ORIGINAL RESEARCH article

Front. Microbiol., 30 April 2018

Sec. Physiology and Metabolism of Microorganisms

Volume 9 - 2018 | https://doi.org/10.3389/fmicb.2018.00846

Dissecting the Acid Stress Response of Rhizobium tropici CIAT 899

  • 1. Programa de Ecología Genómica, Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Cuernavaca, Mexico

  • 2. Programa de Doctorado en Ciencias Biomédicas, Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Cuernavaca, Mexico

  • 3. Programa de Genómica Evolutiva, Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Cuernavaca, Mexico

Abstract

Rhizobium tropici CIAT899 is a nodule-forming α-proteobacterium displaying intrinsic resistance to several abiotic stress conditions such as low pH and high temperatures, which are common in tropical environments. It is a good competitor for Phaseolus vulgaris (common bean) nodule occupancy at low pH values, however little is known about the genetic and physiological basis of the tolerance to acidic conditions. To identify genes in R. tropici involved in pH stress response we combined two different approaches: (1) A Tn5 mutant library of R. tropici CIAT899 was screened and 26 acid-sensitive mutants were identified. For 17 of these mutants, the transposon insertion sites could be identified. (2) We also studied the transcriptomes of cells grown under different pH conditions using RNA-Seq. RNA was extracted from cells grown for several generations in minimal medium at 6.8 or 4.5 (adapted cells). In addition, we acid-shocked cells pre-grown at pH 6.8 for 45 min at pH 4.5. Of the 6,289 protein-coding genes annotated in the genome of R. tropici CIAT 899, 383 were differentially expressed under acidic conditions (pH 4.5) vs. control condition (pH 6.8). Three hundred and fifty one genes were induced and 32 genes were repressed; only 11 genes were induced upon acid shock. The acid stress response of R. tropici CIAT899 is versatile: we found genes encoding response regulators and membrane transporters, enzymes involved in amino acid and carbohydrate metabolism and proton extrusion, in addition to several hypothetical genes. Our findings enhance our understanding of the core genes that are important during the acid stress response in R. tropici.

Introduction

The response to acidic stress conditions is understood best in enterobacteria, and Escherichia coli, S. enterica var. Typhimurium, P. mirabilis and Y. enterocolitica (Castanie-Cornet et al., 1999; Kieboom and Abee, 2006; De Biase and Pennacchietti, 2012), all have effective systems to contend with acid stress. Well-known are the decarboxylation systems, which are composed of two components: a decarboxylase and an antiporter. Protons are consumed in the cytoplasm through the decarboxylation of specific amino acids and the corresponding antiporter exports the decarboxylation product and imports more of the required amino acid (Foster, 2004). The best-studied example is the glutamate decarboxylase (Gad) system depending upon the concerted action of glutamate decarboxylase (GadA/GadB) and of the glutamate/GABA antiporter, GadC (Foster, 1999; Audia et al., 2001; Lund et al., 2014).

Rhizobium tropici CIAT899 is an α-proteobacterium capable of establishing a symbiosis with different leguminous plants including common bean (Phaseolous vulgaris) (Martínez-Romero et al., 1991). During this symbiosis root nodules are formed, which are specialized organs where biological nitrogen fixation (BNF) will take place (Suzaki et al., 2015). The efficiency of this symbiosis can be restrained by different environmental conditions, such as high temperature and low pH (Martínez-Romero et al., 1991; Graham et al., 1994; Hungría et al., 2000; Vinuesa et al., 2003). For example under acidic pH conditions, where survival and persistence of the bacteria are limited, nodulation and BNF can be severely affected. Acidic conditions can be found in the rhizosphere of plants, where the pH is lowered by plant exudates containing protons and organic acids, and inside symbiosomes (Udvardi and Day, 1997). Compared to most other nodule-forming bacteria R. tropici CIAT899 presents an increased resistance to acidic growth conditions.

A few studies trying to identify the genetic determinants of growth at acidic pH have been made in R. tropici (Riccillo et al., 2000; Vinuesa et al., 2003; Rojas-Jiménez et al., 2005; Vences-Guzmán et al., 2011). In 2003, Vinuesa et al. (2003), identified novel rhizobial genes required for acid tolerance. During a screen of a small Tn5 mutant library composed of 1,728 clones, they identified two mutants affected in acid tolerance. In one mutant, the Tn5 was inserted in the sycA-olsC gene cluster and in the second mutant, it was inserted in the lpiA-atvA operon. OlsC catalyzes the hydroxylation at the 2-position of the secondary fatty acid of ornithine lipids (OLs). The presence of this hydroxyl group has been correlated later to an increase tolerance to acidic conditions and high temperatures in CIAT899 (Vinuesa et al., 2003; Rojas-Jiménez et al., 2005; Vences-Guzmán et al., 2011). LpiA is a lysyl-phosphatidylglycerol synthase homologous to MprF from Staphylococcus aureus and the atvA gene is encoding a putative serine lipase homologous to the virulence proteins AcvB and VirJ from Agrobacterium tumefaciens. It was demonstrated that lpiA is induced under acidic conditions, and that LpiA participates in lysyl-phosphatidylglycerol (LPG) biosynthesis, which confers an increased resistance of R. tropici CIAT899 to the cationic peptide polymyxin under acidic growth conditions (Vinuesa et al., 2003; Sohlenkamp et al., 2007). Transcriptional induction of lpiA expression was also induced in Sinorhizobium medicae and Sinorhizobium meliloti as part of the response to low pH (Reeve et al., 2006; Hellweg et al., 2009). GshB participates in glutathione biosynthesis (Riccillo et al., 2000), which is necessary to grow in several environmental conditions like oxidative stress, osmotic stress and acid stress and transcription of gshB is induced under acidic stress conditions as shown by quantitative PCR (Muglia et al., 2007).

In addition, the CIAT899 genome encodes homologs to several proteins that are involved in acid stress response in other bacteria: (1) eptA encodes a putative lipid A phosphoethanolamine transferase, which confers acid resistance in E. coli, Salmonella typhimurium, and Shigella flexneri 2a (Martinić et al., 2011); (2) cfa encodes cyclopropane-fatty-acyl-phospholipid synthase which enhances acid tolerance in E. coli by reducing the permeability of the membrane to H+ (Shabala and Ross, 2008; Sohlenkamp, 2017). Five different copies of cfa genes are encoded in the genome of R. tropici CIAT899; (3) H+/Cl antiporters are responsible for protons extrusion when E. coli or Helicobacter pylori are exposed to acidic conditions (Inoue et al., 1999; Padan et al., 2004; Padan, 2008). CIAT899 possesses four genes encoding antiporters that possibly help to maintain pH homeostasis; (4) Exopolysaccharide (EPS) biosynthesis has been related to acid tolerance. In S. meliloti it has been shown that genes related to EPS production are expressed under acidic conditions (Cunningham and Munns, 1984; Hellweg et al., 2009) and the genome of CIAT899 encodes several exo genes and EPS production could help the bacteria to resist acid stress. It is not known, if the orthologues to these genes involved in acid stress response in other bacteria have a function during the acid stress response in R. tropici.

Vinuesa et al. (2003) had identified at least two novel genes involved in the acid stress response in R. tropici out of a screen using only 1,728 mutants. As the genome of R. tropici CIAT899 contains more than 6,280 genes (Ormeño-Orrillo et al., 2012), we think that it should be possible to discover further novel genes having a function in acid stress response in this organism. Here we present a study combining random transposon mutagenesis with transcriptomics to obtain a broad catalog of genes important or essential for the acid stress response in R. tropici CIAT899.

Materials and methods

Bacterial strains and culture conditions

Bacterial strains and plasmids used in this work are listed in Table 1. R. tropici CIAT899 was routinely grown in TY medium (Beringer, 1974) or the minimal medium described by Kingsley and Bohlool (Kingsley and Bohlool, 1992), adjusted to pH 6.8 [MM- buffered to pH 6.8 with 20 mM Hepes (N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid))] or to pH 4.5 (MAM-buffered to pH 4.5 with 25 mM Homopipes (Homopiperazine-N,N′-bis-2-(ethanesulfonic acid))), Research Organics, Cleveland, OH, USA) at 30°C. MM and MAM were solidified with 0.8% gelrite (Carl Roth GmbH, Karlsruhe, Germany). E. coli strains were grown in Luria-Bertani (LB) medium at 37°C. Antibiotics were added at the following final concentrations (μg/mL): kanamycin (Km) 150; carbenicillin (Cb) 100; tetracycline (Tc) 10, and nalidixic acid (Nal) 20.

Table 1

Strains or plasmidRelevant characteristicsReferences
Rhizobium tropici
ACIAT899A bean-nodulating strain acid tolerant, NalrMartínez-Romero et al., 1991
Escherichia coli
DH5αrecA1, ΔacU169, _80dlacZΔM1Hanahan, 1983
HB101supE44 hsdS20 (r–Bm–B) recA13 ara-14 proA2 lacY1 galK2 rpsL20 syl-5 mtl-1New England Biolabs
S17.1thi pro hsdRhsdMΔ recA, RP4 integrated in the chromosome, 2-Tc::Mu- Km::Tn7(Tpr/Smr)Simon et al., 1983
PLASMIDS
pET17BExpression vector, CbrStudier, 1991
pRK404Broad-host-range vector, TcrDitta et al., 1985
pBBR5MCS-2Broad-host-range plasmid, KmrKovach et al., 1994
pUC18Cloning vector, AmprYanisch-Perron et al., 1985
pK18mobsacBConjugative suicide vector, KmrSchäfer et al., 1994
pSUP1011Mobilizable suicide plasmid for Tn5 mutagenesisSimon et al., 1983

Bacterial strains and plasmids used in this study.

ACIAT stands for “Centro Internacional de Agricultura Tropical,” which is located in Cali, Colombia.

Tn5 mutagenesis of Rhizobium tropici CIAT899

A general Tn5 transposon mutagenesis of R. tropici CIAT899 was performed via conjugal transfer of pSUP1021 into CIAT899 utilizing E. coli S17.1 as the donor strain (Simon et al., 1983). Appropriate dilutions were plated on TY medium, supplemented with kanamycin and nalidixic acid to select for Tn5 transconjugants. Individual colonies were transferred to microtiter plate wells with TY medium and were grown overnight at 30°C. Glycerol was added to a final concentration of 30% (w/v) and the mutant library was stored at −80 °C. To check the quality of the library, 10 transconjugants were randomly selected, genomic DNA was extracted, digested with EcoRI (New England Biolabs), and Southern blot hybridization was performed using a digoxigenin-labeled probe hybridizing to a fragment of the Tn5. The probe was synthesized using the oligos Tn5-1 and Tn5-2 (Table 2). This analysis established that the transposon had inserted in each strain only once and into different regions within the genome of R. tropici CIAT899.

Table 2

PrimerLengthDNA sequence (5′ to 3′)Tm* (°C)References
Tn5-120CATTGAAGCGGGAAGGGACT68.1This study
Tn5-220AGATCCTCGCCGTCGGGCAT69.8This study
BL20GGGGACCTTGCACAGATAGC55.8Huang et al., 2000
BR23CATTCCTGTAGCGGATGGAGATC56.9Huang et al., 2000
IR121GAGCAGAAGTTATCATGAACG50.3Huang et al., 2000
IR229CGGGATCCTCACATGGAAGTCAGATCCTG64.3Huang et al., 2000

Primers used in this study.

Tm* was calculated for DNA/DNA hybrid with a monovalent cation concentration of 100 mmol−1 using the program Tm calculator on the NEB webpage (http://tmcalculator.neb.com/#!/).

Screen for acid-sensitive mutants

The ordered mutant library was replica-plated from the glycerol stock onto TY plates and grown for 3 days. Clones were transferred using a 48-pin replicator onto MM and MAM plates, and grown for 5 days. Mutants that grew as the wildtype under neutral pH conditions (MM), but that were strongly affected or that did not grow at low pH (MAM) were selected for further analysis. The Tn5 insertion sites were mapped using two approaches. Most of the transposon insertion sites were determined using inverse PCR (iPCR) using the oligos described in Table 2. Briefly, 1 μg of genomic DNA of an acid-sensitive mutant is digested with the enzyme BamHI (New England Biolabs) that cuts just in the middle of the Tn5. Following digestion, the reactions were inactivated at 65°C for 15 min. The restricted DNA was circularized overnight at 16°C in 100 μL reactions with 200 U of T4 DNA ligase (New England Biolabs), and then purified with High Pure PCR Product Purification Kit (Roche). The iPCR mix contained 10 μL of 10x PCR buffer, 6 μL of 25 mM MgCl2 (final concentration of 1.5 mM), 2 μL 10 mM dNTP mix (final concentration of 200 μM each dNTP), 0.5 μM (4 μL) of each primer (different combinations like BL-IR1, BL-IR2, or BR-IR1, BR-IR2 were used for the amplification, see Table 2), 10 μL (500 ng) of circularized template and 1.6 U of rTth DNA polymerase XL (Applied Biosystems) and ultrapure water (Milli-Q). The target DNA sequence was amplified using the following program: 94°C for 10 min, then 35 cycles 94°C for 1 min, 68°C for 5 min and 72°C for 10 min, and finally 72 °C for 10 min. PCR products were purified and sequenced (using different combinations of primers (see Table 2) at the Institute of Biotechnology (IBt) of the UNAM and mapped to the reference genome to identify the position of the Tn5 insertions. For the other approach genomic DNA of acid-sensitive mutants was digested with EcoRI (cuts Tn5 sequence without damaging the kanamycin resistance cassette) and then cloned into pUC19. After transformation we selected for kanamycin-resistant clones containing the resistance cassette and flanking sequences from the R. tropici genome. Plasmids were sequenced, and the insertion sites were mapped in the reference genome.

RNA isolation

R. tropici CIAT899 was pre-grown in TY medium, then cultured in MM (control pH 6.8) (sample AR) or MAM (pH 4.5) (sample BR) until an OD620 of 0.6–0.7. For acid shock treatment cells were cultured in MM medium to mid-log phase, then washed with MAM and incubated another 45 min in MAM (pH 4.5) (sample CR). Cells were harvested by centrifugation and the pellets were immediately frozen in liquid nitrogen. Total RNA was prepared using the RNeasy mini kit (QIAGEN, Hildesheim, Germany) with some modifications. Pellets were resuspended in RLT buffer supplemented with lysozyme (20 mg per mL; QIAGEN, Hildesheim, Germany) and containing Zirconium Oxide Beads (0.5 mm, Next Advance). Cells were disrupted using the Bullet Blender Tissue Homogenizer (Next-Advance) in impact-resistant 2 mL tubes. Genomic DNA was eliminated by digestion with RNase-free DNase (QIAGEN, Hildesheim, Germany) for 20 min at room temperature. Final RNA concentrations were determined using a NanoDrop (Thermo Scientific). The typical OD260 to OD280 ratio of RNA samples was approximately 2.0. The integrity of RNA samples was verified using a TapeStation 2,200 instrument (Agilent Technologies) and the RNA integrity number (RINe) was determined. Three independent total RNA extractions were obtained for each condition and each one was analyzed separately.

RNA-seq and data analysis

RNA-Seq libraries were prepared using the TruSeq RNA sample Prep kit (Illumina) and sequenced (150 nt per read) by HiSeq 2500 instrument (Illumina) at the Beijing Genomics Institute (BGI, China). For the analysis of RNA-Seq data, Bowtie2 was used to align raw reads to the R. tropici CIAT 899 genome (Genbank entry CP004015, CP004016, CP004017, and CP004018) and samtools was used to obtain BAM files. Differentially expressed genes (DEGs) were obtained via NOISeq 2.14.1 Bioconductor package using local fit and betaPrior parameter set to False. NOISeq implements differential expression analysis based on the Negative Binomial distribution. A false discovery rate (FDR) threshold of 0.95 was set for DEG calling. Sample clustering and principal component analyses were performed upon variance stabilizing transformation of expression data (NOISeq package). Transcripts were called as differentially expressed when the FDR-Log2FC adjusted p-values were below 0.05 and fold-changes over 2 (Tarazona et al., 2011, 2015).

Functional categorization of genes

The Clusters of Orthologous Groups (COGs) database was used to classify DEGsin R. tropici CIAT899 into functional categories (https://www.ncbi.nlm.nih.gov/COG/).

Results

Insertional mutagenesis of Rhizobium tropici CIAT899 and selection of acid-sensitive transposon mutants

R. tropici CIAT899 has a 6.3 Mb genome in which some 6,280 protein-encoding genes are annotated. The aim was to saturate the genome with transposon insertions or at least to come close to saturation. An ordered library of 18,300 mutants was constructed using Tn5-derived transposons (Simon et al., 1983). For a small subset of mutants, we showed that each one presented a single Tn5-insertion and that they presented different RFLPs, indicating that the insertions were at different sites. Mutants were replica-plated on TY medium from the 96-well plate glycerol stock. After 3 days of growth, cells were replicated to minimal acid medium (MAM) and to neutral minimal medium (MM) to identify and select acid-sensitive mutants. Mutants were grown for 5 days, selecting those that grew at neutral pH as well as the wildtype but did not grow at acidic pH or that showed a drastically reduced growth under the latter condition (Figure 1). We grouped the mutants into two classes, those unable to grow at acid pH (AS: acid-sensitive) and those that presented only residual growth (MAS: mildly acid-sensitive). In total, 26 mutants were identified that showed growth deficiency under acid conditions, of these three are AS and 23 MAS at pH 4.5. We succeeded in identifying 17 Tn5 insertions among these (Table 3). Most mutants presented insertions sites in the chromosome (14 mutants), except JG283 and JG9867, for which the insertion site was located in the megaplasmid pC (locus tag RTCIAT899_RS28660, polysaccharide biosynthesis protein). Megaplasmid pC has the characteristics of a chromid (Harrison et al., 2010), since it harbors essential genes involved in the biosynthesis of vitamins like thiamine and cobalamine. For mutant JG6057 the transposon insertion site was located to the plasmid pA (locus tag RTCIAT899_ RS18385, hypothetical protein). This is the smallest plasmid of R. tropici CIAT899, it is self-transmissible and includes various conjugation systems genes (Figure 2 and Table 3). None of the insertions was localized in the symbiotic plasmid (pSym or pB).

Figure 1

Table 3

MutantLocus tagPhenotypelog2FCGen product
AR vs. BRAR vs. CR
JG241RTCIAT899_RS09205MAS0.0828204030.358090297Triose-phosphate isomerase
JG1042RTCIAT899_RS09635MAS0.5621355330.019664157Ribulose phosphate 3-epimerase.
JG4882RTCIAT899_RS05920MAS1.1276235340.775841137prolyl aminopeptidase
JG6187RTCIAT899_RS18500MAS0.27111160.62190933Acs acetyl-coenzyme A synthetase
JG5373RTCIAT899_RS15005MAS−0.191861430.374167234Glutathione-dependent formaldehyde-activating GFA
JG283 JG9867RTCIAT899_RS28660MAS−1.16368769−0.27188271Polysaccharide biosynthesis protein (pC)
JG8656RTCIAT899_RS13445MAS−0.16562978−0.35630822Ornithine lipid biosynthesis protein OlsC.
JG9587RTCIAT899_RS14675AS0.033702161−0.04398059K+/H+ antiporter
JG163RTCIAT899_RS14610AS0.8106025710.312163145Virulence factor family protein
JG9477RTCIAT899_RS00995MAS−0.07145354−0.56570741MarR family transcriptional regulator
JG8654RTCIAT899_RS09190MAS0.0489651210.482194227Transcriptional regulator FtrA
JG2646RTCIAT899_RS05450AS1.1317534571.39942044DNA-binding response regulator
JG1076RTCIAT899_RS31680MAS0.050745221−0.56595384Hypothetical protein
JG4655
JG6057RTCIAT899_RS18385MAS0.035556937−0.30504672Hypothetical protein (pA)
JG5634RTCIAT899_RS20115MAS0.436451660.498978895IS5/IS1182 family transposase

Description of the acid-sensitive mutants identified in the mutant library.

The site of transposon insertion, the phenotype and the predicted gene product are described for each mutant. For comparison, the expression data obtained by RNA-Seq for these genes are presented. For example the transposon insertion in mutant JG2646 was localized to a gene encoding a DNA-binding response regulator and its expression was more than 2-fold induced in both cases (AR vs. BR and AR vs. CR). AR vs. BR = pH 6.8 vs. pH 4.5, AR vs. CR, pH 6.8 vs. acid shock for 45 min to pH 4.5, pA, pRtrCIAT899a; pC, pRtrCIAT899c.

Figure 2

Transcriptomic analysis shows that many genes are expressed differentially in response to acidic conditions

The principal aim of this study was to identify novel genes important during acid stress in R. tropici. The screening of Tn5 mutants allowed us to identify genes that are important under acid stress, but dispensable under neutral pH conditions. Unfortunately, this approach would not allow for the identification of genes that are important during acid stress, but that are at the same time essential for growth at neutral pH. We guessed that these genes should be either transcriptionally induced or repressed during acid stress. R. tropici CIAT899 cells were grown under control conditions (pH 6.8 adapted, sample AR), in MAM at pH 4.5 (pH 4.5 adapted cells, sample BR), or pre-grown at pH 6.8 until an OD 600 nm of 0.6, washed and then transferred to pH 4.5 for 45 min (acid-shocked, sample CR). Three independent biological experiments were performed for each condition and transcriptomes were analyzed by RNA-Seq. Libraries were sequenced and between 6 and 11 million reads were obtained under each condition. Before subsequent analysis, a normalization process was carried out to eschew statistical deviations due to differences in library sizes (Alexandre et al., 2014). Differentially expressed genes in each condition were identified using the statistical software R (Figure 3). 394 genes were expressed differentially and most of these genes (353) were located in the chromosome, but a few were located in plasmid A (3), plasmid B (8), and plasmid C (30) (Figure 3A). RNA-seq data were submitted to the Sequence Read Archive (SRA) database with the accession number GSE108074.

Figure 3

When comparing the transcriptomes of cells grown at pH 6.8 to cells adapted to pH 4.5, we observed that 351 genes were induced (chromosome: 288, pA: 3, pB: 2 and pC:58, respectively) (Figure 4A). The large majority of these genes was located on the chromosome and several others on plasmid C. Only very few of the induced genes were on plasmids A and B. 32 genes were repressed (chromosome: 17 and pC: 15) (Figures 3B,C, 4A). However, when comparing the transcriptomes of cells grown at pH 6.8 to the transcriptome of cells pre-grown at pH 6.8 and then acid-shocked for 45 min, only 11 genes were up-regulated (chromosome: 6, pB: 1 and pC: 4) and no gene was down-regulated under these conditions (Figures 3D, 4).

Figure 4

Functional analysis of differentially expressed genes

Genes that were differentially expressed (DEGs) were grouped according to the COGs protein database (https://www.ncbi.nlm.nih.gov/COG/) and were classified into four principal categories: (1) processes and signaling, (2) information storage and processing, (3) metabolism and (4) poorly characterized (Figure 5). DEGs assigned to these principal categories were further sub-grouped. When comparing the transcriptomes of acid-adapted cells (sample BR) and control cells (sample AR), of the 126 differently expressed genes grouped into the COG category metabolism, 35 DEGs were assigned to amino acid transport and metabolism (E), 26 DEGs to inorganic ion transport and metabolism (P), 17 DEGs to energy production and conversion (C) and to coenzyme transport and metabolism (H), 15 DEGs to carbohydrate transport and metabolism (G), 7 DEGs to lipid transport and metabolism (I), 6 DEGs to nucleotide transport and metabolism (F) and finally 3 DEGs were assigned to the sub-category secondary metabolites biosynthesis, transport, and catabolism (Q). Another principal category that is also over-represented is information storage and processing (99 DEGs). Of these DEGs, 79 DEGs were grouped to the sub-categories translation, ribosome structure and biogenesis (J), 16 DEGs to transcription (K) and 4 DEGs to replication, recombination and repair (L). The third principal category is cellular processes and signaling with 55 DEGs. Of these, 19 DEGs were assigned to post-translational modification, protein turnover, and chaperones (O), 15 DEGs to cell wall/membrane/envelope biogenesis (M), 8 DEGs to intracellular trafficking, secretion, and vesicular transport (U), 6 DEGs to defense mechanisms (V), 5 DEGs to signal transduction mechanism (T) and 2 DEG to cell cycle control, cell division, chromosome partitioning (D). Finally, a few DEGs are poorly characterized and cannot be classified within the other principal categories. This includes General functional prediction only (R, 12 DEGs) and Function unknown (S, 14 DEGs) (Figure 5A). When we analyzed the DEGs that were repressed comparing the transcriptomes of acid-adapted cells and control cells, 8 DEGs were grouped in amino acid transport and metabolism (E), and 3 DEGs in carbohydrate transport and metabolism (G). To a few other subcategories, one DEG each was assigned (M, T, D, J, P, C, F, and S). When comparing the transcriptomes of acid-shocked cells and control cells, we found only 11 DEGs, with 6 DEGs grouped into the principal category metabolism and one DEG grouped into the principal category information storage and processing (Figure 5C). In total, 62 DEGs could not be classified in COGs (for all conditions).

Figure 5

Discussion

The effects of acid stress have been characterized best in Enterobacteriaceae that can be exposed to extreme changes in extracellular pH as they pass through the inhospitable environment of the stomach into the lower digestive tract (Foster, 2004; Lund et al., 2014). Rhizobia show significant variability in their ability to grow under different low pH conditions, and within this family R. tropici CIAT899 is among the most tolerant strains (Martínez-Romero et al., 1991; Graham et al., 1994). The capacity to grow and persist under environmental changes is essential for survival in the rhizosphere and within the nodules of leguminous plants. A Tn5-based transposon library of 18,300 insertional mutants was screened to identify mutants growing as the wildtype at neutral pH, but that did not grow or that showed a drastically reduced growth under low pH conditions. This strategy aimed at identifying genes specifically required for the acid stress response, but not for growth at neutral pH. We isolated 26 Tn5 mutants that were unable to grow under acidic conditions (see Table 3). For 17 of these we could identify the transposon insertion sites, which could be located mainly to the chromosome, but also to the plasmids pA and pC. None of the selected mutants presented an insertion site in the symbiotic plasmid pB (Figure 2).

Vinuesa et al. (2003) had made a similar screening, but on a much smaller scale. One of the mutants identified in the earlier study had an insertion in the sycA/olsC gene cluster (Vinuesa et al., 2003; Rojas-Jiménez et al., 2005). Interestingly, the mutant JG8656 identified in the present study also had an insertion in the gene olsC. This gene codes for the ornithine lipid (OLs) hydroxylase OlsC, which is responsible for the 2-hydroxylation of the secondary fatty acid in OLs. This hydroxylation has been correlated to an increased resistance of R. tropici to acid stress and high temperatures (Vences-Guzmán et al., 2011). One hypothesis is that the presence of the additional hydroxyl group allows the formation of hydrogen bonds between lipid head groups, thereby making the membrane less fluid and less permeable to protons (Nikaido, 2003; Rojas-Jiménez et al., 2005; Vences-Guzmán et al., 2011; Sohlenkamp and Geiger, 2016). Another gene found by Vinuesa et al. was lpiA (low pH inducible) encoding a putative lysyl-phosphatidylglycerol (LPG) synthase, implicated in LPG biosynthesis. LPG is a membrane lipid whose presence confers resistance to various cationic peptides to S. aureus (Peschel et al., 2001). The lpiA gene is found in an operon with atvA (acid tolerance and virulence), which is an orthologue of acvB from A. tumefaciens. Interestingly, in our study we found a mutant (JG163) affected in atvA, which is consistent with the results obtained by Vinuesa and co-workers (Vinuesa et al., 2003). Furthermore, three mutants were affected in a gene whose product is a hypothetical protein (JG1076, JG4655 and JG6057), in this case two of them have an insertion in the same ORF (JG1076, JG4655). Interestingly, two more mutants (JG283 and JG9867) also presented transposon insertions in an identical ORF. This could be indicating that the transposon mutagenesis is close to saturation.

Mutant JG241 presents an insertion in a gene encoding a putative triose phosphate isomerase enzyme (tpiA1). It has been reported that H. pylori, in addition to the genes involved in urea hydrolysis, induces genes at pH 5.5 that are related to carbohydrate metabolism (including the tpiA gene). An explanation suggested was that the cell's energy requirement is increased under this condition (Ang et al., 2001; Wen et al., 2003; Zanotti and Cendron, 2010). Besides, we found other mutants with insertions in genes related to anabolic and energy generation process like ribulose phosphate 3-epimerase (locus tag RTCIAT899_RS09635), prolyl aminopeptidase (RTCIAT899_RS05920) and acetyl-coenzyme A synthetase (Acs) (RTCIAT899_RS18500). Another mutant (JG283) presented an insertion in a gene encoding a polysaccharide biosynthesis protein. Polysaccharide and exopolysaccharide biosynthesis has been reported to help counteract high proton concentrations by preventing protons from passing into the cell (Aarons and Graham, 1991; Graham et al., 1994; Reeve et al., 1997, 1998; Hellweg et al., 2009). Mutant JG9587 has a Tn5 insertion in an ORF encoding a putative antiporter protein, whose function could be to expel protons toward the periplasm under acid stress conditions. In E. coli the Na+/H+ antiporter (NhaA) helps to maintain Na+ and H+ homeostasis and several reports indicate that NhaA activity is increased at high or neutral pH (Padan et al., 2004; Padan, 2008). In contrast, H. pylori has a Na+/H+ antiporter whose activity is high at acidic and neutral pH, indicating that H. pylori employs this antiporter under acidic conditions (Inoue et al., 1999).

In some bacteria an increase of the extracellular proton concentration is sensed through two-component systems (Lund et al., 2014), examples being the PhoPQ system from S. typhimurium which is induced in acidic conditions (Prost et al., 2007) and the ArsRS system from H. pylori, which senses increased proton concentrations and responds by regulating genes of biosynthesis and metabolism of the urease system (Pflock et al., 2006). Mutant JG2646 presented a transposon insertion in a gene encoding a response regulator. This gene is found in an operon with a gene encoding a histidine kinase, and so this two-component system may be sensing the external pH and may be responsible for the activation of a subset of genes under this condition. Two more mutants had transposon insertions in genes encoding transcription factors (JG9477 and JG8654). These genes code for proteins with homology to MarR and FtrA (locus tag RTCIAT899_ RS00995 and RTCIAT899_RS009190), respectively. MarR presents similarity to the transcriptional regulator Rv1404 from Mycobacterium tuberculosis, which regulates the transcription of the genes rv1403c and rv1405c encoding putative S-adenosyl methionine (SAM)-dependent methyltransferases. This activation under acid stress conditions (pH 5.5) also requires phoP (Healy et al., 2016). In the case of FtrA, there are no reports about its role acid stress conditions.

In mutant JG5373 the transposon insertion is probably affecting a gene whose product might be involved in catalyzing the condensation of formaldehyde and glutathione to S-hydroxymethylglutathion (gshA). In the genomic context of R. tropici CIAT899, a glutamate synthase (possibly gshB) is located downstream of gshA. Ricillo et al. reported that a mutant affected in a gene involved in the biosynthesis of tripeptide glutathione (gshB) in R. tropici was affected in growth under acidic conditions (Riccillo et al., 2000). It is possible that the transposon insertion in the mutant JG5373 creates a polar effect affecting glutathione biosynthesis and causing susceptibility to acid stress. Most often an polar effect occurs when the transposon is inserted into the first ORFs of an operon affecting the expression of the downstream genes of the same operon (Zipser, 1969). In our study, we identified three mutants (JG4882, JG163 and JG2646), whose Tn5 insertion occurred in putative operon, however, only the mutant JG2646 has the insertion in the first gene (Supplementary Figure S1) of the operon. The latter transposon insertion can be expected to cause a polar effect on the expression of the downstream genes. This hypothesis was verified by a complementation assay of mutant JG2646: the gene encoding for the response regulator alone was not able to complement the mutant phenotype when provided in trans whereas the complete operon (including the histidine kinase (HK), locus tag RT899_RS05455) complemented the mutant phenotype when provided in trans.

The results obtained by our library screening indicate that outside of certain conserved components of the acid stress response, such as response regulators or antiporters, the genes necessary for an acid stress response vary from species to species. To study the acid stress response from another angle we used RNA-seq to analyze the transcriptomes of R. tropici CIAT899 cells grown at neutral pH (6.8, control condition), of cells grown at pH 4.5 (acid-adapted cells), and of cells pre-grown at pH 6.8 and then acid-shocked for 45 min at pH 4.5. We chose such a short time (45 min) for the acid shock because we were interested in the very first transcriptional responses. Earlier transcriptome studies in S. meliloti 1021 applied a pH shift from pH 7.0 to pH 5.75 (the lowest pH at which S. meliloti grows) for varying times (from 3 to 63 min), observing the maximum induction between 33 and 63 min (Hellweg et al., 2009). Our RNA-seq results exhibit that gene expression of R. tropici CIAT899 was broadly changed by the acid stress. Hundreds of genes (351 up-regulated and 32 down-regulated in acidic conditions and 11 up-regulated in acid shock) were significantly up- or down-regulated under acidic conditions (Table 4 and Supplementary Table S1). These differently expressed genes (DEGs) can be functionally grouped according to the predicted functions of the encoded proteins. We identified several genes associated with metal transport (like RTCIAT899_RS04615, RTCIAT899_RS04620, RTCIAT899_RS04610, RTCIAT899_RS17535, RTCIAT899_RS10385, or RTCIAT899_RS14255). It is known that in tropical acid soils high concentrations of metals like Zn2+, Co2+, Cd2+, Ni2+, and often, Mn2+, Fe2+, Cu2+ and mercury ions are very common. Therefore, these metal transporters could be contributing to the efflux of these metals to avoid the toxic effects of metal ions (Montanini et al., 2007) when the cells encounter high proton and metal concentrations. ABC transporters transport solutes across the membrane utilizing the energy of ATP hydrolysis and they have been over-expressed after acid shock in other bacteria, including S. aureus (Bore et al., 2007). In our study, several of the identified DEGs encoded ABC transporters that were significantly over-expressed under acid stress (Jia et al., 2017) (Figure 5 and Supplementary Table S1). Furthermore, we identified a few putative transcription factors that might be implicated in the regulation of efflux pumps under acid stress (like DeoR, RTCIAT899_RS29995; TetR, RTCIAT899_RS10760, RTCIAT899_RS28830, or YebC/PmpR, RTCIAT899_RS14585). The TetR family of transcriptional regulators has been reported to be involved in the regulation of efflux pumps (Perrone et al., 2017) and drug efflux in mycobacteria (Betts et al., 2003; Wei et al., 2014). Among the DEGs that were up-regulated were also the hyc genes encoding hydrogenases proteins. In E. coli and Salmonella these hydrogenases can reduce acid stress by proton consumption and H2 production. In this study, 10 genes encoding hydrogenases were over-expressed and the transcriptional induction of hydrogenase genes observed in this study is probably involved in the acid stress response, indicating that R. tropici uses this mechanism to resist high proton concentrations (Supplementary Table S1; Hayes et al., 2006; Zbell and Maier, 2009; Noguchi et al., 2010; Jia et al., 2017). F0F1 synthase normally catalyzes the synthesis of ATP from ADP using the energy derived from an electrochemical proton gradient. Under acid stress conditions, hydrolysis of ATP may be used to expel protons from the cytoplasm. This flow of protons through the F0 subunit could contribute to pH homeostasis and therefore contributed to acid stress response like in E. coli or Corynebacterium glutamicum (Diez et al., 2004; Barriuso-Iglesias et al., 2013). In our study we identify two gene clusters encoding several subunits of F0F1 ATPase encompassing nine genes involved in the assembly of the two units of ATPase (F0 and F1), which are up-regulated more than 4 times at pH 4.5 compared to pH 6.8. Sigma factors are subunits of the bacterial RNA polymerase (RNAP) playing important roles in transcription initiation, especially during promoter recognition. Specific sigma factors have functions during the differential expression of genes during abiotic stress, during development or during specific growth phases (Paget, 2015). The sigma factor E (SigE) in M. tuberculosis is up-regulated during acid stress response, and Bansal et al. (2017) demonstrated that PhoP interacts with acid-inducible extra-cytoplasmic SigE to regulate a complex transcriptional of genes. In this study, we observed that three sigma factors (RTCIAT899_RS15835, RTCIAT899_RS13855, and RTCIAT899_RS12250) were induced during the acid stress response. These sigma factors are possibly responsible for regulating other genes important for growth under acid conditions. In addition, forty hypothetical proteins were differentially expressed in acidic conditions (see Table 4 and Supplementary Table S1). Further studies are required to explore the functions of these proteins under acid stress. We also specifically looked at the transcriptome data of orthologues of genes that had been reported to contribute to the acid stress response in other bacteria. For example, the gene glutathione synthase (RTCIAT899_RS01980) and the molecular chaperone DnaK (RTCIAT899_RS00760), have a log2FC of 1 and 1.8 respectively. Genes such as lpiA (RTCIAT899_RS14615) and atvA (RTCIAT899_RS14610) also have a similar log2FC, and most of the orthologues of genes involved in the acid response in other bacteria have very low log2FC values or are even repressed (Table 5). To our surprise only a very small number of genes was induced in response to 45 min of acid shock. We had designed our experiment based on the article published by Hellweg et al. (2009). Maybe the transcription induction responding to acid stress is slower in R. tropici, but there is also the possibility that pH 4.5 is not sufficiently stressful for the bacteria to induce a major short-term response (Figure 6). Although R. tropici grows slower at pH 4.5 than at pH 6.8, there is no clear adaptation phase visible in the growth curve obtained at the lower pH.

Table 4

Locus tagLocationLog2FCCOGFunction
UP-REGULATED GENES pH 4.5 vs. pH 6.8
RTCIAT899_RS04615Chromosome5.7363999PMn/Zn ABC transporter permease
RTCIAT899_RS04620Chromosome5.5273566PMn/Zn ABC transporter ATP-binding protein
RTCIAT899_RS26115pRtrCIAT899c5.2777315PPotassium-transporting ATPase subunit A
RTCIAT899_RS27660pRtrCIAT899c5.1789806QL-lysine 6-monooxygenase (Lysine 6-N-hydroxylase)(Lysine N(6)-hydroxylase) (Lysine-N-oxygenase)
RTCIAT899_RS10390Chromosome5.1308622PZinc ABC transporter substrate-binding protein
RTCIAT899_RS07330Chromosome5.1206373J30S ribosomal protein S7
RTCIAT899_RS07325Chromosome5.0474634J30S ribosomal protein S12
RTCIAT899_RS28825pRtrCIAT899c4.8717347KTPhage shock protein A, PspA
RTCIAT899_RS13555Chromosome4.7818776PHmuS-like siderophore transporter
RTCIAT899_RS01890Chromosome4.7545879SMetallopeptidase
RTCIAT899_RS13560Chromosome4.7083112PHemin ABC transporter substrate-binding protein
RTCIAT899_RS07335Chromosome4.6010438JElongation factor G
RTCIAT899_RS28820pRtrCIAT899c4.464704SHypothetical protein
RTCIAT899_RS29995pRtrCIAT899c4.3322649KGDeoR family transcriptional regulator
RTCIAT899_RS12735Chromosome4.3314229E2-isopropylmalate synthase
RTCIAT899_RS10890Chromosome4.252498EHAcetolactate synthase 3 large subunit
RTCIAT899_RS04610Chromosome4.1803897PMn/Zn ABC transporter substrate-binding protein
RTCIAT899_RS23310Chromosome4.173639Hypothetical protein
RTCIAT899_RS16580Chromosome2.2041402CF0F1 ATP synthase subunit epsilon
RTCIAT899_RS16685Chromosome1.8911647CDihydrolipoamide succinyltransferase
DOWN-REGULATED GENES pH 4.5 vs. pH 6.8
RTCIAT899_RS11180Chromosome−0.7724538DCell division protein FtsZ
RTCIAT899_RS25455pRtrCIAT899c−1.0066353COxidoreductase alpha (molybdopterin) subunit
RTCIAT899_RS15135Chromosome−1.0153571GMaltodextrin phosphorylase
RTCIAT899_RS02985Chromosome−1.2719958EGlutamine synthetase 2
RTCIAT899_RS15110Chromosome−1.7130873STransglutaminase
RTCIAT899_RS13620Chromosome−2.014387EZn-dependent hydrolase
RTCIAT899_RS01510Chromosome−2.4492838GSugar ABC transporter substrate-binding protein
RTCIAT899_RS28315pRtrCIAT899c−2.5649069THybrid sensor histidine kinase/response regulator
RTCIAT899_RS28150pRtrCIAT899c−2.594403GAmino acid ABC transporter substrate-binding protein
RTCIAT899_RS25690pRtrCIAT899c−2.6742957JAmidase
UP-REGULATED GENES SHOCK BY ACID (pH 4.5/45 MIN)
RTCIAT899_RS24705pRtrCIAT899c5.280397PNitrate ABC transporter, permease protein
RTCIAT899_RS10390Chromosome5.225411PZinc ABC transporter substrate-binding protein
RTCIAT899_RS24685pRtrCIAT899c4.829516CNitrate reductase
RTCIAT899_RS28825pRtrCIAT899c4.419892TPhage shock protein A, PspA
RTCIAT899_RS02060Chromosome3.059133PCholine-sulfatase
RTCIAT899_RS10890Chromosome2.250506HAcetolactate synthase 3 large subunit
RTCIAT899_RS16685Chromosome1.982522CDihydrolipoamide succinyltransferase

List of differentially expressed genes showing the strongest induction or repression.

Genes differentially expressed in both conditions are highlighted in boldface. DEGs were those with a p-value in hypergeometrical test inferior to 0.15.

Table 5

GeneLocus taglog2FCProductReferences
ABAC
lpiARTCIAT899_RS146150.720833860.17611909Low pH inducible proteinVinuesa et al., 2003
atvARTCIAT899_RS146100.810602570.31216314Acid tolerance and virulence protein
olsCRTCIAT899_RS13445−0.16562978−0.35630822Ornithine lipid biosynthesis protein OlsCVences-Guzmán et al., 2011
eptARTCIAT899_RS133650.45261766−0.28158652Phosphoethanolamine transferaseMartinić et al., 2011
cfa1RTCIAT899_RS042650.52083757−0.09048503Class I SAM-dependent methyltransferaseShabala and Ross, 2008
cfa2RTCIAT899_RS172350.03053786−0.92576353Class I SAM-dependent methyltransferase
cfa3RTCIAT899_RS24775−0.7897075−0.08312349Class I SAM-dependent methyltransferase
cfa4RTCIAT899_RS189400.678632170.54558424SAM-dependent methyltransferase
cfa5RTCIAT899_RS189600.182753740.45288988SAM-dependent methyltransferase
ExoRTCIAT899_RS06570−1.33771965−0.11074631EPS transporter familyYuan et al., 2008
exoXRTCIAT899_RS291150.105495870.69617043EPS production repressor protein ExoXHellweg et al., 2009
ExoRTCIAT899_RS296750.330667670.12072731EPS synthesis proteinCunningham and Munns, 1984
ExoRTCIAT899_RS24840−1.07127212−0.35927437Putative EPS biosynthesis protein
exoZRTCIAT899_RS07595−0.091697630.17806745EPS production protein exoz
ExoRTCIAT899_RS102400.06877117−0.05075594EPS biosynthesis protein
exoQRTCIAT899_RS29130−0.87644662−0.09605896EPS polymerase ExoQ
ExoRTCIAT899_RS27545−0.728364680.54432119EPS polymerization protein
ExoRTCIAT899_RS24315−0.11007681−0.08717239EPS biosynthesis protein
ExoRTCIAT899_RS24280−0.29950943−0.15973563EPS biosynthesis protein
trkDRTCIAT899_RS041050.2878656−0.04007632Potassium transporter KupFoster, 2004
gshBRTCIAT899_RS019801.006621680.28522761Glutathione synthaseRiccillo et al., 2000
kefB/kefCRTCIAT899_RS04005−0.133254590.09956478System protein KefB/KefC
ClcRTCIAT899_RS10520−0.010912420.05697754Chloride channel proteinAccardi and Miller, 2004
ClcRTCIAT899_RS04900−0.00017649−0.31726611ClC-type chloride channel
ClcRTCIAT899_RS146500.02874732−0.2712195ClC-type chloride channel
sycARTCIAT899_RS134500.00631424−0.32276777ClC-type chloride channelRojas-Jiménez et al., 2005
dnaKRTCIAT899_RS007601.835443660.34592161Molecular chaperone DnaKTeixeira-Gomes et al., 2000; Bearson et al., 2006
groLRTCIAT899_RS039350.61461457−0.3681504Molecular chaperone GroELZanotti and Cendron, 2010
groSRTCIAT899_RS039400.9051802−0.26609308Molecular chaperone GroESZanotti and Cendron, 2010
ureCRTCIAT899_RS13685−0.75813131−0.1082779Urease subunit alphaMobley et al., 1995; Bandara et al., 2007
ureERTCIAT899_RS13675−0.907717140.23427801Urease accessory protein UreE
ureFRTCIAT899_RS13670−0.71555469−0.03317185Urease accessory protein UreF
ureRTCIAT899_RS13700−1.03377163−0.10253492Urease subunit beta
ureRTCIAT899_RS13715−1.185106040.08358709Urease accessory protein
ureRTCIAT899_RS13710−0.99533936−0.03468376Urease subunit gamma
ureGRTCIAT899_RS13665−2.472687770.08669492Urease accessory protein UreG
ureRTCIAT899_RS13690−0.777581670.04132216Urease accessory protein
ureRTCIAT899_RS13705−0.92906417−0.10094011Hypothetical protein

Expression of genes whose orthologues are reported to be involved in acid stress response in other bacteria.

Figure 6

As expected, both, the Tn5 mutagenesis and RNA-seq approach, produced complementary sets of results. But, the use of both approaches allows the identification of a wider range of genes involved in the acid stress response. Therefore, with this work, we make an important step toward comprehending the genetic bases to understanding the acid stress response in R. tropici CIAT899. Much works remains to be done to understand how all the identified genes contribute to the acid stress response. This is especially interesting in the case of genes where the correlation to acid stress is not completely obvious.

Statements

Author contributions

JG-C and CS designed the study. JG-C and CS carried out the experiments. JG-C and LL carried out the data analysis. JG-C and CS were involved in drafting the manuscript and all authors read and approved the final manuscript.

Acknowledgments

JG-C was a recipient of a Ph.D. scholarship from the Consejo Nacional de Ciencia y Tecnología (CONACyT) and this article is part of his thesis at the Ph.D. Program in Biomedical Sciences (Programa de Doctorado en Ciencias Biomédicas) of the Universidad Nacional Autónoma de México (UNAM). Research in our lab was supported by grants from CONACyT-Mexico (153200, 237713), PAPIIT/UNAM (IN202413 and IN208116), and UC-MEXUS/CONACyT (CN-12-552) to CS.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2018.00846/full#supplementary-material

Supplementary Table S1

Complete list of differentially expressed genes. DEGs over-regulated in acid stress conditions. AR_vs_BR_UP (pH 6.8 vs. pH 4.5), AR_vs_BR_DOWN (pH 6.8 vs. pH 4.5) and AR_vs_CR_UP (pH 6.8 vs. acid shock 45 min). Genes differentially expressed in both conditions are highlighted in boldface.

Supplementary Figure S1

Genomic context of Tn5 mutants from R. tropici CIAT899. White arrows represent the genes that were interrupted by the transposon Tn5 (yellow triangles), gray arrows represent neighboring genes to each mutated gene, black lines indicate the genome of R. tropici CIAT899.

References

  • 1

    AaronsS. R.GrahamP. H. (1991). Response of Rhizobium leguminosarum bv phaseoli to acidity. Plant Soil134, 145151. 10.1007/BF00010727

  • 2

    AccardiA.MillerC. (2004). Secondary active transport mediated by a prokaryotic homologue of ClC Cl- channels. Nature427, 803807. 10.1038/nature02314

  • 3

    AlexandreA.LaranjoM.OliveiraS. (2014). Global transcriptional response to heat shock of the legume symbiont Mesorhizobium loti MAFF303099 comprises extensive gene downregulation. DNA Res.21, 195206. 10.1093/dnares/dst050

  • 4

    AngS.LeeC. Z.PeckK.SindiciM.MatrubuthamU.GleesonM. A.et al. (2001). Acid-induced gene expression in Helicobacter pylori: study in genomic scale by microarray. Infect. Immun.69, 16791686. 10.1128/IAI.69.3.1679-1686.2001

  • 5

    AudiaJ. P.WebbC. C.FosterJ. W. (2001). Breaking through the acid barrier: an orchestrated response to proton stress by enteric bacteria. Int. J. Med. Microbiol.291, 97106. 10.1078/1438-4221-00106

  • 6

    BandaraA. B.ContrerasA.Contreras-RodríguezA.MartinsA. M.DobreanV.Poff-ReichowS.et al. (2007). Brucella suis urease encoded by ure1 but not ure2 is necessary for intestinal infection of BALB/c mice. BMC Microbiol.7:57. 10.1186/1471-2180-7-57

  • 7

    BansalR.Anil KumarV.SevalkarR. R.SinghP. R.SarkarD. (2017). Mycobacterium tuberculosis virulence-regulator PhoP interacts with alternative sigma factor SigE during acid-stress response. Mol. Microbiol.104, 400411. 10.1111/mmi.13635

  • 8

    Barriuso-IglesiasM.BarreiroC.Sola-LandaA.MartinJ. F. (2013). Transcriptional control of the F0F1-ATP synthase operon of Corynebacterium glutamicum: sigmaH factor binds to its promoter and regulates its expression at different pH values. Microb. Biotechnol.6, 178188. 10.1111/1751-7915.12022

  • 9

    BearsonS. M.BearsonB. L.RasmussenM. A. (2006). Identification of Salmonella enterica serovar typhimurium genes important for survival in the swine gastric environment. Appl. Environ. Microbiol.72, 28292836. 10.1128/AEM.72.4.2829-2836.2006

  • 10

    BeringerJ. E. (1974). R factor transfer in Rhizobium leguminosarum. J. Gen. Microbiol.84, 188198. 10.1099/00221287-84-1-188

  • 11

    BettsJ. C.McLarenA.LennonM. G.KellyF. M.LukeyP. T.BlakemoreS. J.et al. (2003). Signature gene expression profiles discriminate between isoniazid-, thiolactomycin-, and triclosan-treated Mycobacterium tuberculosis. Antimicrob. Agents Chemother.47, 29032913. 10.1128/AAC.47.9.2903-2913.2003

  • 12

    BoreE.LangsrudS.LangsrudO.RodeT. M.HolckA. (2007). Acid-shock responses in Staphylococcus aureus investigated by global gene expression analysis. Microbiology153, 22892303. 10.1099/mic.0.2007/005942-0

  • 13

    Castanie-CornetM. P.PenfoundT. A.SmithD.ElliottJ. F.FosterJ. W. (1999). Control of acid resistance in Escherichia coli. J. Bacteriol.181, 35253535.

