doi: 10.1186/s13567-015-0169-0

Summary

Keywords

gastrointestinal protozoa, pet cats, prevalence, zoonotic, public health

Citation

Zhang H, Tong X, Ma Z, Zhang T, Wu F, Wu Q, Yang C and Han C (2025) Gastrointestinal protozoa in pet cats from Anhui province: prevalence and molecular characterization. Front. Cell. Infect. Microbiol. 15:1522176. doi: 10.3389/fcimb.2025.1522176

Received

04 November 2024

Accepted

03 January 2025

Published

27 January 2025

Volume

15 - 2025

Edited by

Rui Miguel Gil Da Costa, Federal University of Maranhão, Brazil

Reviewed by

Hongbin Si, Guangxi University, China

Chenxu Zhao, Northwest A&F University, China

Liuhong Shen, Sichuan Agricultural University, China

Updates

Copyright

*Correspondence: Chunyang Han, ; Congshan Yang,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics