ORIGINAL RESEARCH article

Front. Microbiol., 23 April 2018

Sec. Microbiotechnology

Volume 9 - 2018 | https://doi.org/10.3389/fmicb.2018.00786

The Small Regulatory Antisense RNA PilR Affects Pilus Formation and Cell Motility by Negatively Regulating pilA11 in Synechocystis sp. PCC 6803

  • 1. School of Life Sciences, Northwestern Polytechnical University, Xi'an, China

  • 2. Key Laboratory of Algal Biology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China

  • 3. Donghu Experimental Station of Lake Ecosystems, State Key Laboratory of Freshwater Ecology and Biotechnology of China, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China

Abstract

Pili are found on the surface of many bacteria and play important roles in cell motility, pathogenesis, biofilm formation, and sensing and reacting to environmental changes. Cell motility in the model cyanobacterium Synechocystis sp. PCC 6803 relies on expression of the putative pilA9-pilA10-pilA11-slr2018 operon. In this study, we identified the antisense RNA PilR encoded in the noncoding strand of the prepilin-encoding gene pilA11. Analysis of overexpressor [PilR(+)] and suppressor [PilR(−)] mutant strains revealed that PilR is a direct negative regulator of PilA11 protein. Although overexpression of PilR did not affect cell growth, it greatly reduced levels of pilA11 mRNA and protein and decreased both the thickness and number of pili, resulting in limited cell motility and small, distinct colonies. Suppression of PilR had the opposite effect. A hypothetical model on the regulation of pilA9-pilA10-pilA11-slr2018 operon expression by PilR was proposed. These results add a layer of complexity to the mechanisms controlling pilA11 gene expression and cell motility, and provide novel insights into how sRNA and the intergenic region secondary structures can work together to discoordinatly regulate target gene in an operon in cyanobacterium.

Introduction

Cyanobacteria are ancient organisms that perform oxygenic photosynthesis (Waterbury et al., 1985). According to endosymbiotic theory, plant chloroplasts originated from cyanobacteria (or a cyanobacteria-like organism) through primary endosymbiosis. Many cyanobacteria move by gliding, swimming, or twitching (Waterbury et al., 1985; Häder, 1987). Gliding motility is a slow, uniform, forward motion, which parallel to the cell's longitudinal axis on a solid surface (Häder, 1987). This type of motion is occasionally interrupted by reversals in filamentous cyanobacteria such as Phormidium uncinatum and Anabaena variabilis (Häder, 1987). Several marine species of unicellular Synechococcus show swimming motility through liquids at a rate of 25 μm s−1(Waterbury et al., 1985). Twitching motility is small and intermittent translocation on a solid surface with frequent changes in direction (Henrichsen, 1972). Synechocystis sp. PCC 6803, a model unicellular cyanobacterium, exhibits twitching motility on an agar plate or glass slide (Stanier et al., 1971; Ng et al., 2003).

The pilus is a hair-like appendage found on the surface of many single-celled prokaryotes and has emerged as an efficient device for cell motility, pathogenesis (Herrington et al., 1988; Strom and Lory, 1993; Sauer et al., 2000), biofilm formation (Pratt and Kolter, 1998; Barken et al., 2008), and environmental sensing (Kawagishi et al., 1996). The genomic sequencing of Synechocystis sp. PCC 6803 was finished in 1996 (Kaneko et al., 1996). Since then, a number of genes (known as the pil genes) involved in pilus biogenesis, cell motility, and transformation competency have been revealed by mutational analysis (Bhaya et al., 1999, 2000, 2001; Yoshihara et al., 2001), which show homology to type IV pili biogenesis genes in many Gram-negative bacteria. Nonflagellar appendages of Gram-negative bacteria can be categorized into five major classes based on their biosynthetic pathway (Fronzes et al., 2008; Lo et al., 2013): chaperone–usher pili (Sauer et al., 1999; Waksman and Hultgren, 2009; Busch and Waksman, 2012; Geibel and Waksman, 2014; Pham et al., 2016), curli (Olsén et al., 1989; Barnhart and Chapman, 2006; Green et al., 2016), type IV pili (Bhaya et al., 2000; Merz et al., 2000; Maier et al., 2002; Busch and Waksman, 2012; Busch et al., 2015), type III secretion needle (Roine et al., 1997; Kubori et al., 1998), and type IV secretion pili (Seubert et al., 2003; Schröder and Lanka, 2005). Eleven pilA-like genes are contained in Synechocystis genome, which encode a prepilin peptide with a characteristic sequence (Yoshihara et al., 2002; Yoshimura et al., 2002). Of these genes, pilA10, pilA11, and slr2018 function in cell motility (Bhaya et al., 2001), and pilA1 is essential for the formation of thick and thin pili (Bhaya et al., 2000; Yoshihara et al., 2001).

Transcriptome analyses have identified numerous noncoding transcripts in bacteria, mainly trans-encoded RNAs and cis-antisense RNAs (asRNAs) (Waters and Storz, 2009). Cis-encoded asRNA transcripts appear to be dominant in several cyanobacteria. For example, asRNAs respectively comprise 26 and 39% of all genes in Synechocystis sp. PCC 6803 (Georg et al., 2009; Mitschke et al., 2011a) and Anabaena sp. PCC 7120 (Mitschke et al., 2011b). Chromosomally encoded asRNAs may play important roles in the regulatory networks of cyanobacteria. During the past decade, numerous newly discovered asRNAs have been shown to be involved in a wide range of processes (Kopf and Hess, 2015), including stress responses, photoprotection, low carbon responses, and carbon assimilation (Dühring et al., 2006; Eisenhut et al., 2012; Sakurai et al., 2012; Hu et al., 2017).