  • 14

    CunninghamS. D.MunnsD. N. (1984). The correlation between extracellular polysaccharide production and acid tolerance in Rhizobium. Soil Sci. Soc. Am. J.48, 12731276. 10.2136/sssaj1984.03615995004800060014x

  • 15

    De BiaseD.PennacchiettiE. (2012). Glutamate decarboxylase-dependent acid resistance in orally acquired bacteria: function, distribution and biomedical implications of the gadBC operon. Mol. Microbiol.86, 770786. 10.1111/mmi.12020

  • 16

    DiezM.ZimmermannB.BorschM.KonigM.SchweinbergerE.SteigmillerS.et al. (2004). Proton-powered subunit rotation in single membrane-bound F0F1-ATP synthase. Nat. Struct. Mol. Biol.11, 135141. 10.1038/nsmb718

  • 17

    DittaG.SchmidhauserT.YakobsonE.LuP.LiangX. W.FinlayD. R.et al. (1985). Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitoring gene expression. Plasmid13, 149153. 10.1016/0147-619X(85)90068-X

  • 18

    FosterJ. W. (1999). When protons attack: microbial strategies of acid adaptation. Curr. Opin. Microbiol.2, 170174. 10.1016/S1369-5274(99)80030-7

  • 19

    FosterJ. W. (2004). Escherichia coli acid resistance: tales of an amateur acidophile. Nat. Rev. Microbiol.2, 898907. 10.1038/nrmicro1021

  • 20

    GrahamP. H.DraegerK. J.FerreyM. L.ConroyM. J.HammerB. E.MartínezE.et al. (1994). Acid pH tolerance in strains of Rhizobium and Bradyrhizobium, and initial studies on the basis for acid tolerance of Rhizobium tropici Umr1899. Can. J. Microbiol.40, 198207. 10.1139/m94-033

  • 21

    HanahanD. (1983). Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol.166, 557580. 10.1016/S0022-2836(83)80284-8

  • 22

    HarrisonP. W.LowerR. P.KimN. K.YoungJ. P. (2010). Introducing the bacterial 'chromid': not a chromosome, not a plasmid. Trends Microbiol.18, 141148. 10.1016/j.tim.2009.12.010

  • 23

    HayesE. T.WilksJ. C.SanfilippoP.YohannesE.TateD. P.JonesB. D.et al. (2006). Oxygen limitation modulates pH regulation of catabolism and hydrogenases, multidrug transporters, and envelope composition in Escherichia coli K-12. BMC Microbiol.6:89. 10.1186/1471-2180-6-89

  • 24

    HealyC.GolbyP.MacHughD. E.GordonS. V. (2016). The MarR family transcription factor Rv1404 coordinates adaptation of Mycobacterium tuberculosis to acid stress via controlled expression of Rv1405c, a virulence-associated methyltransferase. Tuberculosis97, 154162. 10.1016/j.tube.2015.10.003

  • 25

    HellwegC.PühlerA.WeidnerS. (2009). The time course of the transcriptomic response of Sinorhizobium meliloti 1021 following a shift to acidic pH. BMC Microbiol.9:37. 10.1186/1471-2180-9-37

  • 26

    HuangG.ZhangL.BirchR. G. (2000). Rapid amplification and cloning of Tn5 flanking fragments by inverse PCR. Lett. Appl. Microbiol.31, 149153. 10.1046/j.1365-2672.2000.00781.x

  • 27

    HungríaM.AndradeD. D.ChueireL. M. D.ProbanzaA.Guttiérrez-ManeroF. J.MegíasM. (2000). Isolation and characterization of new efficient and competitive bean (Phaseolus vulgaris L.) rhizobia from Brazil. Soil Biol. Biochem.32, 15151528. 10.1016/S0038-0717(00)00063-8

  • 28

    InoueH.SakuraiT.UjikeS.TsuchiyaT.MurakamiH.KanazawaH. (1999). Expression of functional Na+/H+ antiporters of Helicobacter pylori in antiporter-deficient Escherichia coli mutants. FEBS Lett.443, 1116. 10.1016/S0014-5793(98)01652-4

  • 29

    JiaK.WangG. Y.LiangL. J.WangM.WangH. H.XuX. L. (2017). Preliminary transcriptome analysis of mature biofilm and planktonic cells of Salmonella enteritidis exposure to acid stress. Front. Microbiol.8:1861. 10.3389/fmicb.2017.01861

  • 30

    KieboomJ.AbeeT. (2006). Arginine-dependent acid resistance in Salmonella enterica serovar typhimurium. J. Bacteriol.188, 56505653. 10.1128/JB.00323-06

  • 31

    KingsleyM. T.BohloolB. (1992). Extracellular polysaccharide is not responsible for aluminum tolerance of Rhizobium leguminosarum bv phaseoli CIAT899. Appl. Environ. Microbiol.58, 10951101.

  • 32

    KovachM. E.PhillipsR. W.ElzerP. H.RoopR. M.PetersonK. M. (1994). pBBR1mcs - a broad-host-range cloning vector. Biotechniques16, 800802.

  • 33

    LundP.TramontiA.De BiaseD. (2014). Coping with low pH: molecular strategies in neutralophilic bacteria. FEMS Microbiol. Rev.38, 10911125. 10.1111/1574-6976.12076

  • 34

    Martínez-RomeroE.SegoviaL.MercanteF. M.FrancoA. A.GrahamP.PardoM. A. (1991). Rhizobium tropici, a novel species nodulating Phaseolus vulgaris L. beans and Leucaena sp. trees. Int. J. Syst. Bacteriol.41, 417426. 10.1099/00207713-41-3-417

  • 35

    MartinićM.HoareA.ContrerasI.AlvarezS. A. (2011). Contribution of the lipopolysaccharide to resistance of Shigella flexneri 2a to extreme acidity. PLoS ONE6:e25557. 10.1371/journal.pone.0025557

  • 36

    MobleyH. L.IslandM. D.HausingerR. P. (1995). Molecular biology of microbial ureases. Microbiol. Rev.59, 451480.

  • 37

    MontaniniB.BlaudezD.JeandrozS.SandersD.ChalotM. (2007). Phylogenetic and functional analysis of the Cation Diffusion Facilitator (CDF) family: improved signature and prediction of substrate specificity. BMC Genomics8:107. 10.1186/1471-2164-8-107

  • 38

    MugliaC. I.GrassoD. H.AguilarO. M. (2007). Rhizobium tropici response to acidity involves activation of glutathione synthesis. Microbiology153, 12861296. 10.1099/mic.0.2006/003483-0

  • 39

    NikaidoH. (2003). Molecular basis of bacterial outer membrane permeability revisited. Microbiol. Mol. Biol. Rev.67, 593656. 10.1128/MMBR.67.4.593-656.2003

  • 40

    NoguchiK.RigginsD. P.EldahanK. C.KitkoR. D.SlonczewskiJ. L. (2010). Hydrogenase-3 contributes to anaerobic acid resistance of Escherichia coli. PLoS ONE5:e10132. 10.1371/journal.pone.0010132

  • 41

    Ormeño-OrrilloE.MennaP.AlmeidaL. G. P.OlleroF. J.NicolasM. F.RodriguesE. P.et al. (2012). Genomic basis of broad host range and environmental adaptability of Rhizobium tropici CIAT 899 and Rhizobium sp PRF 81 which are used in inoculants for common bean (Phaseolus vulgaris L.). BMC Genomics13:735. 10.1186/1471-2164-13-735

  • 42

    PadanE. (2008). The enlightening encounter between structure and function in the NhaA Na+-H+ antiporter. Trends Biochem. Sci.33, 435443. 10.1016/j.tibs.2008.06.007

  • 43

    PadanE.TzuberyT.HerzK.KozachkovL.RimonA.GaliliL. (2004). NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+ antiporter. Biochim. Biophys. Acta1658, 213. 10.1016/j.bbabio.2004.04.018

  • 44

    PagetM. S. (2015). Bacterial sigma factors and anti-sigma factors: structure, function and distribution. Biomolecules5, 12451265. 10.3390/biom5031245

  • 45

    PerroneF.De SienaB.MuscarielloL.KendallS. L.WaddellS. J.SaccoM. (2017). A novel TetR-Like transcriptional regulator is induced in acid-nitrosative stress and controls expression of an efflux pump in mycobacteria. Front. Microbiol.8:2039. 10.3389/fmicb.2017.02039

  • 46

    PeschelA.JackR. W.OttoM.CollinsL. V.StaubitzP.NicholsonG.et al. (2001). Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with L-lysine. J. Exp. Med.193, 10671076. 10.1084/jem.193.9.1067

  • 47

    PflockM.FinstererN.JosephB.MollenkopH.MeyerT. F.BeierD. (2006). Characterization of the ArsRS regulon of Helicobacter pylori, involved in acid adaptation. J. Bacteriol.188, 34493462. 10.1128/JB.188.10.3449-3462.2006

  • 48

    ProstL. R.DaleyM. E.Le SageV.BaderM. W.Le MoualH.KlevitR. E.et al. (2007). Activation of the bacterial sensor kinase PhoQ by acidic pH. Mol. Cell26, 165174. 10.1016/j.molcel.2007.03.008

  • 49

    ReeveW. G.BrauL.CastelliJ.GarauG.SohlenkampC.GeigerO.et al. (2006). The Sinorhizobium medicae WSM419 IpiA gene is transcriptionally activated by FsrR and required to enhance survival in lethal acid conditions. Microbiology152, 30493059. 10.1099/mic.0.28764-0

  • 50

    ReeveW. G.DilworthM. J.TiwariR. P.GlennA. R. (1997). Regulation of exopolysaccharide production in Rhizobium leguminosarum biovar viciae WSM710 involves exoR. Microbiology143, 19511958. 10.1099/00221287-143-6-1951

  • 51

    ReeveW. G.TiwariR. P.WongC. M.DilworthM. J.GlennA. R. (1998). The transcriptional regulator gene phrR in Sinorhizobium meliloti WSM419 is regulated by low pH and other stresses. Microbiology144, 33353342. 10.1099/00221287-144-12-3335

  • 52

    RiccilloP. M.MugliaC. I.de BruijnF. J.RoeA. J.BoothI. R.AguilarO. M. (2000). Glutathione is involved in environmental stress responses in Rhizobium tropici, including acid tolerance. J. Bacteriol.182, 17481753. 10.1128/JB.182.6.1748-1753.2000

  • 53

    Rojas-JiménezK.SohlenkampC.GeigerO.Martínez-RomeroE.WernerD.VinuesaP. (2005). A CIC chloride channel homolog and ornithine-containing membrane lipids of Rhizobium tropici CIAT899 are involved in symbiotic efficiency and acid tolerance. Mol. Plant-Microbe Interact.18, 11751185. 10.1094/MPMI-18-1175

  • 54

    SchäferA.TauchA.JägerW.KalinowskiJ.ThierbachG.PühlerA. (1994). Small mobilizable multipurpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19 - selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene145, 6973. 10.1016/0378-1119(94)90324-7

  • 55

    ShabalaL.RossT. (2008). Cyclopropane fatty acids improve Escherichia coli survival in acidified minimal media by reducing membrane permeability to H+ and enhanced ability to extrude H+. Res. Microbiol.159, 458461. 10.1016/j.resmic.2008.04.011

  • 56

    SimonR.PrieferU.PühlerA. (1983). A broad host range mobilization system for in vivo genetic engineering - transposon mutagenesis in gram-negative bacteria. Bio-Technology1, 784791. 10.1038/nbt1183-784

  • 57

    SohlenkampC. (2017). Membrane homeostasis in bacteria upon pH challenge, in Biogenesis of Fatty Acids, Lipids and Membranes, ed GeigerO. (Cham: Springer International Publishing), 113.

  • 58

    SohlenkampC.Galindo-LagunasK. A.GuanZ. Q.VinuesaP.RobinsonS.Thomas-OatesJ.et al. (2007). The lipid lysyl-phosphatidylglycerol is present in membranes of Rhizobium tropici CIAT899 and confers increased resistance to polymyxin B under acidic growth conditions. Mol. Plant Microbe Interact.20, 14211430. 10.1094/MPMI-20-11-1421

  • 59

    SohlenkampC.GeigerO. (2016). Bacterial membrane lipids: diversity in structures and pathways. FEMS Microbiol. Rev.40, 133159. 10.1093/femsre/fuv008

  • 60

    StudierF. W. (1991). Use of bacteriophage-T7 lysozyme to improve an inducible T7 expression system. J. Mol. Biol.219, 3744. 10.1016/0022-2836(91)90855-Z

  • 61

    SuzakiT.YoroE.KawaguchiM. (2015). Chapter three - leguminous plants: inventors of root nodules to accommodate symbiotic bacteria, in International Review of Cell and Molecular Biology, ed JeonK. W. (Okazaki: Academic Press), 111158.

  • 62

    TarazonaS.Furio-TariP.TurraD.Di PietroA.NuedaM. J.FerrerA.et al. (2015). Data quality aware analysis of differential expression in RNA-seq with NOISeq R/Bioc package. Nucleic Acids Res.43:e140. 10.1093/nar/gkv711

  • 63

    TarazonaS.Garcia-AlcaldeF.DopazoJ.FerrerA.ConesaA. (2011). Differential expression in RNA-seq: a matter of depth. Genome Res.21, 22132223. 10.1101/gr.124321.111

  • 64

    TatusovR. L.GalperinM. Y.NataleD. A.KooninE. V. (2000). The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res.28, 3336. 10.1093/nar/28.1.33

  • 65

    Teixeira-GomesA. P.CloeckaertA.ZygmuntM. S. (2000). Characterization of heat, oxidative, and acid stress responses in Brucella melitensis. Infect. Immun.68, 29542961. 10.1128/IAI.68.5.2954-2961.2000

  • 66

    UdvardiM. K.DayD. A. (1997). Metabolite transport across symbiotic membranes of legume nodules. Annu. Rev. Plant Physiol. Plant Mol. Biol.48, 493523. 10.1146/annurev.arplant.48.1.493

  • 67

    Vences-GuzmánM. A.GuanZ.Ormeno-OrrilloE.González-SilvaN.López-LaraI. M.Martínez-RomeroE.et al. (2011). Hydroxylated ornithine lipids increase stress tolerance in Rhizobium tropici CIAT899. Mol. Microbiol.79, 14961514. 10.1111/j.1365-2958.2011.07535.x

  • 68

    VinuesaP.Neumann-SilkowF.Pacios-BrasC.SpainkH. P.Martínez-RomeroE.WernerD. (2003). Genetic analysis of a pH-regulated operon from Rhizobium tropici CIAT899 involved in acid tolerance and nodulation competitiveness. Mol. Plant-Microbe Interact.16, 159168. 10.1094/MPMI.2003.16.2.159

  • 69

    WeiJ.LiangJ. C.ShiQ. Y.YuanP.MengR. Z.TangX. D.et al. (2014). Genome-wide transcription analyses in Mycobacterium tuberculosis treated with lupulone. Braz. J. Microbiol.45, 333341. 10.1590/S1517-83822014005000032

  • 70

    WenY.MarcusE. A.MatrubuthamU.GleesonM. A.ScottD. R.SachsG. (2003). Acid-adaptive genes of Helicobacter pylori. Infect. Immun.71, 59215939. 10.1128/IAI.71.10.5921-5939.2003

  • 71

    Yanisch-PerronC.VieiraJ.MessingJ. (1985). Improved M13 phage cloning vectors and host strains - nucleotide-sequences of the M13mp18 and pUC19 vectors. Gene33, 103119. 10.1016/0378-1119(85)90120-9

  • 72

    YuanZ. C.LiuP.SaenkhamP.KerrK.NesterE. W. (2008). Transcriptome profiling and functional analysis of Agrobacterium tumefaciens reveals a general conserved response to acidic conditions (pH 5.5) and a complex acid-mediated signaling involved in Agrobacterium-plant interactions. J. Bacteriol.190, 494507. 10.1128/JB.01387-07

  • 73

    ZanottiG.CendronL. (2010). Functional and structural aspects of Helicobacter pylori acidic stress response factors. IUBMB Life62, 715723. 10.1002/iub.382

  • 74

    ZbellA. L.MaierR. J. (2009). Role of the hya hydrogenase in recycling of anaerobically produced H-2 in Salmonella enterica serovar Typhimurium. Appl. Environ. Microbiol.75, 14561459. 10.1128/AEM.02064-08

  • 75

    ZipserD. (1969). Polar mutations and operon function. Nature221, 2125.

Summary

Keywords

Rhizobium tropici CIAT899, pH, acid stress response, Tn5, transcriptome, RNA-Seq

Citation

Guerrero-Castro J, Lozano L and Sohlenkamp C (2018) Dissecting the Acid Stress Response of Rhizobium tropici CIAT 899. Front. Microbiol. 9:846. doi: 10.3389/fmicb.2018.00846

Received

22 December 2017

Accepted

12 April 2018

Published

30 April 2018

Volume

9 - 2018

Edited by

Marc Strous, University of Calgary, Canada

Reviewed by

Ernesto Ormeño-Orrillo, National Agrarian University, Peru; Amy Michele Grunden, North Carolina State University, United States

Updates

Copyright

*Correspondence: Christian Sohlenkamp

This article was submitted to Microbial Physiology and Metabolism, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics