In the original article, there was a typographical mistake in Table 1 as published. The sequence of Yan-R primer should read “TGTTGAGGAGTCTACCTATTTG”. The Yan-R primer sequence was given correct in the Supplementary Table 2. The correct Yan-R primer was used in experiments undertaken in this study and thus it does not impact on validity of the results. The corrected Table 1 appears below.
Table 1
| Primers | Nucleotide sequence 5' to 3' | Expected position | References |
|---|---|---|---|
| P326(+) | GACTTCGAGGCNGANCTCGCT | 330–350 | Liu et al., 2007 |
| P12(-) | GCTCCGTCTGTGACCGCAAT | 1226–1245 | Liu et al., 2007 |
| P115(+) | GGGTTTTTAGAGGGGCTCTGT | 1157–1177 | Liu et al., 2007 |
| OYV5(-) | TCACCATGTTGAAGCCGTATT | 2199–2219 | This study |
| OYV4(+) | ATGTTCGTTGAGGATAAGATGC | 1973–1994 | This study |
| OYV1(-) | AGTACGTGAGAGCTAATGTAC | 2800–2820 | This study |
| Shu-F | TACGGTAAGTGCCCAACTCC | 2650–2669 | Malmstrom and Shu, 2004 |
| Yan-R | TGTTGAGGAGTCTACCTATTTG | 3459–3480 | Malmstrom and Shu, 2004 |
| OYV2(+) | TGAACTCGACACTGCGTGCA | 3237–3256 | This study |
| OYV3(-) | CTACCCGAGCTTATGAACCT | 4857–4876 | This study |
| P47(+) | GCAAAGGAGTACAAGGCACAAT | 4777–4798 | Liu et al., 2007 |
| P55(-) | GGATTGCTATGGTTTATGTCC | 5491–5511 | Liu et al., 2007 |
| OYV5pR1 | AAGTCCGTCCAAGCCTCGG | 533–541 | This study |
| OYV5pR2 | CTTTGACGCTGGCTCCAATGAGC | 161–183 | This study |
| PasF | GAAGAGGGCCAAATTCTATACC | 3003–3024* | This study |
| OyvF | CCAATTCCTCAGGGATCC | 3080–3097 | This study |
| GavF | GTTACAAGATCACAAACGTCAAG | 3156–3178** | This study |
| PavF | CTTCACAATCAGCAGGAC | 3261–3278*** | This study |
Primers used in the current study.
Primer binding positions are shown respective to full length sequence of BYDV-OYV Avinurme2 isolate (MK012645; unless mentioned otherwise).
BYDV-PAS (MK012660),
BYDV-GAV (MK012663), and
BYDV-PAV (MK012661).
The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Publisher's Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
LiuF.WangX.LiuY.XieJ.GrayS. M.ZhouG.et al. (2007). A Chinese isolate of barley yellow dwarf virus-PAV represents a third distinct species within the PAV serotype. Arch. Virol.152, 1365–1373. 10.1007/s00705-007-0947-8
2
MalmstromC.ShuR. (2004). Multiplexed RT-PCR for streamlined detection and separation of barley and cereal yellow dwarf viruses. J. Virol. Methods120, 69–78. 10.1016/j.jviromet.2004.04.005
Summary
Keywords
HTS, Luteovirus, BYDV, CYDV, diagnostics, wheat, epidemiology, OYV
Citation
Sõmera M, Massart S, Tamisier L, Sooväli P, Sathees K and Kvarnheden A (2021) Corrigendum: A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated. Front. Microbiol. 12:772637. doi: 10.3389/fmicb.2021.772637
Received
08 September 2021
Accepted
26 October 2021
Published
19 November 2021
Approved by
Frontiers Editorial Office, Frontiers Media SA, Switzerland
Volume
12 - 2021
Updates
Copyright
© 2021 Sõmera, Massart, Tamisier, Sooväli, Sathees and Kvarnheden.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Merike Sõmera merike.somera@taltech.ee
This article was submitted to Microbe and Virus Interactions with Plants, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.