The transcriptome analysis using differential RNA sequencing in Synechocystis sp. PCC 6803 (Xu et al., 2014; Hu et al., 2017) revealed a low-abundance asRNA encoded in the noncoding strand of pilA11, which was named PilR. In this study, we determined the molecular functions of PilR by identifying its target gene, pilA11. An analysis of mutants with either elevated or reduced levels of PilR expression showed that PilR plays a key role in pilus formation and cell motility by negatively regulating pilA11 expression.

Results

Characterization of PilR

Differential RNA sequencing of the Synechocystis sp. PCC 6803 (hereafter Synechocystis) transcriptome detected an asRNA, designated PilR, with a transcription start site at the 3′ end of the pilA11 gene, but on its complementary strand. PilR was determined to be 210 long using Northern blot (Figure 1A) and RACE analyses, and its transcription start site was mapped to nucleotide nt758305 in the sequenced genome. PilR extends from positions 677–886 in the coding sequence of pilA11 (Figure 1B), and can be folded into two extended stem regions, with a terminal loop at each ending as predicted by the mfold software (http://www.bioinfo.rpi.edu/applications/mfold/; Figure 1C), such loops structures are believed to be involved in RNA–RNA interactions and therefore functionally related to the hypothetical trans-acting function (Dühring et al., 2006).

Figure 1

We further constructed background control, PilR overexpression [PilR(+)], and PilR suppression [PilR(−)] strains (Supplementary Figure S1) for investigating the relationship between PilR and its target gene, pilA11. PilR appears to be a negative regulator of pilA11 expression during the exponential growth phase, as revealed through qRT-PCR and immunoblot analyses of these strains (Figures 2A,E). As shown in Figure 2A, the levels of asRNA PilR were 4.28-fold higher in the PilR(+) strain than in the control, and 0.25-fold lower in the PilR(−) strain than in the control (Figure 2A, white speckled bars; **P < 0.01). By contrast, the levels of pilA11 mRNA were 0.45-fold lower in the PilR(+) strain than in the control, and 2.06-fold higher in the PilR(−) strain than in the control (Figure 2A, gray bars, **P < 0.01). Similarly, the levels of PilA11 protein were 0.55-fold lower in the PilR(+) strain than in the control, and 1.25-fold higher in the PilR(−) strains than in the control (Figure 2E).

Figure 2

As previous investigations on the expression levels of the six genes (slr1667, slr1668, pilA9, pilA10, pilA11, and slr2018) strongly suggested that pilA9, pilA10, pilA11, and slr2018 constitute one operon (Kamei et al., 2001a; Yoshimura et al., 2002; Panichkin et al., 2006) to verify that PilR affects pilA11 but no other genes in the pilA9-pilA10-pilA11-slr2018 operon, pilA9, pilA10, and slr2018 transcript levels were also analyzed by qRT-PCR in the mutant strains (Figures 2B–D). We found that the mRNA levels of pilA9 were 0.87-fold lower in the PilA(+) strain than in the control, and 1.10-fold higher in the PilA(−) strain (Figure 2B, P > 0.05); those of pilA10 were 1.11-fold higher in the PilA(+) strain than in the control, and 1.20-fold higher in the PilA(−) strain (Figure 2C, P > 0.05); and those of slr2018 were 1.13-fold higher in the PilA(+) strain than in the control, and 1.18-fold higher in the PilA(−) strain (Figure 2D, P > 0.05). These results suggest that PilR has no significant effect on the stability of the mRNA portions that encode pilA9, pilA10, and slr2018, providing strong evidence that PilR, despite its relatively low steady-state expression level, negatively regulates the amount of pilA11 mRNA and PilA11 protein in Synechocystis.

PilA11 localization

To visualize the influence of PilR on PilA11 protein, we observed the in vivo localization of PilA11 protein in control, PilR(+), and PiIR(−) strains using immunofluorescence and confocal microscopy. PilR(+) cells exhibited weaker fluorescence compared to the control strain, but PilR(−) cells had significantly enhanced fluorescence compared to the control (Figures 3, 4; Table 1, **P < 0.01), in agreement with their protein levels (Figure 2E). When enlarged and visualized at the single cell level, the fluorescence signal could be observed clearly at the cell surface of all strains (Figure 3), as expected given its role in cell motility. We also observed high levels of fluorescence in all three strains in dividing cells (Figure 4, Supplementary Figure S2), suggesting that PilA11 protein is enriched at the cell surface during division regardless of PilR levels.

Figure 3

Figure 4

Table 1

Cell stateCONPilR(+)PilR(−)
Interphase14, 281 ± 2, 4815, 066 ± 1, 547**22, 366 ± 3, 809**
Cell division51, 911 ± 4, 66114, 868 ± 5, 945**78, 113 ± 3, 194**

PilA11 protein fluorescence intensity in the PilR mutant cells.

The fluorescence intensity of PilA11 protein was measured and calculated using the Quantity One software package, version 4.0.0 (Bio–Rad, http://www.bio-rad.com/) in 50 individual cells for each of the three strains. All values are means ± standard deviation. Significant differences between the control (CON) and test values were determined using a one–way ANOVA.

**

P < 0.01 vs. CON.

Pilus formation and cell motility of the PilR mutant strains

Previous studies showed that PilA11 was an essential protein for cell motility and thick pili formation (Bhaya et al., 2001; Panichkin et al., 2006). To test the effect of PilR on PilA11 protein function, we examined cell motility and thick pili formation in the PilR strains. Cyanobacterial cells were grown under normal conditions, and cells were maintained in the presence of 20 μg·mL−1 kanamycin. However, for eliminating possible phenotypic alterations due to the antibiotic, the final cultures without kanamycin were used in the experiments.

We examined control, PilR(+), and PiIR(−) cells with an electron microscope to investigate whether changes in PilR expression affected the formation of pili. As shown in Figure 5, the pili of PilR(+) cells were significantly thinner and fewer than the well-developed, normal pili of the control cells. Pili of PilR(−) cells were thicker and denser than those of the control. The number and diameter of pili of fifty individual cells each of the control, PilR(+), and PiIR(−) strains were examined and the results confirmed that PilR overexpression or suppression significantly affected pilus formation (Table 2).

Figure 5

Table 2

PiliCONPilR(+)PilR(−)
Number (per cell)36.7 ± 4.57.7 ± 1.5**57.3 ± 4.0**
Diameter (nm)4.80 ± 0.603.26 ± 0.30**6.06 ± 0.30**

Number and diameter of pili in PilR mutant cells.

Number of pili was calculated for the cross-sections of 50 cells. All values are means ± standard deviation. Significant differences between the control (CON) and test values were determined using a one-way ANOVA.

**

P < 0.01 vs. CON.

To investigate the effects of PilR on cell growth and motility in Synechocystis, we analyzed the three strains under normal conditions in liquid culture or on agar plates. As shown in Figure 6A and Table 3, when cultured in liquid BG11, the growth rate and pigmentation were not affected in either the PilR(+) or PilR(−) strains. We examined the effects of PilR overexpression or suppression on motility by monitoring the colonies shape formed on agar plates. The colonies of the PilR(−) strain were larger and more diffuse than the control colonies, whereas those of the PilR(+) strain were smaller and more centralized (Figure 6B).

Figure 6

Table 3

PigmentationCONPilR(+)PilR(−)
Chlorophyll a (mg/L)4.09 ± 0.544.34 ± 0.274.02 ± 0.23
Carotenoid (mg/L)1.46 ± 0.281.59 ± 0.161.37 ± 0.20

The effect of PilR on pigmentation in Synechocystis sp. PCC 6803.

All values are means ± standard deviation. Significant differences between the control (CON) and test values were determined using a one–way ANOVA.

We then performed agar surface-based phototaxis assays to clarify the differences in motility between the control, PilR(+), and PiIR(−) strains (Figure 6C). When the cells were dot plated and exposed to a unidirectional light source for 7 days, the control and PilR(−) mutant strains showed positive phototactic movement, with the latter having a stronger phenotype. The PilR(+) mutant strain showed almost no sign of phototactic movement (Figure 6C), suggesting that PilR expression influences Synechocystis cell motility in a concentration-dependent manner.

Discussion

Many species of cyanobacteria move by gliding, twitching, or swimming. Unlike Escherichia coli and Chlamydomonas reinhardtii, which use flagella, cyanobacteria use a pilus apparatus for motility (Waterbury et al., 1985; Häder, 1987). The oxygenic phototrophic cyanobacterium Synechocystis exhibits twitching motility (Stanier et al., 1971; Ng et al., 2003). Two morphologically distinct pilus types, thick and thin, exist in wild-type Synechocystis cells. Thick pili, possibly encoded by pilA1, are similar to type IV pili in many functional and morphological characteristics. Thin pili with smaller diameter are shorter than typical type IV pili (Bhaya et al., 2000). Type IV pilus biogenesis requires a complex polypeptides assemblage, located in the cytoplasmic membrane, the periplasm, or the outer membrane, for post-translational modification (e.g., PilD), assembly and export (e.g., PilC, PilQ) (Bhaya et al., 2000).. Type IV pili subunits (i.e., PilA) have a conserved, hydrophobic α-helix domain at the N-terminus, which consists of 20–25 amino acids that forms the hydrophobic pilus core (Proft and Baker, 2009). pilA1 is responsible for the structure, motility, and transformation efficiency of thick pilus (Bhaya et al., 1999; Yoshihara et al., 2001). Mutants with disrupted pilA2, which encodes a second pilin-like protein, are still motile with normal cell-surface pili morphology and density. By contrast, inactivation of pilD, which encodes the leader peptidase, or pilC, which encodes a protein required for pilus assembly, abolishes cell motility and causes the absence of both pilus morphotypes (Bhaya et al., 2000). In our study, suppression of pilA11 by overexpression of its antisense RNA PilR [PilR(+)] leads to thin, sparse pili, whereas PilR suppression [PilR(−)] has the opposite effect (Figure 5). This indicates that pilA11 may also contribute to thick pilus biogenesis and, indeed, the ratio of thick pili to all pili was altered in the PilR mutant strains.

A locus containing five genes (pilA9-pilA10-pilA11-slr2018-slr2019) was discovered in Synechocystis in an analysis of transposon-generated mutants (Bhaya et al., 2001). The protein encoded by pilA10 shows weak similarity to members of the PilA-like protein family (Bhaya et al., 1999), but the proteins encoded by pilA11 and slr2018 lack obvious functional motifs and have no clear homologs in protein databases. We observed that expression of pilA11, but not pilA9, pilA10, or slr2018, is negatively affected by its antisense sRNA PilR (Figure 2), and that overexpression of PilR disturbs the biogenesis of the thick pilus morphotype (Figure 5), which affects cell motility (Figure 6). These results suggest that PilR negatively regulates pilA11 and has an important function in cell motility.

SpkA and the ATPase PilT are required for motility in Synechocystis (Kamei et al., 2001b; Okamoto and Ohmori, 2002). Bhaya et al. showed that the pilA10, pilA11, and slr2018 genes were essential for cell motility (Bhaya et al., 2001). This study found that on 1% agar-solidified plates the pilA11 asRNA overexpressor PilR(+) colonies are small and distinct, whereas the suppressor PilR(−) colonies are large and diffuse (Figure 6B). spkA::Cmr mutant cells, in which the pilA9-pilA10-pilA11-slr2018 operon is down-regulated, also form distinct colonies similar to PilR(+) (Panichkin et al., 2006). The observed phenotype of PilR(+) mutant strains is consistent with a previous analysis showing that the putative pilA9-pilA10-pilA11-slr2018 operon in Synechocystis might be involved in the formation of thick pili (Panichkin et al., 2006). However, the effect that expression of the operon has on Synechocystis cells has not been deciphered until now.

sRNAs regulate gene expression from polycistronic messages through a variety of mechanisms (Balasubramanian and Vanderpool, 2013), which can alter expression of select genes in an operon by inhibiting the translation of genes or by altering the stability of mRNA, resulting in discoordinate regulation of the target mRNA (Møller et al., 2002; Kalamorz et al., 2007; Desnoyers et al., 2009). Alternatively, they can affect expression of all genes in an operon by sRNA-mRNA interactions, causing coordinate regulation (Rice and Vanderpool, 2011; Lu et al., 2012). The 210 nt sRNA PilR was identified as an asRNA by repressing expression of pilA11 gene, but not pilA9, pilA10, or slr2018, in Synechocystis (Figure 2). It is speculated that PilR prevents pilA11 gene expression by selective mRNA degradation. This type of regulation represses pilA11 gene expression, but allows continued synthesis of other Type IV pilin-like proteins.

To further elucidate the discoordinate regulation mechanism of the cis-type PilR transcript to pilA11 gene, a closer sequence inspection is needed in both target gene pilA11 and asRNA PilR, their cleavage by RNases. By sequence analysis, a strong secondary structure (Figure 7A) in the intergenic region between the pilA11 and slr2018 cistrons was predicted. Add up to the present understanding of the function of PilR in the regulation of pilA11 gene expression, a hypothetical model on the regulation of pilA9-pilA10-pilA11-slr2018 operon expression by PilR was proposed (Figure 7). Normally, single-stranded pilA9-pilA10-pilA11-slr2018 mRNA is translated into three type IV pilin-like protein, PilA9, PilA10, PilA11 and the unknown protein Slr2018 (Figure 7B, upper panel). While the degradation of pilA11 mRNA is typically triggered by sRNA PilR base pairing to the target mRNA, and results in translational silencing and promoted degradosome-dependent endonucleolytic cleavage (Kaberdin et al., 2011; Balasubramanian and Vanderpool, 2013) of the pilA11 portion of the mRNA, presumably by RNase E (Figure 7B, middle panel). The degradosome is stopped and discharged by the hairpin structure (Figure 7A) between the pilA11 and slr2018 cistrons and thus selectively prevents the slr2018 mRNA from degradation (Figure 7B, lower panel). The suggested model provides novel insights into how sRNA and the intergenic region secondary structures can work together to discoordinatly regulate target gene in an operon in Synechocystis (Figures 2A,E).

Figure 7

Cis-encoded asRNA transcripts typically regulate target gene expression either negatively, as is the case for IsrR (Dühring et al., 2006) and As1_flv4 (Eisenhut et al., 2012), or positively, as is the case for PsbA2R, PsbA3R (Sakurai et al., 2012), and RblR (Hu et al., 2017). These asRNAs are involved in various processes (Kopf and Hess, 2015), but prior to this study, no asRNAs related to cell motility were known. Our results show that the asRNA PilR is encoded by the antisense strand of the pilA11 gene and negatively regulates its expression through complementary base pairing. Downregulation of this member of the putative pilA9-pilA10-pilA11-slr2018 operon reduces the number and thickness of the pili, affecting cell motility. These results add a new layer of complexity to the regulatory mechanisms controlling pilA11 gene expression and function and hence cell motility.

Experimental procedures

Strains and growth conditions

Wild-type Synechocystis was cultured as described previously (Hu et al., 2017). Solid medium supplemented with 1% (w/v) or 0.5% (w/v) agar is used to observe colony morphology for motility evaluation. After generating mutant strains (see below), kanamycin (20 μg/mL) was added to the growth medium to identify the transformed cells. Antibiotics were excluded during phenotyping to avoid interactions. The colonies were trained for 7 days under lateral illumination with a white fluorescent lamp (~30 μmol photons·m−2·S−1).

RNA extraction and northern blot analysis

Total RNA extraction was performed as described previously (Hu et al., 2017). Northern blot analysis was performed as previously described (Hu et al., 2014). [γ-32P] ATP (PerkinElmer, USA) was used for the labeling of probes. DNA oligonucleotides used for the Northern blot analysis are listed in Table 4.

Table 4

NameSequence (5′−3′)Experiment
PilR-RTTGGAGTTACGGGAAACCTTACPilR probe
3′ linkerphosphorylated-AAGATGAATGCAACACTTCTGTACGACTAGAGCAC-NH2RACE
3′ RTrevlinkerGTGCTCTAGTCGTACAGAAGTGTTGCATTCATCRACE
3′ PCRrevlinkerGTGCTCTAGTCGTACAGAAGTGTTGCATTCATCRACE
PilR-revTAATAATTACACTGCCGGCGG5′ RACE, first PCR
PilR-rev2ACGGGGCTATCGCCTCAA5′ RACE, second PCR
PilR-rev3GCAAGCAACTATTGATGGGGT5′ RACE, third PCR
PilR-fw1GGAAGAAGTCTAGTGCAATCGGA3′ RACE, first PCR
PilR-fw2ATTGAGGCGATAGCCCCGTTC3′ RACE, second PCR
PilR-qRT-FGAAGTCTAGTGCAATCGGAAGGqRT-PCR
PilR-qRT-RTTGGAGTTACGGGAAACCTTACqRT-PCR
pilA9-qRT-FTAGTCGTGGTGGTGATTGGCqRT-PCR
pilA9-qRT-RTGCCCTAGTTCTAGCGGTCTqRT-PCR
pilA10-qRT-FTGAGTTGGACGCCCAGTTAGqRT-PCR
pilA10-qRT-RGGAACAAGTCCCGTTGGGATqRT-PCR
pilA11-qRT-FCTGAAATTCCTCCCGCTGGTqRT-PCR
pilA11-qRT-RTGCCCATTGCCGTTGTAGATqRT-PCR
slr2018-qRT-FTCTCCGGTTTGTTGGTAGCCqRT-PCR
slr2018-qRT-RATTCAGGGCTCCTTCTGCACqRT-PCR
5′rnpBAATGCGGTCCAATACCTCCMutagenesis (overlap extension PCR)
3′rnpB/kanaGTTACCCA TGATATCTCTTTTTCTAGTGTGCCATTGMutagenesis (overlap extension PCR)
5′kana/rnpBCTAGAAAAAGAGATATCAGTTGGGTAACGCCAGGGMutagenesis (overlap extension PCR)
3′kanaCACTTTATGCTTCCGGCTCGMutagenesis (overlap extension PCR)
slr0168-FACCTCTCCACGCTGAATTAGAMutagenesis (slr0168, upstream)
slr0168-RTAATACCCACCGCACTGACCMutagenesis (slr0168, downstream)
PilR(+)-FGAAGTCTAGTGCAATCGGAAGGMutagenesis (PilR, upstream)
PilR(+)-RTTGGAGTTACGGGAAACCTTACMutagenesis (PilR, downstream)
PilR(−)-FTAGAAGAACGGGGCTATCGCMutagenesis (anti-PilR, upstream)
PilR(−)/oop ter-RGGAATAAAAAACGCCCGGCGGCAACCGAGCGTTGAAGTCTAGTGCAATCGGAAGGMutagenesis (anti-PilR, downstream)
0168-FCCCTGAAGTTAGCCAGTTTAATTGPCR
0168-RGTCACTGAAGCGGTCTAACTTAGCPCR

Oligonucleotides used in this study.

The 3′ RACE analysis was performed prior to 5′ RACE. All PCR primers for 5′ RACE were designed according to the results of 3′ RACE. fw, forward; rev, reverse.

5′- and 3′- rapid amplification of cDNA ends (RACE)

The 5′ end and 3′ end RACE was performed according to Hu et al. (2014). All oligonucleotides and primers used in the RACE analysis are listed in Table 4.

qRT-PCR validation

The qRT-PCR analysis was done by standard procedure using cDNA as previously described (Hu et al., 2014, 2017). All data are shown as the mean ± SD (n = 5). All primers used for the analysis are listed in Table 4.

Mutagenesis

Mutant strains PilR(+), and PilR(−) were created as previously described (Golden et al., 1987; Hu et al., 2017). All primers used for this analysis are listed in Table 4.

Protein gel and immunoblot analysis

Protein gel and immunoblot analysis were performed as previously described (Hu et al., 2014). The membranes were probed with rabbit primary anti-PilA11 antibodies (1:5,000; QWbio, http://www.qwbio.com Beijing).

Electron microscopy

Specimens were prepared for electron microscopy using the conventional negative staining procedure (Bhaya et al., 1999) with the following modifications. Briefly, a 200 μL drop of sample solution was adsorbed onto a glow-discharged carbon-coated copper grid for 10 min, stained with two drops of freshly prepared 2% phosphotungstic acid (pH 7.0), and examined using a Hitachi HT7700 microscope.

Immunofluorescence microscopy

Microscopy analysis of cells grown in liquid BG11 medium was carried out using a confocal scanning microscope (Leica TCS SP8, Wetzlar, Germany). PilA11 localization was performed as previously described (Miyagishima et al., 2005; Zhan et al., 2016). The fluorescence intensity was measured and quantified using the Quantity One software package, version 4.0.0 (Bio-Rad, http://www.bio-rad.com/) in 50 individual cells for each of the three strains.

Measurements of chlorophyll a and carotenoid contents

Chlorophyll a and carotenoid contents were measured as described (Zhang et al., 2013). Chlorophyll a (Ca) and total carotenoid (Cc) contents were calculated according to Equation (1) (Harmut and Lichtenthaler, 1987).

Calculating the number and diameter of pili

Number and diameter of pili were calculated for the cross-sections of 50 cells of electron microscopy using ImageJ software. All values are means ± standard deviation. Significant differences between the control (CON) and test values were determined using a one-way ANOVA. **P < 0.01 vs. CON.

Statements

Author contributions

JH and QW: Designed the study; JH, JZ, HuiC, CH, and QW: Collected, analyzed, and interpreted the data; JH, HuaC, and QW: Wrote the manuscript.

Acknowledgments

This work was supported jointly by the National Natural Science Foundation of China (31770128, 31700107, and 31700055), the State Key Laboratory of Freshwater Ecology and Biotechnology (Y11901-1-F01), the Fundamental Research Funds for the Central Universities (3102017OQD042), and the China Postdoctoral Science Foundation (2017M610648). We thank Yuan Xiao and Fang Zhou of the Institute of Hydrobiology, CAS for assistance with the electron microscopy and confocal scanning microscopy.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2018.00786/full#supplementary-material

References

  • 1

    BalasubramanianD.VanderpoolC. K. (2013). New developments in post-transcriptional regulation of operons by small RNAs. RNA Biol.10, 337–341. 10.4161/rna.23696

  • 2

    BarkenK. B.PampS. J.YangL.GjermansenM.BertrandJ. J.KlausenM.et al. (2008). Roles of type IV pili, flagellum-mediated motility and extracellular DNA in the formation of mature multicellular structures in Pseudomonas aeruginosa biofilms. Environ. Microbiol.10, 2331–2343. 10.1111/j.1462-2920.2008.01658.x

  • 3

    BarnhartM. M.ChapmanM. R. (2006). Curli biogenesis and function. Annu. Rev. Microbiol.60, 131–147. 10.1146/annurev.micro.60.080805.142106

  • 4

    BhayaD.BiancoN. R.BryantD.GrossmanA. (2000). Type IV pilus biogenesis and motility in the cyanobacterium Synechocystis sp. PCC6803. Mol. Microbiol.37, 941–951. 10.1046/j.1365-2958.2000.02068.x

  • 5

    BhayaD.TakahashiA.ShahiP.GrossmanA. R. (2001). Novel motility mutants of synechocystis strain PCC 6803 generated by in vitro transposon mutagenesis. J. Bacteriol.183, 6140–6143. 10.1128/JB.183.20.6140-6143.2001

  • 6

    BhayaD.WatanabeN.OgawaT.GrossmanA. R. (1999). The role of an alternative sigma factor in motility and pilus formation in the cyanobacterium Synechocystis sp. strain PCC6803. Proc. Natl. Acad. Sci. U.S.A.96, 3188–3193. 10.1073/pnas.96.6.3188

  • 7

    BuschA.PhanG.WaksmanG. (2015). Molecular mechanism of bacterial type 1 and P pili assembly. Philos. Trans. A Math. Phys. Eng. Sci.373:20130153. 10.1098/rsta.2013.0153

  • 8

    BuschA.WaksmanG. (2012). Chaperone-usher pathways: diversity and pilus assembly mechanism. Philos. Trans. R. Soc. Lond. B Biol. Sci.367, 1112–1122. 10.1098/rstb.2011.0206

  • 9

    DesnoyersG.MorissetteA.PrévostK.MasséE. (2009). Small RNA-induced differential degradation of the polycistronic mRNA iscRSUA. EMBO J.28, 1551–1561. 10.1038/emboj.2009.116

  • 10

    DühringU.AxmannI. M.HessW. R.WildeA. (2006). An internal antisense RNA regulates expression of the photosynthesis gene isiA. Proc. Natl. Acad. Sci. U.S.A.103, 7054–7058. 10.1073/pnas.0600927103

  • 11

    EisenhutM.GeorgJ.KlähnS.SakuraiI.MustilaH.ZhangP.et al. (2012). The antisense RNA As1_flv4 in the cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply. J. Biol. Chem.287, 33153–33162. 10.1074/jbc.M112.391755

  • 12

    FronzesR.RemautH.WaksmanG. (2008). Architectures and biogenesis of non-flagellar protein appendages in Gram-negative bacteria. EMBO J.27, 2271–2280. 10.1038/emboj.2008.155

  • 13

    GeibelS.WaksmanG. (2014). The molecular dissection of the chaperone-usher pathway. Biochim. Biophys. Acta1843, 1559–1567. 10.1016/j.bbamcr.2013.09.023

  • 14

    GeorgJ.VossB.ScholzI.MitschkeJ.WildeA.HessW. R. (2009). Evidence for a major role of antisense RNAs in cyanobacterial gene regulation. Mol. Syst. Biol.5, 305. 10.1038/msb.2009.63

  • 15

    GoldenS. S.BrusslanJ.HaselkornR. (1987). Genetic engineering of the cyanobacterial chromosome. Method Enzymol.153, 215–231. 10.1016/0076-6879(87)53055-5

  • 16

    GreenA.PhamN.OsbyK.AramA.ClaudiusR.PatrayS.et al. (2016). Are the curli proteins CsgE and CsgF intrinsically disordered?Intrins. Disord. Proteins4:e1130675. 10.1080/21690707.2015.1130675

  • 17

    HäderD. P. (1987). Photosensory behavior in procaryotes. Microbiol. Rev.51, 1–21.

  • 18

    HarmutA.LichtenthalerK. (1987). Chlorophylls and carotenoids: pigments of photosynthetic membranes. Method Enzymol.148, 350–383. 10.1016/0076-6879(87)48036-1

  • 19

    HenrichsenJ. (1972). Bacterial surface translocation: a survey and a classification. Bacteriol. Rev.36, 478–503.

  • 20

    HerringtonD. A.HallR. H.LosonskyG.MekalanosJ. J.TaylorR.LevineM. M. (1988). Toxin, toxin-coregulated pili, and the toxR regulon are essential for Vibrio cholerae pathogenesis in humans. J. Exp. Med.168, 1487–1492. 10.1084/jem.168.4.1487

  • 21

    HuJ.DengX.ShaoN.WangG.HuangK. (2014). Rapid construction and screening of artificial microRNA systems in Chlamydomonas reinhardtii. Plant J.79, 1052–1064. 10.1111/tpj.12606

  • 22

    HuJ.LiT.XuW.ZhanJ.ChenH.HeC.et al. (2017). Small antisense RNA RblR positively regulates RuBisCo in Synechocystis sp. PCC 6803. Front. Microbiol.8:231. 10.3389/fmicb.2017.00231

  • 23

    KaberdinV. R.SinghD.Lin-ChaoS. (2011). Composition and conservation of the mRNA-degrading machinery in bacteria. J. Biomed. Sci.18:23. 10.1186/1423-0127-18-23

  • 24

    KalamorzF.ReichenbachB.MärzW.RakB.GörkeB. (2007). Feedback control of glucosamine-6-phosphate synthase GlmS expression depends on the small RNA GlmZ and involves the novel protein YhbJ in Escherichia coli. Mol. Microbiol.65, 1518–1533. 10.1111/j.1365-2958.2007.05888.x

  • 25

    KameiA.HiharaY.YoshiharaS.GengX.KanehisaM.IkeuchiM. (2001a). Functional analysis of lexA-like gene, sll1626 in Synechocystis sp. PCC 6803 using DNA microarray. Sci. Acc.3:SA0403733. 10.1071/SA0403733

  • 26

    KameiA.YuasaT.OrikawaK.GengX. X.IkeuchiM. (2001b). A eukaryotic-type protein kinase, SpkA, is required for normal motility of the unicellular Cyanobacterium synechocystis sp. strain PCC 6803. J. Bacteriol.183, 1505–1510. 10.1128/JB.183.5.1505-1510.2001

  • 27

    KanekoT.SatoS.KotaniH.TanakaA.AsamizuE.NakamuraY.et al. (1996). Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res.3, 109–136. 10.1093/dnares/3.3.109

  • 28

    KawagishiI.ImagawaM.ImaeY.McCarterL.HommaM. (1996). The sodium-driven polar flagellar motor of marine Vibrio as the mechanosensor that regulates lateral flagellar expression. Mol. Microbiol.20, 693–699. 10.1111/j.1365-2958.1996.tb02509.x

  • 29

    KopfM.HessW. R. (2015). Regulatory RNAs in photosynthetic cyanobacteria. FEMS Microbiol. Rev.39, 301–315. 10.1093/femsre/fuv017

  • 30

    KuboriT.MatsushimaY.NakamuraD.UralilJ.Lara-TejeroM.SukhanA.et al. (1998). Supramolecular structure of the Salmonella typhimurium type III protein secretion system. Science280, 602–605. 10.1126/science.280.5363.602

  • 31

    LoA. W.MoonensK.RemautH. (2013). Chemical attenuation of pilus function and assembly in Gram-negative bacteria. Curr. Opin. Microbiol.16, 85–92. 10.1016/j.mib.2013.02.003

  • 32

    LuP.ZhangY.LiL.HuY.HuangL.LiY.et al. (2012). Small non-coding RNA SraG regulates the operon YPK_1206-1205 in Yersinia pseudotuberculosis.FEMS Microbiol. Lett.331, 37–43. 10.1111/j.1574-6968.2012.02548.x

  • 33

    MaierB.PotterL.SoM.LongC. D.SeifertH. S.SheetzM. P. (2002). Single pilus motor forces exceed 100 pN. Proc. Natl. Acad. Sci. U.S.A.99, 16012–16017. 10.1073/pnas.242523299

  • 34

    MerzA. J.SoM.SheetzM. P. (2000). Pilus retraction powers bacterial twitching motility. Nature407, 98–102. 10.1038/35024105

  • 35

    MitschkeJ.GeorgJ.ScholzI.SharmaC. M.DienstD.BantscheffJ.et al. (2011a). An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp. PCC6803. Proc. Natl. Acad. Sci. U.S.A.108, 2124–2129. 10.1073/pnas.1015154108

  • 36

    MitschkeJ.VioqueA.HaasF.HessW. R.Muro-PastorA. M. (2011b). Dynamics of transcriptional start site selection during nitrogen stress-induced cell differentiation in Anabaena sp. PCC7120. Proc. Natl. Acad. Sci. U.S.A.108, 20130–20135. 10.1073/pnas.1112724108

  • 37

    MiyagishimaS. Y.WolkC. P.OsteryoungK. W. (2005). Identification of cyanobacterial cell division genes by comparative and mutational analyses. Mol. Microbiol.56, 126–143. 10.1111/j.1365-2958.2005.04548.x

  • 38

    MøllerT.FranchT.UdesenC.GerdesK.Valentin-HansenP. (2002). Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon. Genes Dev.16, 1696–1706. 10.1101/gad.231702

  • 39

    NgW. O.GrossmanA. R.BhayaD. (2003). Multiple light inputs control phototaxis in Synechocystis sp. strain PCC6803. J. Bacteriol.185, 1599–1607. 10.1128/JB.185.5.1599-1607.2003

  • 40

    OkamotoS.OhmoriM. (2002). The cyanobacterial PilT protein responsible for cell motility and transformation hydrolyzes ATP. Plant Cell Physiol.43, 1127–1136. 10.1093/pcp/pcf128

  • 41

    OlsénA.JonssonA.NormarkS. (1989). Fibronectin binding mediated by a novel class of surface organelles on Escherichia coli. Nature338, 652–655. 10.1038/338652a0

  • 42

    PanichkinV. B.Arakawa-KobayashiS.KanasekiT.SuzukiI.LosD. A.ShestakovS. V.et al. (2006). Serine/threonine protein kinase SpkA in Synechocystis sp. strain PCC 6803 is a regulator of expression of three putative pilA operons, formation of thick pili, and cell motility. J. Bacteriol.188, 7696–7699. 10.1128/JB.00838-06

  • 43

    PhamT.WerneburgG. T.HendersonN. S.ThanassiD. G.DelcourA. H. (2016). Effect of chaperone-adhesin complex on plug release by the PapC usher. FEBS Lett.590, 2172–2179. 10.1002/1873-3468.12257

  • 44

    PrattL. A.KolterR. (1998). Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol. Microbiol.30, 285–293. 10.1046/j.1365-2958.1998.01061.x

  • 45

    ProftT.BakerE. (2009). Pili in Gram-negative and Gram-positive bacteria—structure, assembly and their role in disease. Cell. Mol. Life Sci.66, 613–635. 10.1007/s00018-008-8477-4

  • 46

    RiceJ. B.VanderpoolC. K. (2011). The small RNA SgrS controls sugar–phosphate accumulation by regulating multiple PTS genes. Nucleic Acids Res.39, 3806–3819. 10.1093/nar/gkq1219

  • 47

    RoineE.WeiW.YuanJ.Nurmiaho-LassilaE. L.KalkkinenN.RomantschukM.et al. (1997). Hrp pilus: an hrp-dependent bacterial surface appendage produced by Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. U.S.A.94, 3459–3464. 10.1073/pnas.94.7.3459

  • 48

    SakuraiI.StazicD.EisenhutM.VuorioE.SteglichC.HessW. R.et al. (2012). Positive regulation of psbA gene expression by cis-encoded antisense RNAs in Synechocystis sp. PCC 6803. Plant Physiol.160, 1000–1010. 10.1104/pp.112.202127

  • 49

    SauerF. G.FüttererK.PinknerJ. S.DodsonK. W.HultgrenS. J.WaksmanG. (1999). Structural basis of chaperone function and pilus biogenesis. Science285, 1058–1061. 10.1126/science.285.5430.1058

  • 50

    SauerF. G.MulveyM. A.SchillingJ. D.MartinezJ. J.HultgrenS. J. (2000). Bacterial pili: molecular mechanisms of pathogenesis. Curr. Opin. Microbiol.3, 65–72. 10.1016/S1369-5274(99)00053-3

  • 51

    SchröderG.LankaE. (2005). The mating pair formation system of conjugative plasmids-A versatile secretion machinery for transfer of proteins and DNA. Plasmid54, 1–25. 10.1016/j.plasmid.2005.02.001

  • 52

    SeubertA.HiestandR.de la CruzF.DehioC. (2003). A bacterial conjugation machinery recruited for pathogenesis. Mol. Microbiol.49, 1253–1266. 10.1046/j.1365-2958.2003.03650.x

  • 53

    StanierR. Y.KunisawaR.MandelM.Cohen-BazireG. (1971). Purification and properties of unicellular blue-green algae (order Chroococcales). Bacteriol. Rev.35, 171–205.

  • 54

    StromM. S.LoryS. (1993). Structure-function and biogenesis of the type IV pili. Ann. Rev. Microbiol.47, 565–596. 10.1146/annurev.mi.47.100193.003025

  • 55

    WaksmanG.HultgrenS. J. (2009). Structural biology of the chaperone-usher pathway of pilus biogenesis. Nat. Rev. Microbiol.7, 765–774. 10.1038/nrmicro2220

  • 56

    WaterburyJ. B.WilleyJ. M.FranksD. G.ValoisF. W.WatsonS. W. (1985). A cyanobacterium capable of swimming motility. Science230, 74–76. 10.1126/science.230.4721.74

  • 57

    WatersL. S.StorzG. (2009). Regulatory RNAs in bacteria. Cell136, 615–628. 10.1016/j.cell.2009.01.043

  • 58

    XuW.ChenH.HeC.-L.WangQ. (2014). Deep sequencing-based identification of small regulatory RNAs in Synechocystis sp. PCC 6803. PLoS ONE9:e92711. 10.1371/journal.pone.0092711

  • 59

    YoshiharaS.GengX.IkeuchiM. (2002). pilG Gene cluster and split pilL genes involved in pilus biogenesis, motility and genetic transformation in the cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol.43, 513–521. 10.1093/pcp/pcf061

  • 60

    YoshiharaS.GengX.OkamotoS.YuraK.MurataT.GoM.et al. (2001). Mutational analysis of genes involved in pilus structure, motility and transformation competency in the unicellular motile cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol.42, 63–73. 10.1093/pcp/pce007

  • 61

    YoshimuraH.YoshiharaS.OkamotoS.IkeuchiM.OhmoriM. (2002). A cAMP receptor protein, SYCRP1, is responsible for the cell motility of Synechocystis sp. PCC 6803. Plant Cell Physiol.43, 460–463. 10.1093/pcp/pcf050

  • 62

    ZhanJ.ZhuX.ZhouW.ChenH.HeC.WangQ. (2016). Thf1 interacts with PS I and stabilizes the PS I complex in Synechococcus sp. PCC7942. Mol. Microbiol.102, 738–751. 10.1111/mmi.13488

  • 63

    ZhangY. M.ChenH.HeC. L.WangQ. (2013). Nitrogen starvation induced oxidative stress in an oil-producing green alga Chlorella sorokiniana C3. PLoS ONE8:e69225. 10.1371/journal.pone.0069225

Summary

Keywords

Synechocystis sp. PCC 6803, PilR, pilA11, pili, cell motility

Citation

Hu J, Zhan J, Chen H, He C, Cang H and Wang Q (2018) The Small Regulatory Antisense RNA PilR Affects Pilus Formation and Cell Motility by Negatively Regulating pilA11 in Synechocystis sp. PCC 6803. Front. Microbiol. 9:786. doi: 10.3389/fmicb.2018.00786

Received

18 February 2018

Accepted

06 April 2018

Published

23 April 2018

Volume

9 - 2018

Edited by

Weiwen Zhang, Tianjin University, China

Reviewed by

Jiangxin Wang, Shenzhen University, China; Takashi Osanai, Meiji University, Japan; Bao-Sheng Qiu, Central China Normal University, China

Updates

Copyright

*Correspondence: Qiang Wang

This article was submitted to Microbiotechnology, Ecotoxicology and Bioremediation, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics