ORIGINAL RESEARCH article

Front. Microbiol., 03 November 2022

Sec. Food Microbiology

Volume 13 - 2022 | https://doi.org/10.3389/fmicb.2022.989824

In silico genomic analysis of the potential probiotic Lactiplantibacillus pentosus CF2-10N reveals promising beneficial effects with health promoting properties

  • Área de Microbiología, Departamento de Ciencias de la Salud, Facultad de Ciencias Experimentales, Universidad de Jaén, Jaén, Spain

Abstract

Lactiplantibacillus pentosus CF2-10 N, isolated from brines of naturally fermented Aloreña green table olives, exhibited high probiotic potential. High throughput sequencing and annotation of genome sequences underline the potential of L. pentosus CF2-10 N as excellent probiotic candidate of vegetable origin. In a previous study we could show the probiotic potential of CF2-10 N in vitro, while in this study in silico analysis of its genome revealed new insights into its safety and functionality. Our findings highlight the microorganism’s ecological flexibility and adaptability to a broad range of environmental niches, food matrices and the gastrointestinal tract. These features are shared by both phylogenetically very close L. pentosus strains (CF2-10 N and MP-10) isolated from the same ecological niche with respect to their genome size (≅ 3.6 Mbp), the presence of plasmids (4–5) and several other properties. Nonetheless, additional and unique features are reported in the present study for L. pentosus CF2-10 N. Notably, the safety of L. pentosus CF2-10 N was shown by the absence of virulence determinants and the determination of acquired antibiotic resistance genes, i.e., resistome, which is mostly represented by efflux-pump resistance genes responsible for the intrinsic resistance. On the other hand, defense mechanisms of L. pentosus CF2-10 N include eight prophage regions and a CRISPR/cas system (CRISPR-I and CRISPR-II) as acquired immune system against mobile elements. Finally, the probiotic potential of this strain was further demonstrated by the presence of genes coding for proteins involved in adhesion, exopolysaccharide biosynthesis, tolerance to low pH and bile salts, immunomodulation, and vitamin and enzyme production. Taken together these results, we propose the use of L. pentosus CF2-10 N as a potential and promising probiotic candidate able to colonize several niches and adapt to different lifestyles. The strain can provide attractive functional and probiotic features necessary for its application as starter culture and probiotic.

Introduction

Probiotics are defined by the Food and Agriculture Organization of the United Nations/World Health Organization (FAO/WHO) “as live microorganisms that, when administered in adequate amounts, confer a health benefit to the host” (Hill et al., 2014). In this regard, probiotic microorganisms are characterized by their diverse origin, taxonomy, fitness, effective dose, host and health benefits depending specifically on the strain employed. Thus, preliminary screening criteria for potential probiotic microorganisms include their capacity to withstand several barriers and challenges (1) in vitro, such as stressful environmental conditions; and (2) in vivo-notably during their passage through the gastrointestinal tract (acids and bile salts), their capacity to adhere and colonize human epithelial cells and their ability to produce beneficial effects in the host (antimicrobial activity, modulation of the immune system, degradation of toxic components, etc.).

In this sense, the key element for the differentiation of probiotic strains from each other is their specific functionality. Naturally, this has led to a considerable amount of research efforts put into determining the specific probiotic effect(s) of each potential probiotic strain and highlighting their potential targets over recent years (Allain et al., 2018; van de Wijgert and Verwijs, 2019; Yan et al., 2019; Yoha et al., 2022). In other words, a search for unique and attractive functional characteristics is crucial to provide new and helpful information on microorganisms with probiotic potential. This is especially important for those microorganisms that are naturally present in fermented foods, such as for example Lactiplantibacillus species.

On the other hand, probiotics as indicated by their name, act as a ‘promoter of life’ supporting in a natural way the improvement of the overall health status of the host organism (Amara and Shibl, 2015). It has further been shown that it is possible to combine several of these strains into multi-strain probiotics (Nayak, 2010), where the strains of this ‘probiotic cocktail’ can work synergistically, thus greatly increasing the overall benefit spectrum for the host (Puvanasundram et al., 2021).

The recently reclassified Lactiplantibacillus pentosus, formerly known as Lactobacillus pentosus (Zheng et al., 2020), colonizes a large set of environmental niches and therefore exhibits a huge ecological and metabolic adaptability (Anukam et al., 2013; Abriouel et al., 2017; Pérez-Díaz et al., 2021). Due to its genomic diversity and functionality, this species is found in several fermented foods (vegetables, meat, and dairy), plants, animals, vaginal, urogenital and gastrointestinal tract, while also having a large set of biotechnological and probiotic applications (Tofalo et al., 2014; Vaccalluzzo et al., 2020).

Lactiplantibacillus pentosus together with L. plantarum is an important member of the bacterial community found on the surface of olive fruits and thus represent the predominating bacteria in olive fermentation. Notably, they promote the fermentation process, conservation and extension of shelf life of the product, in addition to their role in organoleptic properties and the production of health promoting molecules such as amino acids, short chain fatty acids (SCFA), antioxidants, exopolysaccharides and vitamins (Caggianiello et al., 2016; Carrasco et al., 2018; Benítez-Cabello et al., 2019; Perpetuini et al., 2020). Furthermore, besides the production of the abovementioned molecules in foods such as olives, these bacteria are also able to produce these substances in vivo, i.e., in the gastrointestinal tract thus providing an important probiotic effect (Oguntoyinbo and Narbad, 2015; Saxami et al., 2017; Guantario et al., 2018). Consequently, several fermented foods have been classified as functional foods, as they are carriers of probiotic organisms and/or their molecules. In this regard, the health benefit and functionality of table olives goes beyond just “fermented food” due to their ability to deliver beneficial microbes adhering to the drupe epidermis into the human gastrointestinal tract where they may influence the microbial diversity and functionality (Lavermicocca et al., 2005; Rodríguez-Gómez et al., 2014, 2017).

Among olives, naturally fermented Aloreña green table olives are a promising carrier of probiotics since they are characterized by their diverse microbial community. This is mostly due to the richness of the ecosystem (soil, plant, and brine) and the progressive changes inherent to the production process (Abriouel et al., 2011).

The microbial diversity of Aloreña table olives includes lactic acid bacteria (LAB), mainly L. pentosus-yeasts and other contaminant microorganism, with microbial profiles greatly depending on the fermentation conditions (e.g., vat, fermenter or in cold). In this regard, however under vat and fermenter conditions, LAB and yeasts have been determined as the main actors (Abriouel et al., 2011). Among LAB, L. pentosus are considered potential probiotics due to their good growth capacity and survival rate under simulated gastro-intestinal conditions (acidic pH of 1.5, up to 4% of bile salts and 5 mM of nitrate), auto-aggregation, co-aggregation with pathogenic bacteria, adhesion to intestinal and vaginal cell lines, biofilm formation, fermentation of several prebiotics and their capacity to ferment lactose among others (Pérez Montoro et al., 2016). In addition, omics approaches were used by our group; including genomics, proteomics and transcriptomics, to determine and confirm the safety and functionality of the probiotic L. pentosus isolated from Aloreña table olives (Casado Muñoz et al., 2016; Pérez Montoro et al., 2018a, b; Alonso García et al., 2021, 2023).

Hence, in the present study, we extend the characterization of L. pentosus using in silico genomic analysis to unveil the genetic basis of the safety and probiotic ability of L. pentosus CF2-10 N – one of the most promising potential probiotic strains isolated from Aloreña table olives (Abriouel et al., 2012).

Materials and methods

Bacterial strain and growth conditions

Lactiplantibacillus pentosus CF2-10 N, originally isolated from naturally fermented Aloreña green table olives (Abriouel et al., 2012), was selected based on its probiotic profile as reported by Pérez Montoro et al. (2016). Lactiplantibacillus pentosus CF2-10 N was routinely cultured at 37°C in de Man, Rogosa and Sharpe (MRS) broth or agar (Fluka, Madrid, Spain) under aerobic (atmospheric) conditions for 24–48 h. The strain was kept in 20% glycerol at −80°C for long-term storage.

DNA extraction, library preparation and genome sequencing

Bacterial cells of L. pentosus CF2-10 N were harvested by centrifugation after 18 h incubation at 37°C under aerobic conditions in liquid medium. Total genomic DNA was obtained using the PureGene core kit B, according to the manufacturer’s instructions (Qiagen, Spain). DNA quantification and quality assessment were carried out using a NanoDrop 2000 spectrophotometer (Thermo Scientific), the PicoGreen ds DNA Reagent (Invitrogen) and/or agarose gel electrophoresis (0.8% agarose gel in Tris-borate-EDTA buffer, 90V, 45 min). Bacterial DNA was stored at −20°C until required.

Purified genomic DNA was sheared into 10- to 20-kb fragments using the protocol designed for DNA library preparation using the PacBio RS II System (Pacific Biosciences, Menlo Park, CA, United States). Resulting libraries (22–24 kb) were purified and sequenced using a P6-C4 DNA polymerase (Pacific Biosciences) and single-molecule real-time (SMRT) cells with a 240-min sequence capture protocol and Stage Start to maximize the subread length on the PacBio RS II.

Genome assembly and annotation

Raw sequence data were filtered (Q20) and a total of 150,292 reads were obtained with a median length of 14,991 bp. The resulting reads were assembled de novo following the Hierarchical Genome Assembly Process (HGAP3.0) approach (SMRT analysis version: 2.3.0, patch #4) for Pacific Bioscience using the WGS-Celera Assembler 7.0 (Myers et al., 2000) and Quiver algorithm (Chen-Shan Chin et al., 2013). Once assembled, the prediction of Coding DNA Sequences (CDS) was done with the help of the GenMark program (Besemer et al., 2001). Furthermore, prediction of tRNA, rRNA, and mRNA genes and signal peptides in the sequences was achieved using tRNAscan (version 2.0), RNAmmer (Version 1.2), HMMer [HMMER 3.1 (July 2017)]1 programs, respectively (Lowe and Eddy, 1997; Lagesen et al., 2007). The assembled genome sequences were annotated using the BLAST2go program version 4.1.9 (Conesa et al., 2005) followed by a complementary annotation specific for protein domains using the HMMer program [HMMER 3.1 (July 2017)] see footnote 2 and Pfam database. Furthermore, the annotation process also included blasting genes against Clusters of Orthologous Groups (COGs) of proteins using the WebMGA server (Wu et al., 2010). The circular maps of chromosome and plasmids were performed by Artemis and DNAPlotter software (Carver et al., 2005, 2009).

Genome sequencing, assembly, and annotation were done at Biopolis (Valencia, Spain). The complete genome sequence of L. pentosus CF2-10 N was deposited at the EMBL Nucleotide Sequence Database (accession number of ERR11550479).

Comparative genomic analysis of Lactiplantibacillus pentosus CF2-10 N and other Lactiplantibacillus pentosus strains

Genome sequences of L. pentosus CF2-10 N and other L. pentosus strains (MP-10, IG1 and KCA1) were aligned using MAUVE (Darling et al., 2004) available in DNASTAR Lasergene (version 17.3). Trees were then generated using RAxML with default parameters (Stamatakis, 2014). Further genome alignment and comparison of L. pentosus CF2-10 N and other L. pentosus strains (IG1 and KCA1) isolated from different ecological niches or L. plantarum WCFS1 (as reference strain) was done using the MUMmer program (version 3.0), considering alignment > 500 bp. The genome accession numbers of strains used in this study are as follows: L. pentosus IG1 (PRJEA67801), L. pentosus KCA1 (PRJNA81575, GenBank assembly accession GCA_000271445.1) and L. plantarum WCFS1 (PRJNA356, GenBank assembly accession GCA_000203855.3). Functional annotation of CDS (COG) for the three strains (L. pentosus IG1, L. pentosus KCA1 and L. plantarum WCFS1) was completed following the same strategy as for L. pentosus CF2-10 N by using reciprocal blast (BLAST2go) program version 4.1.9 (Conesa et al., 2005) and the available genome sequences in NCBI.

Genomic analysis of safety aspects and defense mechanisms of Lactiplantibacillus pentosus CF2-10 N

For specific annotation of antibiotic resistance genes (ARGs), the Resistance Gene Identifier (RGI) software (as part of the CARD “The Comprehensive Antibiotic Resistance Database” tools; Alcock et al., 2020) was used for the prediction of the L. pentosus CF2-10 N resistome from protein or nucleotide data based on homology and SNP (Single Nucleotide Polymorphism) models, employing the CARD’s curated AMR (antimicrobial resistance) detection models (last accessed in March 2022). In addition, the genome of L. pentosus CF2-10 N was investigated for acquired antibiotic resistance genes/chromosomal mutations mediating antimicrobial resistance through the ResFinder3 software version 4.1 (Zankari et al., 2012; Bortolaia et al., 2020) with selected %ID threshold of 90.00% and selected minimum length of 60% (last accessed in March 2022).

Regarding virulence factors (VFs), the predicted CDSs were annotated using reciprocal BLAST against the Virulence Factors of Bacterial Pathogens (VFDB) database. Hits were considered positive when the results of reciprocal BLAST were similar, employing a 80% sequence similarity cut-off (Liu et al., 2019).

Concerning mobile genetic elements, the annotated genome sequence of L. pentosus CF2-10 N was screened for the presence of conjugative plasmid, transposase, transposon, IS elements and prophage coding genes. The genome was searched for Insertion Sequences (IS) using the ISfinder search tool (Zhang et al., 2000). Furthermore, complementary information on prophage DNA within the L. pentosus CF2-10 N genome was obtained by using bioinformatic tools such as PHASTER’s version (PHAge Search Tool Enhanced Release, last updated March 2016; corresponding to the updated prophage/virus database PHAST “PHAge Search Tool”) for the rapid identification and annotation of prophage sequences within bacterial genomes and plasmids (Zhou et al., 2011; Arndt et al., 2016).

Finally, the annotated genome sequence of L. pentosus CF2-10 N was screened for the presence of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) coding genes and the localization of CRISPR RNAs targets was identified using the CRISPRDetect program version 2.4 (Biswas et al., 2016).4

Genomic analysis of probiotic properties of Lactiplantibacillus pentosus CF2-10 N

To identify the putative genes associated with probiotic characteristics in L. pentosus CF2-10 N, the annotated genome sequence was screened for the presence of genes coding for proteins involved in cell adhesion (mucus binding proteins, cell surface proteins and moonlighting proteins among others), exopolysaccharide (EPS) biosynthesis, tolerance to low pH and bile salts, enzyme production, vitamin biosynthesis and host immunomodulation.

Results

General genomic features of a probiotic Lactiplantibacilluis pentosus CF2-10 N

The analysis revealed that the Lactiplantibacillus pentosus CF2-10 N genome consisted of a single circular chromosome of 3,645,747 bp, with an estimated mol% G + C content of 46.42% and 4 plasmids ranging 58–120 kb (Figure 1). The annotated genome sequence (Figure 1) revealed 3,713 open reading frames (ORFs), of which 75.4% (2,801) were attributed to a COG (Cluster of Orthologous Groups) family and/or were given a functional description (Supplementary Table S1). Furthermore, 16 rRNA genes were predicted in L. pentosus CF2-10 N genome using RNAmmer (version 1.2), while 67 tRNA encoding sequences were identified corresponding to all 20 amino acids and three undermined amino acids (Supplementary Table S2).

Figure 1

Supplementary Figure S1 shows the biological processes, the cellular components and the molecular function frequencies predicted in L. pentosus CF2-10 N. Among the Gene Ontology (GO) terms, those related to biological processes such as oxidation–reduction process, regulation of transcription, DNA-templated transcription and DNA-templated transmembrane transport were the most identified. Regarding molecular function, ATP-binding and DNA binding were the most prevalent. However, in both biological process and molecular function about 1,250–1,550 genes have no known biological process/function (Supplementary Figure S1).

The most abundant COG category of L. pentosus CF2-10 N genome, except for “[S] Function unknown” (273 CDSs, 9.7%), was “[R] General function prediction only” (336 CDSs, 12%), followed by “[G] Carbohydrate transport and metabolism” (307 CDSs, 11%), “[K] Transcription” (235 CDSs, 8.4%), “[L] Replication, recombination and repair” (213 CDSs, 7.6%) and “[E] Amino acid transport and metabolism” (192 CDSs, 6.9%), accounting for 45.9% of the overall CDS (1,283/2,801 CDSs; Supplementary Table S3).

Comparative genome analysis of Lactiplantibacillus pentosus CF2-10 N

Comparative genomic analysis of L. pentosus CF2-10 N and L. pentosus MP-10 isolated from the same ecological niche (Aloreña table olives) showed that both L. pentosus strains shared 99.87% identity as revealed by sequence alignment using the MAUVE algorithm. This high similarity was further highlighted by large blocks of colinearization in the MAUVE alignment, being the synteny of genes similar, although inversion, insertion and rearrangement occurred (Figure 2). Besides L. pentosus MP-10 (isolated from Aloreña table olives), comparison with other L. pentosus strains by genome sequence alignment (using MAUVE), notably IG1 (isolated from olives) and KCA1 (isolated from the vaginal tract), revealed genetic differences among the studied strains (Supplementary Figure S2A). To illustrate this relationship, a maximum-likelihood core genome tree was constructed using RaxML which showed higher phylogenetic similarity in the case of L. pentosus CF2-10 N and MP-10 strains (evolutionary distance “ED,” ED = 0), followed by L. pentosus IG1 (ED = 0.02) and then L. pentosus KCA1 (ED = 0.08; Supplementary Figure S2B).

Figure 2

The synteny linkage of L. pentosus CF2-10 N against L. pentosus IG1 and KCA1 strains or L. plantarum WCFS1 was further analyzed using the MUMmer program and represented using Circos (Figure 3; Supplementary Tables S4S6). Here, the genome comparison revealed the presence of highly conserved syntenic blocks between L. pentosus strains (IG1 and KCA1; Figures 3A,B), and to a lesser extent with L. plantarum WCFS1 (Figure 3C). On the other hand, comparison of the number of unique and shared annotated genes of L. pentosus CF2-10 N and other strains (L. pentosus IG1, L. pentosus KCA1 or L. plantarum WCFS1) using reciprocal blast revealed unique genomic features in L. pentosus CF2-10 N (Figure 4).

Figure 3

Figure 4

Finally, L. pentosus CF2-10 N appears to share both core and accessory annotated genes with L. pentosus KCA1 (88.93% hits, Figure 4B) and L. pentosus IG1 (87.34% hits; Figure 4A) and to a slightly lesser extent with L. plantarum WCFS1 (83.48%, Figure 4C).

In silico analysis of safety determinants and defense mechanisms of Lactiplantibacillus pentosus CF2-10 N

Safety properties are a crucial feature of potential probiotic strains and their determination is considered a priority when characterizing a new potential probiotic. Hence, in a first step, antibiotic resistance and virulence determinants were screened in the L. pentosus CF2-10 N genome sequence. To do so, in silico prediction of antibiotic resistance genes (ARG) was done against the Comprehensive Antibiotic Resistance Database (CARD) using the RGI tool v3.2.1 available in the CARD database5 which used archive’s curated AMR (antimicrobial resistance) detection models. Results indicated no ARG in the L. pentosus CF2-10 N genome sequence. Thus, neither resistance genes nor mutations conferring antibiotic resistance was predicted in the complete resistome of L. pentosus CF2-10 N. However BLAST2go annotation revealed the presence of non-specific antimicrobial resistance mechanisms relying on efflux transporters or transmembrane proteins involved in response to antibiotics such as ABC transporter ATP-binding protein (encoded by LPE_03051, LPE_00789, FD24_GL000501 genes), TIGR00374 family protein (encoded by mprF gene), undecaprenyl-diphosphatase (encoded by uppP gene), QacE family quaternary ammonium compound efflux SMR transporter (encoded by FD24_GL003284 gene), MATE family efflux transporter (encoded by LPE_00986 gene) and cation efflux pump (encoded by FD24_GL002035 gene).

With regard to acquired resistance by horizontal gene transfer, ResFinder did not detect any acquired antibiotic resistance genes for aminoglycoside, beta-lactam, colistin, disinfectant, fluoroquinolone, fosfomycin, fusidic acid, glycopeptide, MLS-series (Macrolide, lincosamide and streptogramin B), nitroimidazole, oxazolidinone, phenicol, pseudomonic acid, rifampicin, sulphonamide, tetracycline and trimethoprim (data not shown).

Regarding virulence, the predicted CDSs annotated using reciprocal BLAST against VFDB (database including only experimentally validated virulence factors) did not identify any known virulence factors including toxins.

Analysis of the L. pentosus CF2-10 N mobilome showed that the bacterial genome included 66 transposases: 19 transposases, 1 transposase family protein A and 46 transposases belonging to nine IS transposase families (4 IS3, 6 IS5, 5 IS21, 17 IS30, 4 IS66, 3 IS1380, 2 ISL3, 2 DDE, 2 IS6501, 1 IS200/IS605), mainly located on plasmids (pLPE10-1, pLPE10-2 and pLPE10-4) rather than on the chromosome (50 on plasmids/16 on chromosome) and appearing in multiple copies ranging from two to five (Table 1). IS30 family transposases were abundant (17 of 66 transposases) and were represented by seven different genes (Table 1). Furthermore, Blastp alignment of transposase protein sequences detected in L. pentosus CF2-10 N genome showed high similarity with L. pentosus (29 of 66 transposases, 98.9–100%), L. plantarum (11 of 66 transposases, 95.2–100%) and other lactobacilli. It is noteworthy to indicate the presence of 34 paired (adjacent to each other in the genome) transposase genes (2 or 3 genes) being different genes or belonging to different families and located on both chromosome and plasmids (Table 1). Regarding IS elements, 45 CDS were predicted distributed into 16 different families and in various bacteria (Table 2). Here, IS30 and IS3 were the most detected elements followed by IS5 (Table 2).

Table 1

Gene IDGenePositionStrandGene lengthProtein descriptionCOG ID (COG description)COG class (COG class description)Similarity to transposase in Lactiplantibacillus*
gene_86gene_8689,400-90,662+1,263ISL3 family transposase99.3% L. pentosus
gene_204LPENT_00003219,476–220,444969MULTISPECIES: IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_638gene_638700,336–701,4751,140TransposaseCOG0675 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_639LPE_01510701,456–701,908453Transposase family protein ACOG1943 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_700FD14_GL001685761,249–762,5591,311IS1380 family transposase100% L. pentosus
gene_1236gene_12361,345,052–1,345,423+372IS5 family transposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% P. acidilactici
gene_1237gene_12371,345,396–1,345,827+432Putative transposase for insertion sequence element IS6501COG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)97.9% L. plantarum
gene_2023tnp12,236,745–2,237,668924MULTISPECIES: IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Terrabacteria group
gene_2025FD24_GL0026072,239,842–2,240,885+1,044MULTISPECIES: IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)99.7% Lactiplantibacillus
gene_2321HR47_011502,551,136–2,552,023+888IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_2680FD14_GL0016852,918,782–2,920,0921,311IS1380 family transposase100% L. pentosus
gene_2,707HR47_011502,948,652–2,949,539+888IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_2843HR47_011503,146,814–3,147,701+888IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_3192gene_31923,516,037–3,516,375+339MULTISPECIES: IS5 family transposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Bacilli
gene_3261gene_32613,595,253–3,596,5211,269TransposaseCOG0675 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3262LPE_001943,596,619–3,597,059+441IS200/IS605 family transposaseCOG1943 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3455£FD47_GL00048624,260-25,4741,215IS21 family transposaseCOG4584 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Lactiplantibacillus
gene_3464£FD14_GL00168536,418-37,728+1,311IS1380 family transposase100% L. pentosus
gene_3465£LPE_0310338,516-39,514+999IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% L. pentosus
gene_3484£LSEI_200853,623-54,552930MULTISPECIES: IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)99.7% Lactobacillales
gene_3486£gene_348655,300-57,009+1710DDE transposaseCOG3666 (Transposase and inactivated derivatives)L (Replication, recombination and repair)98.9% L. plantarum
gene_3490£FD47_GL00048659,298-60,5121,215IS21 family transposaseCOG4584 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Lactiplantibacillus
gene_3492£LPENT_0000362,337-63,305969MULTISPECIES: IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_3505£gene_350573,427-75,0761,650DDE transposaseCOG3666 (Transposase and inactivated derivatives)L (Replication, recombination and repair)99.5% L. plantarum
gene_3506£gene_350675,204-75,746543TransposaseCOG3666 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3507£gene_350775,794-76,501708Transposase, partialCOG2963 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3509£gene_350977,298-77,729432Putative transposase for insertion sequence element IS6501COG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)97.9% L. plantarum
gene_3510£gene_351077,702-78,073372IS5 family transposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% P. acidilactici
gene_3519£FD47_GL00273883,726-84,565840ISSth1, transposase (Orf2), IS3 familyCOG2801 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3520£LPENT_0006384,601-85,323723Transposase (transposase, IS3 family protein)COG2963 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3530£LPENT_0000391,009-91,977969MULTISPECIES: IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_3557£FD47_GL000486116,556-117,7701,215IS21 family transposaseCOG4584 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Lactiplantibacillus
gene_3565§gene_35654,191-4,487+297Transposase (plasmid)100% L. plantarum
gene_3566§gene_35664,782-5,018+237Transposase (plasmid)COG3464 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. plantarum
gene_3568§FC27_GL0012956,430-6,975+546TransposaseCOG3328 (Transposase and inactivated derivatives)L (Replication, recombination and repair)98.9% L. paraplantarum
gene_3569§LPENT_001257,062-7,991+930Transposase TraISLpl1 (IS30 family)COG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)99.7% L. pentosus
gene_3574§gene_357410,980-11,261282Transposase IS6698.9% L. pentosus
gene_3576§gene_357611,507-12,5201,014IS66 family transposaseCOG3436 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3577§gene_357712,731-12,940210MULTISPECIES: transposaseCOG3436 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3579§gene_357913,597-14,094+498TransposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3603§gene_360336,269-36,484+216MULTISPECIES: transposaseCOG3464 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3607§FC99_GL00034440,024-40,968+945IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% L. pentosus
gene_3609§gene_360942,455-42,751+297Transposase (plasmid)100% L. plantarum
gene_3610§gene_361043,046-43,282+237Transposase (plasmid)COG3464 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. plantarum
gene_3612§FC27_GL00129544,694-45,239+546TransposaseCOG3328 (Transposase and inactivated derivatives)L (Replication, recombination and repair)98.9% L. paraplantarum
gene_3613§LPENT_0012545,326-46,255+930Transposase TraISLpl1 (IS30 family)COG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)99.7% L. pentosus
gene_3619§gene_361949,243-49,524282Transposase IS6698.9% L. pentosus
gene_3621§gene_362150,051-50,782732IS66 family transposaseCOG3436 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3622§gene_362250,992-51,201210MULTISPECIES: transposaseCOG3436 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3624§gene_362451,857-52,252+396TransposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3642&gene_36424,323-4,721399TransposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. plantarum
gene_3643&gene_36434,784-5,122339MULTISPECIES: IS5 family transposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Bacilli
gene_3652&gene_365212,866-13,795+930IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)99.3% L. pentosus
gene_3658&HR47_0115018,998-19,885888IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_3659&FD47_GL00048620,362-21,576+1,215IS21 family transposaseCOG4584 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Lactiplantibacillus
gene_3663&gene_366323,236-23,574339MULTISPECIES: IS5 family transposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Bacilli
gene_3667&gene_366726,120-26,794675TransposaseCOG3415 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Loigolactobacillus
gene_3669&FD00_GL00237727,785-29,125+1,341ISL3 family transposase ISLasa4cCOG3464 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Liquorilactobacillus uvarum
gene_3670&FD47_GL00273829,250-30,089840ISSth1, transposase (Orf2), IS3 familyCOG2801 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3671&LPENT_0006330,125-30,847723Transposase (transposase, IS3 family protein)COG2963 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. pentosus
gene_3689&gene_368946,896-47,294399TransposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% L. plantarum
gene_3690&gene_369047,357-47,695339MULTISPECIES: IS5 family transposaseCOG3293 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Bacilli
gene_3699&gene_369955,438-56,367+930IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)99.4% L. pentosus
gene_3705&HR47_0115061,570-62,457888IS30 family transposaseCOG2826 (Transposase and inactivated derivatives, IS30 family)L (Replication, recombination and repair)100% Lactobacillaceae
gene_3706&FD47_GL00048662,934-64,148+1,215IS21 family transposaseCOG4584 (Transposase and inactivated derivatives)L (Replication, recombination and repair)100% Lactiplantibacillus
gene_3710&gene_371065,413-65,592180Transposase95.2% L. plantarum

Characterization of transposases predicted in the Lactiplantibacillus pentosus CF2-10N genome.

*

: the best hit was indicated.

£

: sequences of pLPE10-1 plasmid.

§

: sequences of pLPE10-4 plasmid.

&

: sequences of pLPE10-2 plasmid.

Table 2

Sequences producing significant alignmentsIS FamilyGroupOriginScore (bits)E value
ISP1ISL3Lactobacillus plantarum2,5470.0
ISLdl3IS30Lactobacillus delbrueckii17050.0
ISLhe30IS30Lactobacillus helveticus1,6350.0
ISLpl3IS5IS427Lactobacillus plantarum1,4290.0
ISLsa1IS30Lactobacillus sakei4946e-136
ISLpl2IS3IS150Lactobacillus plantarum56.04e-04
ISLhe65IS200/IS605IS1341Lactobacillus helveticus54.00.002
ISP2IS1182Lactobacillus plantarum52.00.007
ISMmu1IS200/IS605IS605Mitsuokella multacida52.00.007
ISLjo5IS200/IS605IS605Lactobacillus johnsonii52.00.007
ISSpn5IS1380Streptococcus pneumoniae50.10.026
IS1161IS30Streptococcus salivarius48.10.10
IS1139IS30Streptococcus salivarius48.10.10
IS1086IS30Ralstonia eutropha48.10.10
ISRhru6IS5IS1031Rhodospirillum rubrum46.10.41
ISAar45IS3IS3Arthrobacter arilaitensis46.10.41
ISMsm7IS3IS3Mycobacterium smegmatis46.10.41
IS6770IS30Enterococcus faecalis46.10.41
IS1648IS5IS427Streptomyces coelicolor46.10.41
ISAcba1IS1595ISSod11Actinobacteria bacterium44.11.6
ISBsp5IS1182Bacillus sp.44.11.6
ISBam1IS3IS150Burkholderia ambifaria44.11.6
ISLrh4ISLre2Lactobacillus rhamnosus44.11.6
ISSav4IS701Streptomyces avermitilis44.11.6
IS231JIS4IS231Bacillus thuringiensis44.11.6
ISCfr26IS110IS1111Citrobacter freundii42.16.4
ISAbe16IS3IS150Acinetobacter bereziniae42.16.4
ISVat2IS256IS1249Veillonella atypica42.16.4
ISDha15IS1634Desulfitobacterium dichloroeliminans42.16.4
ISPan1IS5IS903Pantoea ananatis42.16.4
ISPph2IS630Pelodictyon phaeoclathratiforme42.16.4
ISShes12IS1634Shewanella sp.42.16.4
ISSoc13IS5IS427Synechococcus sp.42.16.4
ISEnfa364IS30Enterococcus faecalis42.16.4
ISNwi3IS1595ISNwi1Nitrobacter winogradskyi42.16.4
ISMma18IS1634Methanosarcina mazei42.16.4
ISCfe1IS607Campylobacter fetus42.16.4
ISLpl1IS30Lactobacillus plantarum42.16.4
IS987IS3IS51Mycobacterium bovis42.16.4
IS986IS3IS51Mycobacterium tuberculosis42.16.4
IS6110IS3IS51Mycobacterium tuberculosis42.16.4
IS231BIS4IS231Bacillus thuringiensis42.16.4
IS231AIS4IS231Bacillus thuringiensis42.16.4
IS231KIS4IS231Bacillus cereus42.16.4
IS1476ISL3Enterococcus faecium42.16.4

Characterization of IS elements found within the genome of Lactiplantibacillus pentosus CF2-10 N using the ISfinder search tool.

On the other hand, screening for prophage DNA within the L. pentosus CF2-10 N genome, using bioinformatic tools such as PHASTER, determined the presence of eight temperate phage regions (Table 3). Two regions were intact (Regions 2 and 3, score > 90), the other three were questionable (Regions 5, 6 and 7, score 70 ± 90), and the last three regions were incomplete (Regions 1, 4 and 8, score < 70). The complete prophage regions of the L. pentosus CF2-10 N chromosome were identified as Lactobacillus phage Sha1 (Regions 2 and 3; GC content, 41.55–41.88%; region length, 39.9–47.7 kb). Regarding the questionable prophage regions, they corresponded to Staphylococcus phage SP beta-like (Regions 5 and 6; GC content, 34.83–40.70%; region length, 13.7–19.4 kb) and Escherichia phage 500,465–1 (Region 7; GC content, 41.54%; region length, 18.8 kb). With respect to the incomplete prophage region, we identified three regions corresponding to Lactobacillus phage PLE3 (Region 1; GC content, 41.26%; region length, 15 kb), Enterobacteria phage fiAA91-ss (Region 4; GC content, 38.27%; region length, 23.4 kb) and Escherichia phage 500,465–1 (Region 8; GC content, 31.68%; region length, 6.7 kb; Table 3).

Table 3

RegionRegion lengthCompleteness*ScoreRegion positionLocalizationMost common phageGC%Total proteins
115 kbIncomplete302,227,200–2,242,287ChromosomePHAGE_Lactob_PLE3_NC_031125(1)41.2611
239.9 kbIntact1502,260,786–2,300,777ChromosomePHAGE_Lactob_Sha1_NC_019489(26)41.5554
347.7 kbIntact1502,808,177–2,855,881ChromosomePHAGE_Lactob_Sha1_NC_019489(22)41.8868
423.4 kbIncomplete6039,960–63,408pLPE10-1PHAGE_Entero_fiAA91_ss_NC_022750(2)38.2722
513.7 kbQuestionable80309–14,094pLPE10-4PHAGE_Staphy_SPbeta_like_NC_029119(2)34.8326
619.4 kbQuestionable9034,863–54,348pLPE10-4PHAGE_Staphy_SPbeta_like_NC_029119(2)40.7038
718.8 kbQuestionable8017,673–36,515pLPE10-2PHAGE_Escher_500,465_1_NC_049342(3)41.5422
86.7 kbIncomplete4060,245–66,978pLPE10-2PHAGE_Escher_500,465_1_NC_049342(3)31.6810

Description of prophage regions detected in the Lactiplantibacillus pentosus CF2-10N genome by using the PHASTER bioinformatic tool.

*

: Intact (score > 90), Questionable (score 70 ± 90), Incomplete (score < 70).

pLPE10: plasmid of L. pentosus CF2-10.

Among the defense mechanisms revealed by in silico analysis of the L. pentosus CF2-10 N genome sequence, CRISPR I and II systems (both signature genes for the Type I “cas3” and Type II “cas9” systems) were detected as defense response to mobile genetic elements (i.e., viruses, transposable elements and conjugative plasmids; Table 4). In this sense, 13 genes were identified as CRISPR associated protein responsible genes (cas genes) organized in two operons (Supplementary Figure S3), and six of them were new genes found in the L. pentosus CF2-10 N genome (Table 4). Regarding CRISPR arrays (CR), five CRISPR unquestionable arrays were identified by using the CRISPRDetect program and they are distributed throughout the genome sequence between 1,791,840 and 3,235,959 bp (Table 5).

Table 4

Gene IDGenePositionStrandGene length (bp)Protein descriptionOntology IDOntology term
gene_1618cas91,785,693–1,789,037+3,345Type II CRISPR RNA-guided endonuclease Cas9GO:0003677, GO:0003723, GO:0004519, GO:0046872, GO:0043571, GO:0051607, GO:0090305DNA binding, RNA binding, endonuclease activity, metal ion binding, maintenance of CRISPR repeat elements, defense response to virus, nucleic acid phosphodiester bond hydrolysis
gene_1619cas91,789,043–1,789,759+717Type II CRISPR RNA-guided endonuclease Cas9GO:0003677, GO:0003723, GO:0004519, GO:0046872, GO:0043571, GO:0051607, GO:0090305DNA binding, RNA binding, endonuclease activity, metal ion binding, maintenance of CRISPR repeat elements, defense response to virus, nucleic acid phosphodiester bond hydrolysis
gene_1620cas11,789,953–1,790,858+906Subtype II CRISPR-associated endonuclease Cas1GO:0003677, GO:0004519, GO:0046872, GO:0043571, GO:0051607, GO:0090305DNA binding, endonuclease activity, metal ion binding, maintenance of CRISPR repeat elements, defense response to virus, nucleic acid phosphodiester bond hydrolysis
gene_1621cas21,790,836–1,791,141+306MULTISPECIES: CRISPR-associated endonuclease Cas2GO:0004521, GO:0046872, GO:0043571, GO:0051607, GO:0090502Endoribonuclease activity, metal ion binding, maintenance of CRISPR repeat elements, defense response to virus, RNA phosphodiester bond hydrolysis, endonucleolytic
gene_1622gene_1622*1,791,138-1,791,815+678Type II-A CRISPR-associated protein Csn2
gene_2923cas13,233,320–3,234,273+954Subtype I-E CRISPR-associated endonuclease Cas1GO:0003677, GO:0004519, GO:0046872, GO:0043571, GO:0051607, GO:0090305DNA binding, endonuclease activity, metal ion binding, maintenance of CRISPR repeat elements, defense response to virus, nucleic acid phosphodiester bond hydrolysis
gene_2924FD24_GL0021573,234,270–3,235,169+900Type I-E CRISPR-associated endoribonuclease Cas2GO:0003676Nucleic acid binding
gene_2925gene_2925*3,236,488-3,239,202+2,715CRISPR-associated helicase/endonuclease Cas3
gene_2926gene_2926*3,239,207-3,240,958+1752CRISPR-associated protein
gene_2927gene_2927*3,240,948-3,241,559+612Type I-E CRISPR-associated protein Cse2/CasB
gene_2928gene_2928*3,241,559-3,242,638+1,080Type I-E CRISPR-associated protein Cas7/Cse4/CasC
gene_2929FD24_GL0021633,242,619–3,243,344+726Type I-E CRISPR-associated protein Cas5/CasDGO:0003723, GO:0043571, GO:0051607RNA binding, maintenance of CRISPR repeat elements, defense response to virus
gene_2930gene_2930*3,243,344-3,244,012+669Type I-E CRISPR-associated protein Cas6/Cse3/CasE

Characterization CRISPR associated proteins predicted in the Lactiplantibacillus pentosus CF2-10N genome.

*

: New genes found in this study.

Table 5

CRISPR array (CR)Start positionEnd positionArray orientationCRISPR lenght (bp)Number of repeatsDR consensus*Array family
CR 11,791,8401,792,537Forward69836GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAACNA
CR 22,982,0592,981,480Reverse58028CTGTTCCCCGTGTATGCGGGGGTGATCCI-E
CR 33,232,1733,231,961Reverse21328CTATTCCCCGTGCATACGGGGGTGATCCNA
CR 43,232,7643,232,310Reverse45528CTGTTCCCCGCGTATGCGGGGGTGATCCI-E
CR 53,235,9593,235,382Reverse57828CTGTTCCCCGTGTATGCGGGGGTGATCCI-E

Characterization of CRISPR arrays predicted in the Lactiplantibacillus pentosus CF2-10N genome.

*

The same DR consensus sequences are indicated.

Identification of genes associated with probiotic characteristics in Lactiplantibacilluis pentosus CF2-10 N

In silico genome analysis of probiotic characteristics of L. pentosus CF2-10 N revealed the presence of genes coding for adhesion, exopolysaccharide biosynthesis, tolerance to low pH and bile salts, vitamin and enzyme production and immunomodulation among others (Table 6). With respect to adhesion, several genes were identified such as 3 mucus-binding proteins, 1 fibronectin/fibrinogen-binding protein, 1 Chitin-binding protein (located on pLPE10-1 plasmid), 1 ABC superfamily ATP binding cassette transporter, binding protein, 2 cell surface proteins, 1 manganese ABC transporter substrate-binding protein, 1 elongation factor Tu, 1 Molecular chaperone DnaK, 1 molecular chaperone GroEL, 1 co-chaperone GroES, 1 class A sortase and 1 type I glyceraldehyde-3-phosphate dehydrogenase (Table 6). Regarding exopolysaccharides, four genes coding for exopolysaccharide biosynthesis protein were identified (Table 6). For adaptation to different lifestyles, L. pentosus CF2-10 N harbored in its genome several genes involved in stress response such as acids and bile. These included three GNAT family acetyltransferases, two Na+/H+ antiporter NhaC, 1 phosphoglycerate mutase, nine elongation factors (factor G, factor GreA, factor 4, factor P, factor Ts and factor Tu) and 1 phosphoglycerate kinase (Table 6).

Table 6

Probiotic propertyGene IDGenePositionStrandGene lengthProtein descriptionOntology term (Ontology ID)COG class (COG class description)
Adhesiongene_411FD24_GL003356445,136–448,2943,159Mucus-binding proteinIntegral component of membrane (GO:0016021)COG3846 (Type IV secretory pathway, TrbL components)
gene_963LPE_007101,054,378–1,060,9296,552Mucus-binding proteinIntegral component of membrane (GO:0016021)COG0810 (Periplasmic protein TonB, links inner and outer membranes)
gene_3039gene_30393,352,844–3,359,7286,885Mucus-binding proteinCOG5099 (RNA-binding protein of the Puf family, translational repressor)
gene_3173gene_31733,497,668–3,499,3741707Fibronectin/fibrinogen-binding proteinCOG1293 (Predicted RNA-binding protein homologous to eukaryotic snRNP)
gene_3512£gene_351278,678-78,812+135Chitin-binding proteinCOG3397 (Uncharacterized protein conserved in bacteria)
gene_891LPE_02200975,971–976,864894ABC superfamily ATP binding cassette transporter, binding proteinMetal ion binding, cell adhesion, metal ion transport (GO:0046872, GO:0007155, GO:0030001)COG0803 (ABC-type metal ion transport system, periplasmic component/surface adhesin)
gene_517LPE_00567561,619–563,421+1803Cell surface proteinExtracellular region, cell wall, integral component of membrane, collagen binding, cell adhesion (GO:0005576, GO:0005618, GO:0016021, GO:0005518, GO:0007155)COG0810 (Periplasmic protein TonB, links inner and outer membranes)
gene_840FD24_GL000462920,457–922,3401884Cell surface proteinExtracellular region, cell wall, collagen binding, cell adhesion (GO:0005576, GO:0005618, GO:0005518, GO:0007155)COG4932 (Predicted outer membrane protein)
gene_2496FD24_GL0001062,735,640–2,736,581+942Manganese ABC transporter substrate-binding proteinMetal ion binding, cell adhesion, metal ion transport (GO:0005576, GO:0005618, GO:0005518, GO:0007155)COG0803 (ABC-type metal ion transport system, periplasmic component/surface adhesin)
gene_158tuf162,869–164,0561,188Elongation factor TuCytoplasm, translation elongation factor activity, GTPase activity, GTP binding, translational elongation (GO:0005737, GO:0003746, GO:0003924, GO:0005525, GO:0006414)COG0050 (GTPases, translation elongation factors)
gene_74dnaK74,096–75,9641869Molecular chaperone DnaKATP binding,unfolded protein binding,protein folding (GO:0005524, GO:0051082, GO:0006457)COG0443 (Molecular chaperone)
gene_2181groL2,382,568–2,384,193+1,626MULTISPECIES: molecular chaperone GroELCytoplasm, ATP binding, unfolded protein binding, protein refolding (GO:0005737, GO:0005524, GO:0051082, GO:0042026)COG0459 [Chaperonin GroEL (HSP60 family)]
gene_2180groS2,382,228–2,382,512+285MULTISPECIES: co-chaperone GroEScytoplasm, ATP binding, protein folding (GO:0005737, GO:0005524, GO:0006457)COG0234 [Co-chaperonin GroES (HSP10)]
gene_1964N692_132952,164,842–2,165,546+705MULTISPECIES: class A sortaseIntegral component of membrane (GO:0016021)COG3764 [Sortase (surface protein transpeptidase)]
gene_2239LPENT_010882,455,749–2,456,771+1,023MULTISPECIES: type I glyceraldehyde-3-phosphate dehydrogenaseGlyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity, NADP binding, NAD binding, glucose metabolic process, oxidation–reduction process (GO:0004365, GO:0050661, GO:0051287, GO:0006006, GO:0055114)COG0057 (Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase)
Exopolysaccharidesgene_146LPE_00040151,375–152,091717Exopolysaccharide biosynthesis proteinExtracellular polysaccharide biosynthetic process (GO:0045226)COG0489 (ATPases involved in chromosome partitioning)
gene_2641LPE_026412,877,168–2,877,944+777Exopolysaccharide biosynthesis proteinTransferase activity, transferring glycosyl groups (GO:0016757)-
gene_2651LPE_008052,887,199–2,887,927+729Exopolysaccharide biosynthesis proteinExtracellular polysaccharide biosynthetic process (GO:0045226)COG0489 (ATPases involved in chromosome partitioning)
gene_2,676LPE_008382,913,577–2,914,353+777Exopolysaccharide biosynthesis proteinTransferase activity, transferring glycosyl groups (GO:0016757)-
Tolerance to low pH and bile saltsgene_74dnaK74,096–75,9641869Molecular chaperone DnaKATP binding,unfolded protein binding,protein folding (GO:0005524, GO:0051082, GO:0006457)COG0443 (Molecular chaperone)
gene_607pyrD664,092–665,009918Dihydroorotate dehydrogenase B catalytic subunitCytoplasm, dihydroorotate dehydrogenase activity, ‘de novo’ pyrimidine nucleobase biosynthetic process, ‘de novo’ UMP biosynthetic process, oxidation–reduction process (GO:0005737, GO:0004152, GO:0006207, GO:0044205, GO:0055114)COG0167 (Dihydroorotate dehydrogenase)
gene_668LPE_01537724,936–726,117+1,182GNAT family acetyltransferaseN-acetyltransferase activity (GO:0008080)COG4552 (Predicted acetyltransferase involved in intracellular survival and related acetyltransferases)
gene_1189LPE_011931,299,104–1,299,562+459GNAT family acetyltransferaseN-acetyltransferase activity (GO:0008080)COG2153 (Predicted acyltransferase)
gene_1799LPE_009111,991,014–1,991,502489GNAT family acetyltransferaseN-acetyltransferase activity (GO:0008080)COG2153 (Predicted acyltransferase)
gene_1172FD24_GL0012671,284,763–1,286,1871,425Na+/H+ antiporter NhaCIntegral component of membrane, antiporter activity, transmembrane transport (GO:0016021, GO:0015297, GO:0055085)COG1757 (Na+/H+ antiporter)
gene_1684LPE_021281,859,459–1,860,8591,401Na+/H+ antiporter NhaCIntegral component of membrane, antiporter activity, transmembrane transport (GO:0016021, GO:0015297, GO:0055085)COG1757 (Na+/H+ antiporter)
gene_2117gpmA2,321,232–2,321,909+678Phosphoglycerate mutase2,3-bisphosphoglycerate-dependent phosphoglycerate mutase activity, gluconeogenesis, glycolytic process (GO:0046538, GO:0006094, GO:0006096)COG0588 (Phosphoglycerate mutase 1)
gene_2181groL2,382,568–2,384,193+1,626MULTISPECIES: molecular chaperone GroELCytoplasm, ATP binding, unfolded protein binding, protein refolding (GO:0005737, GO:0005524, GO:0051082, GO:0042026)COG0459 (Chaperonin GroEL (HSP60 family)
gene_2225luxS2,438,807–2,439,283+477MULTISPECIES: S-ribosylhomocysteine lyaseIron ion binding, S-ribosylhomocysteine lyase activity, quorum sensing (GO:0005506, GO:0043768, GO:0009372)COG1854 (LuxS protein involved in autoinducer AI2 synthesis)
gene_2436fusA2,685,279–2,687,375+2097MULTISPECIES: elongation factor GCytoplasm, translation elongation factor activity, GTPase activity, GTP binding, translational elongation (GO:0005737, GO:0003746, GO:0003924, GO:0005525, GO:0006414)COG0480 [(Translation elongation factors (GTPases)]
gene_2966greA23,282,534–3,283,016+483MULTISPECIES: transcription elongation factor GreADNA binding, translation elongation factor activity, RNA polymerase binding, transcription, DNA-templated, translational elongation, regulation of DNA-templated transcription, elongation (GO:0003677, GO:0003746, GO:0070063, GO:0006351, GO:0006414, GO:0032784)COG0782 (Transcription elongation factor)
gene_1712greA1,893,369–1,893,839471Transcription elongation factor GreADNA binding, translation elongation factor activity, RNA polymerase binding, transcription, DNA-templated, translational elongation, regulation of DNA-templated transcription, elongation (GO:0003677, GO:0003746, GO:0070063, GO:0006351, GO:0006414, GO:0032784)COG0782 (Transcription elongation factor)
gene_2240pgk2,456,889–2,458,091+1,203MULTISPECIES: phosphoglycerate kinaseCytoplasm, phosphoglycerate kinase activity, ATP binding, glycolytic process (GO:0005737, GO:0004618, GO:0005524, GO:0006096)COG0126 (3-phosphoglycerate kinase)
gene_66lepA64,623–66,4581836Elongation factor 4Plasma membrane, translation elongation factor activity, GTPase activity, GTP binding, ribosome binding, translational elongation, positive regulation of translation (GO:0005886, GO:0003746, GO:0003924, GO:0005525, GO:0043022, GO:0006414, GO:0045727)COG0481 (Membrane GTPase LepA)
gene_1072lepA1,171,570–1,173,357+1788Elongation factor 4Plasma membrane, translation elongation factor activity, GTPase activity, GTP binding, ribosome binding, translational elongation, positive regulation of translation (GO:0005886, GO:0003746, GO:0003924, GO:0005525, GO:0043022, GO:0006414, GO:0045727)COG0481 (Membrane GTPase LepA)
gene_1569FD24_GL0029721,732,533–1,734,524+1992Elongation factor GTranslation elongation factor activity, GTPase activity, GTP binding, translational elongation (GO:0003746, GO:0003924, GO:0005525, GO:0006414)COG0480 [Translation elongation factors (GTPases)]
gene_2996efp3,308,149–3,308,706+558MULTISPECIES: elongation factor PCytoplasm, translation elongation factor activity, translational elongation (GO:0005737, GO:0003746, GO:0006414)COG0231 [(Translation elongation factor P (EF-P)/translation initiation factor 5A (eIF-5A)]
gene_101tsf107,593–108,471879MULTISPECIES: elongation factor TsCytoplasm, translation elongation factor activity, translational elongation (GO:0005737, GO:0003746, GO:0006414)COG0264 (Translation elongation factor Ts)
gene_158tuf162,869–164,0561,188Elongation factor TuCytoplasm, translation elongation factor activity, GTPase activity, GTP binding, translational elongation (GO:0005737, GO:0003746, GO:0003924, GO:0005525, GO:0006414)COG0050 (GTPases, translation elongation factors)
Enzymesgene_11gene_117,804–9,6871884Tannase
gene_3293gene_32933,633,861–3,635,7441884Tannase
gene_1672FD24_GL0030741,841,220–1,842,542+1,323Alpha-amylaseAlpha-amylase activity, carbohydrate metabolic process (GO:0004556, GO:0005975)COG0366 (Glycosidases)
gene_1516LPE_010411,679,552–1,681,369+1818AmylopullulanaseAlpha-amylase activity,carbohydrate metabolic process (GO:0004556, GO:0005975)COG0366 (Glycosidases)
gene_1271FD24_GL0010811,379,908–1,381,9592052Beta-galactosidaseBeta-galactosidase complex, beta-galactosidase activity, metal ion binding, galactose metabolic process (GO:0009341, GO:0004565, GO:0046872, GO:0006012)COG1874 (Beta-galactosidase)
gene_1284FD24_GL0010681,394,185–1,396,065+1881Beta-galactosidaseHydrolase activity, hydrolyzing O-glycosyl compounds, carbohydrate metabolic process (GO:0004553, GO:0005975)COG3250 (Beta-galactosidase/beta-glucuronidase)
gene_1285FD24_GL0010671,396,049–1,397,008+960Beta-galactosidaseBeta-galactosidase complex, beta-galactosidase activity, carbohydrate binding, carbohydrate metabolic process (GO:0009341, GO:0004565, GO:0030246, GO:0005975)COG3250 (Beta-galactosidase/beta-glucuronidase)
gene_1422FD24_GL0011611,558,889–1,561,4322,544Hypothetical proteinbeta-galactosidase complex, beta-galactosidase activity, carbohydrate metabolic process (GO:0009341, GO:0004565, GO:0005975)COG1874 (Beta-galactosidase)
gene_1988FD24_GL0019632,194,635–2,195,540906MULTISPECIES: prolyl aminopeptidaseAminopeptidase activity, proteolysis (GO:0004177, GO:0006508)COG0596 [Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily)]
gene_1749map1,926,072–1,926,863792MULTISPECIES: type I methionyl aminopeptidaseMetal ion binding, metalloaminopeptidase activity, proteolysis, protein initiator methionine removal (GO:0046872, GO:0070006, GO:0006508, GO:0070084)COG0024 (Methionine aminopeptidase)
gene_2295FD24_GL0027552,525,861–2,526,769909Prolyl aminopeptidaseAminopeptidase activity, proteolysis (GO:0004177, GO:0006508)COG0596 [(Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily)]
gene_1485LPE_012651,634,935–1,636,2511,317AminopeptidaseAminopeptidase activity, cysteine-type endopeptidase activity, proteolysis (GO:0004177, GO:0004197, GO:0006508)COG3579 (Aminopeptidase C)
gene_2120LPENT_012052,325,277–2,326,6081,332AminopeptidaseAminopeptidase activity, cysteine-type endopeptidase activity, proteolysis (GO:0004177, GO:0004197, GO:0006508)COG3579 (Aminopeptidase C)
gene_2366FD24_GL0002472,600,983–2,603,517+2,535Peptidaseaminopeptidase activity, metallopeptidase activity, zinc ion binding, proteolysis (GO:0004177, GO:0008237, GO:0008270, GO:0006508)COG0308 (Aminopeptidase N)
gene_281pepQ299,603–300,712+1,110Peptidase M24 family proteinHydrolase activity (GO:0016787)COG0006 (Xaa-Pro aminopeptidase)
gene_2995LPE_004423,307,014–3,308,078+1,065Peptidase M24 family proteinAminopeptidase activity, metal ion binding, proteolysis (GO:0004177, GO:0046872, GO:0006508)COG0006 (Xaa-Pro aminopeptidase)
gene_3265pepT3,600,534–3,601,7721,239Peptidase TCytoplasm, metallopeptidase activity, zinc ion binding, tripeptide aminopeptidase activity, proteolysis, peptide catabolic process (GO:0005737, GO:0008237, GO:0008270, GO:0045148, GO:0006508, GO:0043171)COG2195 (Di- and tripeptidases)
gene_3297LPE_001633,638,228–3,639,118891Alpha/beta hydrolaseserine-type peptidase activity, proteolysis (GO:0008236, GO:0006508)COG1506 (Dipeptidyl aminopeptidases/acylaminoacyl-peptidases)
gene_15LPE_0016312,171–13,061891Alpha/beta hydrolaseserine-type peptidase activity,proteolysisCOG1506 (Dipeptidyl aminopeptidases/acylaminoacyl-peptidases)
gene_1479FD24_GL0009071,630,300–1,630,836+537Phenolic acid decarboxylasecarboxy-lyase activity (GO:0016831)COG3479 (Phenolic acid decarboxylase)
ene_2246LPE_031972,463,498–2,464,244+747CarboxylesteraseCarboxylic ester hydrolase activity (GO:0052689)COG1647 (Esterase/lipase)
gene_77FD24_GL00146378,101–78,811711Alpha-acetolactate decarboxylaseAcetolactate decarboxylase activity, acetoin biosynthetic process (GO:0047605, GO:0045151)COG3527 (Alpha-acetolactate decarboxylase)
gene_808FD24_GL001032883,614–884,444831Lipase esteraseHydrolase activity,metabolic process (GO:0016787,GO:0008152)COG0657 (Esterase/lipase)
gene_1852LPE_008682,040,108–2,041,613+1,506MULTISPECIES: multicopper oxidaseCopper ion binding, oxidoreductase activity, cell division, oxidation–reduction process (GO:0005507, GO:0016491, GO:0051301, GO:0055114)COG2132 (Putative multicopper oxidases)
VitaminsFollategene_335FD24_GL000368362,374–363,6991,326Bifunctional folylpolyglutamate synthase/dihydrofolate synthaseTetrahydrofolylpolyglutamate synthase activity, ATP binding, tetrahydrofolylpolyglutamate biosynthetic process (GO:0004326, GO:0005524, GO:0046901)COG0285 (Folylpolyglutamate synthase)
gene_1,140LPE_014271,241,881–1,243,0291,149Dihydropteroate synthaseDihydropteroate synthase activity, folic acid-containing compound biosynthetic process (GO:0004156, GO:0009396)COG0294 (Dihydropteroate synthase and related enzymes)
gene_1145LPENT_020911,246,075–1,246,443369Dihydroneopterin aldolaseDihydroneopterin aldolase activity, tetrahydrofolate biosynthetic process, folic acid biosynthetic process (GO:0004150, GO:0046654, GO:0046656)COG1539 (Dihydroneopterin aldolase)
gene_3158fhs3,480,634–3,482,289+1,656Formate--tetrahydrofolate ligaseFormate-tetrahydrofolate ligase activity, ATP binding, folic acid-containing compound biosynthetic process, tetrahydrofolate interconversion (GO:0004329, GO:0005524, GO:0009396, GO:0035999)COG2759 (Formyltetrahydrofolate synthetase)
gene_1143folE1,245,011–1,245,580570MULTISPECIES: GTP cyclohydrolase I FolECytoplasm, GTP cyclohydrolase I activity, GTP binding, zinc ion binding, one-carbon metabolic process,7,8-dihydroneopterin 3′-triphosphate biosynthetic process, tetrahydrofolate biosynthetic process (GO:0005737, GO:0003934, GO:0005525, GO:0008270, GO:0006730, GO:0035998, GO:0046654)COG0302 (GTP cyclohydrolase I)
gene_1144LPE_014311,245,573–1,246,0855132-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase activity, kinase activity, folic acid-containing compound biosynthetic process, phosphorylation (GO:0003848, GO:0016301, GO:0009396, GO:0016310)COG0801 (7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase)
gene_2999folD3,309,775–3,310,635+861Bifunctional protein folDMethenyltetrahydrofolate cyclohydrolase activity, methylenetetrahydrofolate dehydrogenase (NADP+) activity, histidine biosynthetic process, purine nucleotide biosynthetic process, methionine biosynthetic process, folic acid-containing compound biosynthetic process, tetrahydrofolate interconversion, oxidation–reduction process (GO:0004477, GO:0004488, GO:0000105, GO:0006164, GO:0009086, GO:0009396, GO:0035999, GO:0055114)COG0190 (5,10-methylene-tetrahydrofolate dehydrogenase/Methenyl tetrahydrofolate cyclohydrolase)
Riboflavingene_2293LPE_032242,522,788–2,523,636+849Bifunctional protein: riboflavin kinasFMN adenylyltransferase activity, kinase activity, riboflavin biosynthetic process, phosphorylation (GO:0003919, GO:0016301, GO:0009231, GO:0016310)COG0196 (FAD synthase)
gene_78FD24_GL00146478,815–79,813999Bifunctional riboflavin kinase/FMN adenylyltransferaseFMN adenylyltransferase activity, ATP binding, riboflavin kinase activity, FAD biosynthetic process, riboflavin biosynthetic process, FMN biosynthetic process, phosphorylation (GO:0003919, GO:0005524, GO:0008531, GO:0006747, GO:0009231, GO:0009398, GO:0016310)COG0196 (FAD synthase)
gene_2838FD24_GL0020703,139,751–3,140,962+1,212bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase IIGTP cyclohydrolase II activity, GTP binding, 3,4-dihydroxy-2-butanone-4-phosphate synthase activity, metal ion binding, riboflavin biosynthetic process (GO:0003935, GO:0005525, GO:0008686, GO:0046872, GO:0009231)COG0807 (GTP cyclohydrolase II)
gene_2839ribH3,140,962–3,141,429+4686,7-dimethyl-8-ribityllumazine synthaseriboflavin synthase complex,6,7-dimethyl-8-ribityllumazine synthase activity, transferase activity, riboflavin biosynthetic process (GO:0009349, GO:0000906, GO:0016740, GO:0009231)COG0054 (Riboflavin synthase beta-chain)
gene_2836LPE_030753,138,079–3,139,146+1,068Riboflavin biosynthesis protein RibDZinc ion binding,5-amino-6-(5-phosphoribosylamino) uracil reductase activity, diaminohydroxyphosphoribosylaminopyrimidine deaminase activity, riboflavin biosynthetic process, oxidation–reduction process (GO:0008270, GO:0008703, GO:0008835, GO:0009231, GO:0055114)COG1985 (Pyrimidine reductase, riboflavin biosynthesis)
gene_3254gene_32543,584,670–3,585,050381Riboflavin biosynthesis protein RibT
gene_2837LPE_030763,139,147–3,139,749+603Riboflavin synthaseOxidoreductase activity,oxidation–reduction process (GO:0016491, GO:0055114)COG0307 (Riboflavin synthase alpha chain)
gene_728LPENT_02492795,860–796,399+540Dihydrofolate reductaseintegral component of membrane,5-amino-6-(5-phosphoribosylamino) uracil reductase activity, riboflavin biosynthetic process, oxidation–reduction process (GO:0016021, GO:0008703, GO:0009231, GO:0055114)COG0262 (Dihydrofolate reductase)
Thiaminegene_1606thiE1,772,372–1,773,028+657Thiamine phosphate synthaseMagnesium ion binding, thiamine-phosphate diphosphorylase activity, thiamine biosynthetic process, thiamine diphosphate biosynthetic process (GO:0000287, GO:0004789, GO:0009228, GO:0009229)COG0352 (Thiamine monophosphate synthase)
gene_532LPE_00578575,356–577,10417491-deoxy-D-xylulose-5-phosphate synthase1-deoxy-D-xylulose-5-phosphate synthase activity, metal ion binding, thiamine biosynthetic process, terpenoid biosynthetic process, 1-deoxy-D-xylulose 5-phosphate biosynthetic process (GO:0008661, GO:0046872, GO:0009228, GO:0016114, GO:0052865)COG1154 (Deoxyxylulose-5-phosphate synthase)
gene_1604thiM1,770,746–1,771,540+795Hydroxyethylthiazole kinaseMagnesium ion binding, hydroxyethylthiazole kinase activity, ATP binding, thiamine biosynthetic process, thiamine diphosphate biosynthetic process, phosphorylation (GO:0000287, GO:0004417, GO:0005524, GO:0009228, GO:0009229, GO:0016310)COG2145 (Hydroxyethylthiazole kinase, sugar kinase family)
gene_2902FD24_GL0021333,205,215–3,206,2491,035Molybdopterin biosynthesis protein MoeBSmall protein activating enzyme activity (GO:0008641)COG0476 (Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2)
gene_1605FD24_GL0030091,771,558–1,772,382+825MULTISPECIES: hydroxymethylpyrimidine/phosphomethylpyrimidine kinaseATP binding, phosphomethylpyrimidine kinase activity, thiamine biosynthetic process, phosphorylation (GO:0005524, GO:0008972, GO:0009228, GO:0016310)COG0351 (Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase)
gene_3021LPE_004143,332,290–3,332,946+657Thiamine pyrophosphokinasethiamine diphosphokinase activity, ATP binding, thiamine binding, thiamine metabolic process, thiamine diphosphate biosynthetic process (GO:0004788, GO:0005524, GO:0030975, GO:0006772, GO:0009229)COG1564 (Thiamine pyrophosphokinase)
gene_339thiI369,546–370,7631,218tRNA sulfurtransferasecytoplasm, tRNA binding, tRNA adenylyltransferase activity,ATP binding, sulfurtransferase activity, thiamine biosynthetic process, thiamine diphosphate biosynthetic process, tRNA thio-modification (GO:0005737, GO:0000049, GO:0004810, GO:0005524, GO:0016783, GO:0009228, GO:0009229, GO:0034227)COG0301 (Thiamine biosynthesis ATP pyrophosphatase)
gene_821FD24_GL000441897,704–898,705+1,002FAD:protein FMN transferaseTransferase activity, metal ion binding, protein flavinylation (GO:0016740, GO:0046872, GO:0017013)COG1477 (Membrane-associated lipoprotein involved in thiamine biosynthesis)
gene_1301LPE_025371,421,909–1,422,865957FAD:protein FMN transferaseTransferase activity, metal ion binding, protein flavinylation (GO:0016740, GO:0046872, GO:0017013)COG1477 (Membrane-associated lipoprotein involved in thiamine biosynthesis)
gene_2469FD24_GL0001402,709,017–2,710,129+1,113FAD:protein FMN transferaseTransferase activity, metal ion binding, protein flavinylation (GO:0016740, GO:0046872, GO:0017013)COG1477 (Membrane-associated lipoprotein involved in thiamine biosynthesis)
Vitamin K2gene_1240menG1,346,872–1,347,585+714Bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylaseMethyltransferase activity, menaquinone biosynthetic process, methylation (GO:0008168, GO:0009234, GO:0032259)COG2226 (Methylase involved in ubiquinone/menaquinone biosynthesis)
Vitamin B5gene_452hdhD1486,520–487,4949752-dehydropantoate 2-reductaseCytoplasm, 2-dehydropantoate 2-reductase activity, NADP binding, pantothenate biosynthetic process, oxidation–reduction process (GO:0005737, GO:0008677, GO:0050661, GO:0015940, GO:0055114)COG1893 (Ketopantoate reductase)
gene_693gene_693750,504–751,523+1,0202-dehydropantoate 2-reductaseCOG1893 (Ketopantoate reductase)
gene_1840LPE_008792,026,749–2,027,732+9842-dehydropantoate 2-reductaseCytoplasm, 2-dehydropantoate 2-reductase activity, NADP binding, pantothenate biosynthetic process, oxidation–reduction process (GO:0005737, GO:0008677, GO:0050661, GO:0015940, GO:0055114)COG1893 (Ketopantoate reductase)
Vitamin B6gene_1521FD24_GL0008631,687,267–1,687,710444MULTISPECIES: pyridoxamine 5′-phosphate oxidasePyridoxamine-phosphate oxidase activity, FMN binding, pyridoxal phosphate biosynthetic process, oxidation–reduction process (GO:0004733, GO:0010181, GO:0042823, GO:0055114)-
gene_653FD24_GL002535711,251–712,4351,185Pyridoxal phosphate-dependent aminotransferaseTransaminase activity, pyridoxal phosphate binding, biosynthetic process (GO:0008483, GO:0030170, GO:0009058)COG1168 (Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities)
gene_780LPE_03241846,681–847,8531,173Pyridoxal phosphate-dependent aminotransferasetransaminase activity, pyridoxal phosphate binding, biosynthetic process (GO:0008483, GO:0030170, GO:0009058)COG1168 (Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities)
gene_1841LPE_008782,027,735–2,028,907+1,173Pyridoxal phosphate-dependent aminotransferasetransaminase activity,pyridoxal phosphate binding,biosynthetic process (GO:0008483, GO:0030170, GO:0009058)COG0436 (Aspartate/tyrosine/aromatic aminotransferase)
gene_3128LPE_003253,447,981–3,449,180+Pyridoxal phosphate-dependent aminotransferaseL-aspartate:2-oxoglutarate aminotransferase activity,pyridoxal phosphate binding,L-phenylalanine:2-oxoglutarate aminotransferase activity,biosynthetic process (GO:0004069, GO:0030170,GO:0080130, GO:0009058)COG0436 (Aspartate/tyrosine/aromatic aminotransferase)
gene_2303LPE_032132,538,192–2,539,010+Pyridoxine kinaseATP binding,pyridoxal kinase activity,pyridoxal 5′-phosphate salvage,phosphorylation (GO:0005524, GO:0008478, GO:0009443, GO:0016310)COG2240 (Pyridoxal/pyridoxine/pyridoxamine kinase)

Characterization of genes associated with probiotic properties predicted in the Lactiplantibacillus pentosus CF2-10N genome.

*

: the best hit was indicated.

£

: sequences of pLPE10-1 plasmid.

§

: sequences of pLPE10-4 plasmid.

&

: sequences of pLPE10-2 plasmid.

On the other hand, several genes were identified coding for enzymes involved in probiotic functions such as two genes coding for tannase (exclusive to this strain), 1 alpha-amylase, 1 amylopullulanase, 3 beta-galactosidases, 5 aminopeptidases, 1 lipase esterase, 4 peptidases, 2 alpha/beta hydrolases, 1 phenolic acid decarboxylase, 1 carboxylesterase, 1 alpha-acetolactate decarboxylase, and 1 multicopper oxidase (Table 6).

With respect to vitamin biosynthesis, we detected genes coding for proteins involved in vitamins B1 or thiamine (10 genes), B2 or riboflavin (8 genes), B5 (3 genes) and B6 (6 genes), folate (7 genes) and vitamin K2 or menaquinone (1 gene) production (Table 6). In this regard, vitamin production ability of L. pentosus CF2-10 N was validated in vitro.

Discussion

Aloreña table olives, naturally fermented traditional green olives with a denomination of protection (DOP), are considered as potential source of probiotic L. pentosus strains with high genetic diversity (Abriouel et al., 2012). Several L. pentosus strains isolated from Aloreña table olives throughout the fermentation process were shown to be potential probiotics, with L. pentosus MP-10, L. pentosus CF1-6 and L. pentosus CF2-10 N as the best candidates (Pérez Montoro et al., 2016). Among these strains, L. pentosus CF2-10 N was selected for a more in-depth analysis in the current study on the basis of its excellent probiotic properties. These include notably good growth capacity and survival under simulated gastro-intestinal conditions (acidic pH of 1.5, up to 4% of bile salts and 5 mM of nitrate), good ability to auto-aggregate and co-aggregate with pathogenic bacteria, adherence to intestinal and vaginal cell lines, antimicrobial activity by means of plantaricins and fermentation of prebiotics and lactose (Pérez Montoro et al., 2016). It is also noteworthy that L. pentosus CF2-10 N was isolated from the same ecological niche as the potential previously described probiotic L. pentosus MP-10 (Abriouel et al., 2012), hence, they are exposed to the same ecological conditions and pressure (soil, plant and brine) as well as the same progressive changes throughout the production process. It is thus not surprising that their genetic relatedness is further highlighted by shared genetic, functional and probiotic properties although both strains showed different genomic profiles belonging to different clusters or genomic groups (G1 and G2) as reported by Abriouel et al. (2012). In this sense, both strains harbor a single circular chromosome of similar size of 3,698,214 bp (L. pentosus MP-10, GC content of 46.32%) and 3,645,747 bp (L. pentosus CF2-10 N, GC content of 46.42%) and 4 (L. pentosus CF2-10 N, 58–120 kb) to 5 (L. pentosus MP-10, 29–46.5 kb) plasmids (Abriouel et al., 2016). This similarity highlights the effect of the ecosystem (soil, plant and brine) on the genetic diversity of microbial communities present in Aloreña table olives.

A comparison with other bacterial strains from table olives showed similarities in genomic size and GC content. These strains included L. pentosus IG1 harboring a circular chromosome of 3,687,424 bp (GC content of 44.9%) and 7 plasmids (2.5–125.9 kb; Maldonado-Barragán et al., 2011), L. pentosus strains (IG8, IG9, IG10 and IG11) recovered from biofilms on the skin of green table olives with circular chromosome sizes in the range of 3,787,967 to 3,811,295 bp (GC content of 45.9–45.95%) and 6 to 7 plasmids (Calero-Delgado et al., 2019) and L. pentosus O17 isolated from brines of treated table olives (Cerignola cv.) with a circular chromosome of 3,850,701 bp (GC content of 45.9%; Zotta et al., 2022). This fact indicated their adaptation to a brine-specific lifestyle notably in relation to genes involved in carbohydrate transport and metabolism (307 CDSs and 279 in L. pentosus CF2-10 N and MP-10, respectively) and amino acid metabolism (192 CDSs and 173 in L. pentosus CF2-10 N and MP-10, respectively), among others. On the other hand, the presence of plasmids in L. pentosus isolated from table olives highlight their key role in the fermentation process. In this sense, Abriouel et al. (2019) reported that L. pentosus MP-10 plasmids play an important role as metal bioquencher reducing the amount of these potentially toxic elements in humans and animals, food matrices, and in environmental bioremediation.

Duar et al. (2017) reported a high level of niche conservatism within the well-supported phylogenetic groups of the genus Lactobacillus (including the recently reclassified genus Lactoplantibacillus), with lifestyles ranging from free-living with large genome size to strictly symbiotic or host adapted with small genome size. Considering that the metabolic and physiological properties of L. pentosus strains are reflective of their lifestyle, strains isolated from fermented table olives are characterized by their large genome size of 3.6–3.8 Mbp encoding a versatile repertoire of enzymes to utilize a wide spectrum of substrates available in brines. Comparative genomic analysis of both strains isolated from Aloreña table olives - L. pentosus MP-10 and L. pentosus CF2-10 N- demonstrated their close phylogenetic relation (ED = 0) and a high similarity although some event traits (inversion, insertion or gene rearrangement) occurred, conferring exclusive features to L. pentosus CF2-10 N. However, when genomic comparison was done with L. pentosus IG1 isolated from the Spanish-Style Green Olive fermentation (different ecological niche than Aloreña table olives), genetic differences (ED = 0.02) were detected which were further increased when compared with L. pentosus KCA1 isolated from vagina (ED = 0.08). The ecological adaptability of L. pentosus is thus highly dependent on the ecological niche, with the specific environmental and fermentation conditions and olive material being the key elements to determine the genetic diversity.

Concerning the safety properties of L. pentosus CF2-10 N, no ARGs were detected in the genome sequence, however non-specific antimicrobial mechanisms such as mutation in ddl gene coding for D-Ala-D-lactate in the peptidoglycan instead of the normal dipeptide D-Ala-D-Ala (position 260) and /or efflux transporters or transmembrane proteins were found responsible of the strain’s phenotypic resistance to streptomycin and vancomycin as detected by antibiotic susceptibility testing (Casado Muñoz et al., 2014). Furthermore, in silico analysis of antibiotic resistance in L. pentosus CF2-10 N showed the absence of acquired antibiotic resistance genes. Thus, we can conclude that the resistome is mostly represented by efflux-pump resistance genes or other alternative resistance mechanisms responsible for the intrinsic resistance exhibited by this strain as mentioned above. On the other hand, no virulence determinants were detected in the L. pentosus CF2-10 N genome. Taken together these results, we suggest for L. pentosus CF2-10 N to be considered as safe for food processing as well as probiotic.

Regarding the mobilome (corresponding to genetic elements able to move within a genome or between different genomes), this consists of 66 transposases, 45 IS elements and 8 temperate phage regions in the L. pentosus CF2-10 N genome. The high number and the great diversity of transposases and IS elements identified by in silico analysis of the L. pentosus CF2-10 N genome indicated a frequent genetic diversification within the L. pentosus CF2-10 N genome, which is notably higher than in other lactobacilli such as L. plantarum WCFS1 (36 genes), L. pentosus KCA1 (25 genes), L. pentosus DSM 20314 (14 genes) or L. pentosus IG1 (5 genes; Abriouel et al., 2017). Interestingly, L. pentosus CF2-10 N showed an even higher genetic diversification in comparison to L. pentosus MP-10 (29 genes), even though both strains are isolated from the same ecological niche (Abriouel et al., 2017). Furthermore, most of transposases belonged to IS30 families frequently located on plasmids, while the IS were mainly represented by IS30 and IS3 found in various bacteria and being responsible for information transfer and extreme adaptation. This fact suggests the high adaptability potential of L. pentosus CF2-10 N enabling the bacterium to withstand different environmental and gut stress conditions. Furthermore, the presence of eight prophage regions in the L. pentosus CF2-10 N genome highlights once more the genetic diversity and fitness of its genome, conferring a selective advantage for the survivability and resistance of this strain in view of the potential risk of losses associated with phage infection in different ecosystems. The presence of prophages in lactobacilli genomes is widely distributed (more than 92%, Sun et al., 2015) and is species-specific (Pei et al., 2021), while being highly dependent on the habitat. In this regard L. pentosus CF2-10 N contained intact lactobacilli prophage and incomplete or questionable prophage fragments similar to other bacteria (Staphylococcus, Escherichia and Enterobacteria phages) indicating its adaptability to harsh conditions (fermentation) which may confer flexibility against various stress triggers (phages from different sources such as air, water or soil). Other defense mechanisms were predicted in the L. pentosus CF2-10 N including a CRISPR system (CRISPR-I and CRISPR-II) represented by five CRISPR unquestionable arrays and 13 CRISPR associated proteins (six of them were exclusive of this strain) organized in two operons. This acquired immunity system, which provides protection against mobile genetic elements (conjugative plasmids, transposable elements, and phages) in L. pentosus CF2-10 N, was slightly different from L. pentosus MP-10 isolated from the same ecological niche. Notably, 11 CRISPR associated proteins and 9 CRISPR arrays (3 of them were questionable CRISPRs) were detected in L. pentosus MP-10, which indicated that the increased fitness greatly depends on the strain itself, under changing ecological lifestyles. Among the six newly detected genes, the CRISPR-I system was found to be coding for a Type II-A CRISPR-associated protein Csn2, involved in CRISPR adaptation for new spacer acquisition (Nam et al., 2011) and was associated with the cas9-cas1-cas2 cassette. Furthermore, the other genes (gene_2925 [cas 3] and a cascade of five genes coding for Type I-E CRISPR associated proteins) were found to be involved in interference and infection neutralization as reported by Xue and Sashital (2019).

Concerning functional properties, L. pentosus CF2-10 N genome analysis revealed the presence of genes coding for adhesion, exopolysaccharide biosynthesis, tolerance to low pH and bile salts, immunomodulation, as well as vitamin and enzyme production. In this context, the adhesion capacity exhibited by this strain in vitro to Enterocyte-like Caco-2 ECACC86010202 (from colon adenocarcinoma) and HeLa 229 ECACC86090201(from vaginal cervix carcinoma) cells (Pérez Montoro et al., 2016) was confirmed by the presence of genes coding for several adhesion/multifunctional proteins such as mucus-binding proteins, fibronectin/fibrinogen-binding protein, Chitin-binding protein, ABC superfamily ATP binding cassette transporter, binding protein, cell surface proteins, manganese ABC transporter substrate-binding protein, elongation factor Tu, Molecular chaperone DnaK, molecular chaperone GroEL, co-chaperone GroES, class A sortase and type I glyceraldehyde-3-phosphate dehydrogenase. These proteins were reported to be involved in the adhesion to intestinal epithelial cells (Granato et al., 2004; Vélez et al., 2007; Lebeer et al., 2008; Sánchez et al., 2011; Jensen et al., 2014; Hymes et al., 2016), however, some of these proteins can also be involved in other functions such as stress response, drug efflux, carbohydrate transport and metabolism and other probiotic actions (Lebeer et al., 2008; Lewis et al., 2012; Monteagudo-Mera et al., 2019). The specific functionality notably depends on the surrounding conditions which induce gene expression, with differences detected in both in vitro and in vivo scenarios. On the other hand, other genes coding for proteins involved in cell recognition and adhesion to intestinal mucosae such as the four genes coding for exopolysaccharide biosynthesis proteins were identified in the L. pentosus CF2-10 N genome. These were found to be identical to those detected in L. pentosus MP-10 isolated from Aloreña table olives (Abriouel et al., 2016). Besides their role in niche adaptation, promoting auto-aggregation and biofilm formation, these proteins were also attributed anti-inflammatory, antioxidant, antiviral and antiproliferative activity functions through their interaction with the immune system (Castro-Bravo et al., 2018; Nguyen et al., 2020; Riaz Rajoka et al., 2020).

To allow the adaptation to different lifestyles, L. pentosus CF2-10 N harbored in its genome several genes involved in stress response such as acids and bile. In this sense, Pérez Montoro et al. (2016) reported the strain’s excellent tolerance properties in vitro (acidic pH of 1.5, up to 4% of bile salts and 5 mM of nitrate), while in the present study we detected for the first time several genes coding for proteins involved in bile/acids resistance particularly including cell protection (dnaK and groL), modifications in cell membranes (genes coding for Na+/H+ antiporter NhaC, lepA, pyrD), general function (genes coding for GNAT family acetyltransferase), and key components of central metabolism (pgk, gpm, CysK, luxS, tuf, efp, tsf, FD24_GL002972, greA, greA2, fusA) as it was reported elsewhere for other bacteria (Wu et al., 2010; Liu et al., 2018; Bagon et al., 2021). Most of these proteins are considered moonlighting proteins involved in adhesion to the intestinal epithelium among other functions (Pagnini et al., 2018).

Concerning attractive and promising biotechnological features revealed by in silico analysis of the L. pentosus CF2-10 N genome, detected enzymes were involved in the degradation of toxic/complex substrates such as tannase, alpha-amylase, amylopullulanase, beta-galactosidase, aminopeptidase, lipase esterase, peptidases, alpha/beta hydrolase, phenolic acid decarboxylase, carboxylesterase, alpha-acetolactate decarboxylase and multicopper oxidase. These findings indicate the high adaptability of this strain to a broad range of environmental niches, food matrices and also the gastrointestinal tract, while being able to ferment lactose and starch. Findings further demonstrate the strain’s potential ability to synthesize and degrade a broad array of simple and complex carbohydrates, such as starch, pullulan, amylopectin, tannin, beta-galactosides, phenolic acids and other substrates. It is further noteworthy that L. pentosus CF2-10 N harbored genes coding for vitamin biosynthesis such as the vitamin B group (B1 or thiamine, B2 or riboflavin and B5), folate and vitamin K2 or menaquinone. In this regard, preliminary in vitro studies hinted towards a potential vitamin production ability of L. pentosus CF2-10 N. However, future studies are necessary and will be performed to investigate this potential in further detail.

Conclusion

The results obtained in the present study support the hypothesis that L. pentosus CF2-10 N is an excellent probiotic candidate of vegetable origin. Notably, besides fulfilling the main criteria for probiotic selection in vitro as shown by our previous studies, in silico genome analysis in this study revealed novel insights into its safety and functionality, greatly highlighting the microorganism’s ecological flexibility and adaptability to a broad range of environmental niches, food matrices and the gastrointestinal tract. The safety of L. pentosus CF2-10 N was further confirmed by the absence of virulence determinants and acquired antibiotic resistance genes, with the resistome mostly represented by efflux-pump resistance genes responsible for the intrinsic resistance exhibited by this strain. On the other hand, defense mechanisms of L. pentosus CF2-10 N consist of eight prophage regions as well as a CRISPR (clustered regularly interspaced short palindromic repeats)/cas (CRISPR-associated protein genes) system (CRISPR-I and CRISPR-II) as acquired immune system against mobile elements. The latter is notably represented by five CRISPR unquestionable arrays and 13 CRISPR associated proteins (six of them were exclusive of this strain). Furthermore, the functionality of this strain was supported by the presence of genes coding for proteins involved in adhesion, exopolysaccharide biosynthesis, tolerance to low pH and bile salts, immunomodulation as well as vitamin and enzyme production.

Taken together these results we suggest that L. pentosus CF2-10 N could be considered as potential and promising probiotic candidate able to colonize several niches and adapt to different lifestyles, while providing attractive probiotic features, which will be explored in vivo in future studies with the aim to be applied in vegetable fermentations (including olives) and/or other substrates.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary material.

Author contributions

HA and NB conceived, designed the experiments, and drafted the paper. HA, JM, NC, and NB performed the experiments and analyzed the data. HA contributed reagents, materials, and analysis tools. All authors contributed to the article and approved the submitted version.

Acknowledgments

We acknowledge the Research Team (University of Jaen, EI_BIO1_2021).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2022.989824/full#supplementary-material

References

  • 1

    AbriouelH.BenomarN.CoboA.CaballeroN.Fernández FuentesM. A.Pérez-PulidoR.et al. (2012). Characterization of lactic acid bacteria from naturally-fermented Manzanilla Aloreña green table olives. Food Microbiol.32, 308316. doi: 10.1016/j.fm.2012.07.006

  • 2

    AbriouelH.BenomarN.LucasR.GálvezA. (2011). Culture-independent study of the diversity of microbial populations in brines during fermentation of naturally fermented Aloreña green table olives. Int. J. Food Microbiol.144, 487496. doi: 10.1016/j.ijfoodmicro.2010.11.006

  • 3

    AbriouelH.Pérez MontoroB.Casado MuñozM. D. C.Lavilla LermaL.Hidalgo PestañaM.Caballero GómezN.et al. (2016). Complete genome sequence of a potential probiotic, lactobacillus pentosus MP-10, isolated from fermented Aloreña table olives. Genome Announc.4, e00854e00816. doi: 10.1128/genomeA.00854-16

  • 4

    AbriouelH.Pérez MontoroB.Casimiro-SoriguerC. S.Pérez PulidoA. J.KnappC. W.Caballero GómezN.et al. (2017). Insight into potential probiotic markers predicted in lactobacillus pentosus MP-10 genome sequence. Front. Microbiol.8:891. doi: 10.3389/fmicb.2017.00891

  • 5

    AbriouelH.Pérez MontoroB.de la Fuente OrdoñezJ. J.Lavilla LermaL.KnappC. W.BenomarN. (2019). New insights into the role of plasmids from probiotic lactobacillus pentosus MP-10 in Aloreña table olive brine fermentation. Sci. Reports9:10938. doi: 10.1038/s41598-019-47384-1

  • 6

    AlcockB. P.RaphenyaA. R.LauT. T. Y.TsangK. K.BouchardM.EdalatmandA.et al. (2020). CARD 2020: antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic Acids Res.48, D517D525. doi: 10.1093/nar/gkz935

  • 7

    AllainT.ChaouchS.ThomasM.ValléeI.BuretA. G.LangellaP.et al. (2018). Bile-salt-hydrolases from the probiotic strain lactobacillus johnsonii La1 mediate anti-giardial activity in vitro and in vivo. Front. Microbiol.8:2707. doi: 10.3389/fmicb.2017.02707

  • 8

    Alonso GarcíaA.BenomarB.Lavilla LermaF.de la Fuente OrdoñezJ. J.KnappC. W.AbriouelH. (2023). Changes in resistome profile of potential probiotic Lactiplantibacillus pentosus in response to edible oil adaptation. Food Microbiol.104148. doi: 10.1016/j.fm.2022.104148

  • 9

    Alonso GarcíaE.de la Fuente OrdoñezJ. J.Lavilla LermaL.Estudillo-MartínezM. D.Castillo-GutiérrezS.BenomarN.et al. (2021). Transcriptomic profile and probiotic properties of Lactiplantibacillus pentosus pre-adapted to edible oils. Front. Microbiol.12:747043. doi: 10.3389/fmicb.2021.747043

  • 10

    AmaraA. A.ShiblA. (2015). Role of probiotics in health improvement, infection control and disease treatment and management. Saudi Pharm. J.23, 107114. doi: 10.1016/j.jsps.2013.07.001

  • 11

    AnukamK. C.MacklaimJ. M.GloorG. B.ReidG.BoekhorstJ.RenckensB.et al. (2013). Genome sequence of lactobacillus pentosus KCA1: vaginal isolate from a healthy premenopausal woman. PLoS One8:e59239. doi: 10.1371/journal.pone.0059239

  • 12

    ArndtD.GrantJ.MarcuA.SajedT.PonA.LiangY.et al. (2016). PHASTER: a better, faster version of the PHAST phage search tool. Nucleic Acids Res.44, W16W21. doi: 10.1093/nar/gkw387

  • 13

    BagonB. B.ValerianoV. D. V.OhJ. K.PajarilloE. A. B.LeeJ. Y.KangD. K. (2021). Exoproteome perspective on the bile stress response of lactobacillus johnsonii. Proteomes9:10. doi: 10.3390/proteomes9010010

  • 14

    Benítez-CabelloA.Calero-DelgadoB.Rodríguez-GómezF.Garrido-FernándezA.Jiménez-DíazR.Arroyo-LópezF. N. (2019). Biodiversity and multifunctional features of lactic acid bacteria isolated from table olive biofilms. Front. Microbiol.10:836. doi: 10.3389/fmicb.2019.00836

  • 15

    BesemerJ.LomsadzeA.BorodovskyM. (2001). GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions. Nucleic Acids Res.29, 26072618. doi: 10.1093/nar/29.12.2607

  • 16

    BiswasA.StaalsR. H. J.MoralesS. E.FineranP. C.BrownC. M. (2016). CRISPRDetect: a flexible algorithm to define CRISPR arrays. BMC Genom.17:356. doi: 10.1186/s12864-016-2627-0

  • 17

    BortolaiaV.KaasR. S.RuppeE.RobertsM. C.SchwarzS.CattoirV.et al. (2020). ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother.75, 34913500. doi: 10.1093/jac/dkaa345

  • 18

    CaggianielloG.KleerebezemM.SpanoG. (2016). Exopolysaccharides produced by lactic acid bacteria: from health-promoting benefits to stress tolerance mechanisms. Appl. Microbiol. Biotechnol.100, 38773886. doi: 10.1007/s00253-016-7471-2

  • 19

    Calero-DelgadoB.Pérez-PulidoA. J.Benítez-CabelloA.Martín-PlateroA. M.Casimiro- SoriguerC. S.Martínez-BuenoM.et al. (2019). Multiple genome sequences of lactobacillus pentosus strains isolated from biofilms on the skin of fermented green table olives. Microbiol. Resour. Announc.8, e01546e01518. doi: 10.1128/MRA.01546-18

  • 20

    CarrascoJ. A.Lucena-PadrósH.BrenesM.Ruiz-BarbaJ. L. (2018). Expression of genes involved in metabolism of phenolic compounds by lactobacillus pentosus and its relevance for table-olive fermentations. Food Microbiol.76, 382389. doi: 10.1016/j.fm.2018.06.020

  • 21

    CarverT. J.RutherfordK. M.BerrimanM.RajandreamM. A.BarrellB. G.ParkhillJ. (2005). ACT: the Artemis comparison tool. Bioinform.21, 34223423. doi: 10.1093/bioinformatics/bti553

  • 22

    CarverT. J.ThomsonN.BleasbyA.BerrimanM.ParkhillJ. (2009). DNAPlotter: circular and linear interactive genome visualization. Bioinform.25, 119120. doi: 10.1093/bioinformatics/btn578

  • 23

    Casado MuñozM. C.BenomarN.EnnaharS.HorvatovichP.Lavilla LermaL.KnappC. W.et al. (2016). Comparative proteomic analysis of a potentially probiotic lactobacillus pentosus MP-10 for the identification of key proteins involved in antibiotic resistance and biocide tolerance. Int. J. Food Microbiol.222, 815. doi: 10.1016/j.ijfoodmicro.2016.01.012

  • 24

    Casado MuñozM. C.BenomarN.LermaL. L.GálvezA.AbriouelH. (2014). Antibiotic resistance of lactobacillus pentosus and Leuconostoc pseudomesenteroides isolated from naturally-fermented Aloreña table olives throughout fermentation process. Int. J. Food Microbiol.172, 110118. doi: 10.1016/j.ijfoodmicro.2013.11.025

  • 25

    Castro-BravoN.WellsJ. M.MargollesA.Ruas-MadiedoP. (2018). Interactions of surface exopolysaccharides from Bifidobacterium and lactobacillus within the intestinal environment. Front. Microbiol.9:2426. doi: 10.3389/fmicb.2018.02426

  • 26

    ChinC. S.AlexanderD. H.MarksP.KlammerA. A.DrakeJ.HeinerC.et al. (2013). Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nat. Methods10, 563569. doi: 10.1038/nmeth.2474

  • 27

    ConesaA.GötzS.García-GómezJ. M.TerolJ.TalónM.RoblesM. (2005). Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinform.21, 36743676. doi: 10.1093/bioinformatics/bti610

  • 28

    DarlingA. C. E.MauB.BlattnerF. R.PernaN. T. (2004). Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res.14, 13941403. doi: 10.1101/gr.2289704

  • 29

    DuarR. M.LinX. B.ZhengJ. Z.MartinoM. E.GrenierT.Pérez-MuñozM. E.et al. (2017). Lifestyles in transition: evolution and natural history of the genus lactobacillus. FEMS Microbiol. Rev.41, S27S48. doi: 10.1093/femsre/fux030

  • 30

    GranatoD.BergonzelliG. E.PridmoreR. D.MarvinL.RouvetM.Corthésy-TheulazI. E. (2004). Cell surface-associated elongation factor Tu mediates the attachment of lactobacillus johnsonii NCC533 (La1) to human intestinal cells and mucins. Inf. Immun.72, 21602169. doi: 10.1128/IAI.72.4.2160-2169.2004

  • 31

    GuantarioB.ZinnoP.SchifanoE.RoselliM.PerozziG.PalleschiC.et al. (2018). In vitro and in vivo selection of potentially probiotic lactobacilli from Nocellara del Belice table olives. Front. Microbiol.9:595. doi: 10.3389/fmicb.2018.00595

  • 32

    HillC.GuarnerF.ReidG.GibsonG. R.MerensteinD. J.PotB.et al. (2014). The international scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol.11, 506514. doi: 10.1038/nrgastro.2014.66

  • 33

    HymesJ. P.JohnsonB. R.BarrangouR.KlaenhammerT. R. (2016). Functional analysis of an S-layer-associated fibronectin-binding protein in Lactobacillus acidophilus NCFM. Appl. Environ. Microbiol.82, 26762685. doi: 10.1128/AEM.00024-16

  • 34

    JensenH.RoosS.JonssonH.RudI.GrimmerS.van PijkerenJ. P.et al. (2014). Role of lactobacillus reuteri cell and mucus-binding protein a (CmbA) in adhesion to intestinal epithelial cells and mucus in vitro. Microbiol.160, 671681. doi: 10.1099/mic.0.073551-0

  • 35

    LagesenK.HallinP.RødlandE. A.StærfeldtH. H.RognesT. (2007). RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res.35, 31003108. doi: 10.1093/nar/gkm160

  • 36

    LavermicoccaP.ValerioF.LonigroS. L.de AngelisM.MorelliL.CallegariM. L. (2005). Study of adhesion and survival of lactobacilli and bifidobacteria on table olives with the aim of formulating a new probiotic food. Appl. Environ. Microbiol.71, 42334240. doi: 10.1128/AEM.71.8.4233-4240.2005

  • 37

    LebeerS.VanderleydenJ.De KeersmaeckerS. C. J. (2008). Genes and molecules of lactobacilli supporting probiotic action. Microbiol. Mol. Biol. Rev.72:728. doi: 10.1128/MMBR.00017-08

  • 38

    LewisV. G.WeenM. P.McDevittC. A. (2012). The role of ATP-binding cassette transporters in bacterial pathogenicity. Protoplasma249, 919942. doi: 10.1007/s00709-011-0360-8

  • 39

    LiuL.WuR.ZhangJ.LiP. (2018). Overexpression of luxS promotes stress resistance and biofilm formation of lactobacillus paraplantarum L-ZS9 by regulating the expression of multiple genes. Front. Microbiol.9:2628. doi: 10.3389/fmicb.2018.02628

  • 40

    LiuB.ZhengD.JinQ.ChenL.YangJ. (2019). VFDB 2019: a comparative pathogenomic platform with an interactive web interface. Nucleic Acids Res.47, D687D692. doi: 10.1093/nar/gky1080

  • 41

    LoweT. M.EddyS. R. (1997). tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucl. Acids Res.25, 955964.

  • 42

    Maldonado-BarragánA.Caballero-GuerreroB.Lucena-PadrósH.Ruiz-BarbaJ. L. (2011). Genome sequence of lactobacillus pentosus IG1, a strain isolated from Spanish-style green olive fermentations. J. Bacteriol.193:5605. doi: 10.1128/JB.05736-11

  • 43

    Monteagudo-MeraA.RastallR. A.GibsonG. R.CharalampopoulosD.ChatzifragkouA. (2019). Adhesion mechanisms mediated by probiotics and prebiotics and their potential impact on human health. Appl. Microbiol. Biotechnol.103, 64636472. doi: 10.1007/s00253-019-09978-7

  • 44

    MyersE. W.SuttonG. G.DelcherA. L.DewI. M.FasuloD. P.FlaniganM. J.et al. (2000). A whole-genome assembly of drosophila. Sci287, 21962204.

  • 45

    NamK. H.KurinovI.KeA. (2011). Crystal structure of clustered regularly interspaced short palindromic repeats (CRISPR)-associated Csn2 protein revealed Ca2+-dependent double-stranded DNA binding activity. J. Biol. Chem.286, 3075930768. doi: 10.1074/jbc.M111.256263

  • 46

    NayakS. K. (2010). Probiotics and immunity: a fish perspective. Fish Shellfish Immunol.29, 214. doi: 10.1016/j.fsi.2010.02.017

  • 47

    NguyenP. T.NguyenT. T.BuiD. C.HongP. T.HoangQ. K.NguyenH. T. (2020). Exopolysaccharide production by lactic acid bacteria: the manipulation of environmental stresses for industrial applications. AIMS Microbiol.6, 451469. doi: 10.3934/microbiol.2020027

  • 48

    OguntoyinboF. A.NarbadA. (2015). Multifunctional properties of lactobacillus plantarum strains isolated from fermented cereal foods. J. Funct. Foods17, 621631. doi: 10.1016/j.jff.2015.06.022

  • 49

    PagniniC.CorletoV. D.MartorelliM.LaniniC.D’AmbraG.Di GiulioE.et al. (2018). Mucosal adhesion and anti-inflammatory effects of lactobacillus rhamnosus GG in the human colonic mucosa: a proof-of-concept study. World J. Gastroenterol.24, 46524662. doi: 10.3748/wjg.v24.i41.4652

  • 50

    PeiZ.SadiqF. A.HanX.ZhaoJ.ZhangH.RossR. P.et al. (2021). Comprehensive scanning of prophages in lactobacillus: distribution, diversity, antibiotic resistance genes, and linkages with CRISPR-Cas systems. mSystems6:e0121120. doi: 10.1128/mSystems.01211-20

  • 51

    Pérez MontoroB.BenomarN.Caballero GómezN.EnnaharS.HorvatovichP.KnappC. W.et al. (2018b). Proteomic analysis of lactobacillus pentosus for the identification of potential markers of adhesion and other probiotic features. Food Res. Int.111, 5866. doi: 10.1016/j.foodres.2018.04.072

  • 52

    Pérez MontoroB.BenomarN.Caballero GómezN.EnnaharS.HorvatovichP.KnappC. W.et al. (2018a). Proteomic analysis of lactobacillus pentosus for the identification of potential markers involved in acid resistance and their influence on other probiotic features. Food Microbiol.72, 3138. doi: 10.1016/j.fm.2017.11.006

  • 53

    Pérez MontoroB.BenomarN.Lavilla LermaL.Castillo GutiérrezS.GálvezA.AbriouelH. (2016). Fermented Aloreña table olives as a source of potential probiotic lactobacillus pentosus strains. Front. Microbiol.7:1583. doi: 10.3389/fmicb.2016.01583

  • 54

    Pérez-DíazI. M.JohanningsmeierS. D.AnekellaK.Pagán-MedinaC. G.Méndez-SandovalL.ArellanoC.et al. (2021). Genotypic and phenotypic diversity among lactobacillus plantarum and lactobacillus pentosus isolated from industrial scale cucumber fermentations. Food Microbiol.94:103652. doi: 10.1016/j.fm.2020.103652

  • 55

    PerpetuiniG.PreteR.Garcia-GonzalezN.Khairul AlamM.CorsettiA. (2020). Table olives more than a fermented food. Foods9:178. doi: 10.3390/foods9020178

  • 56

    PuvanasundramP.ChongC. M.SabriS.YusoffM. S.KarimM. (2021). Multi-strain probiotics: functions, effectiveness and formulations for aquaculture applications. Aquac. Rep.21:100905. doi: 10.1016/j.aqrep.2021.100905

  • 57

    Riaz RajokaM. S.WuY.MehwishH. M.BansalM.ZhaoL. (2020). Lactobacillus exopolysaccharides: new perspectives on engineering strategies, physiochemical functions, and immunomodulatory effects on host health, trends food Sci. Technol.103, 3648. doi: 10.1016/j.tifs.2020.06.003

  • 58

    Rodríguez-GómezF.Romero-GilV.Arroyo-LópezF. N.Roldán-ReyesJ. C.Torres-GallardoR.Bautista-GallegoJ.et al. (2017). Assessing the challenges in the application of potential probiotic lactic acid bacteria in the large-scale fermentation of Spanish-style table olives. Front. Microbiol.8:915. doi: 10.3389/fmicb.2017.00915

  • 59

    Rodríguez-GómezF.Romero-GilV.Bautista-GallegoJ.García-GarcíaP.Garrido-FernándezA.Arroyo-LópezF. N. (2014). Production of potential probiotic Spanish-style green table olives at pilot plant scale using multifunctional starters. Food Microbiol.44, 278287. doi: 10.1016/j.fm.2014.03.023

  • 60

    SánchezB.González-TejedoC.Ruas-MadiedoP.UrdaciM. C.MargollesA. (2011). Lactobacillus plantarum extracellular chitin-binding protein and its role in the interaction between chitin, Caco-2 cells, and mucin. Appl. Environ. Microbiol.77, 11231126. doi: 10.1128/AEM.02080-10

  • 61

    SaxamiG.KarapetsasA.ChondrouP.VasiliadisS.LamprianidouE.KotsianidisI.et al. (2017). Potentially probiotic lactobacillus strains with anti-proliferative activity induce cytokine/chemokine production and neutrophil recruitment in mice. Benef. Microbes8, 615623. doi: 10.3920/BM2016.0202

  • 62

    StamatakisA. (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinform.30, 13121313. doi: 10.1093/bioinformatics/btu033

  • 63

    SunZ.HarrisH. M.McCannA.GuoC.ArgimonS.ZhangW.et al. (2015). Expanding the biotechnology potential of lactobacilli through comparative genomics of 213 strains and associated genera. Nat. Commun.6:8322. doi: 10.1038/ncomms9322

  • 64

    TofaloR.PerpetuiniG.SchironeM.CiarrocchiA.FasoliG.SuzziG.et al. (2014). Lactobacillus pentosus dominates spontaneous fermentation of Italian table olives. LWT-Food Sci. Technol.57, 710717. doi: 10.1016/J.LWT.2014.01.035

  • 65

    VaccalluzzoA.PinoA.RussoN.De AngelisM.CaggiaC.RandazzoC. L. (2020). FoodOmics as a new frontier to reveal microbial community and metabolic processes occurring on table olives fermentation. Food Microbiol.92:103606. doi: 10.1016/j.fm.2020.103606

  • 66

    van de WijgertJ. H. H. M.VerwijsM. C. (2019). Lactobacilli-containing vaginal probiotics to cure or prevent bacterial or fungal vaginal dysbiosis: a systematic review and recommendations for future trial designs. BJOG127, 287299. doi: 10.1111/1471-0528.15870

  • 67

    VélezM. P.De KeersmaeckerS. C.VanderleydenJ. (2007). Adherence factors of lactobacillus in the human gastrointestinal tract. FEMS Microbiol. Lett.276, 140148. doi: 10.1111/j.1574-6968.2007.00908.x

  • 68

    WuR.SunZ.WuJ.MengH.ZhangH. (2010). Effect of bile salts stress on protein synthesis of lactobacillus casei Zhang revealed by 2-dimensional gel electrophoresis. J. Dairy Sci.93, 38583868. doi: 10.3168/jds.2009-2967

  • 69

    XueC.SashitalD. G. (2019). Mechanisms of type I-E and I-F CRISPR-Cas Systems in Enterobacteriaceae. EcoSal Plus8:10.1128/ecosalplus.ESP-0008-2018. doi: 10.1128/ecosalplus.ESP-0008-2018

  • 70

    YanS.TianZ.LiM.LiB.CuiW. (2019). Effects of probiotic supplementation on the regulation of blood lipid levels in overweight or obese subjects: a meta-analysis. Food Funct.10, 17471759. doi: 10.1039/c8fo02163e

  • 71

    YohaK. S.NidaS.DuttaS.MosesJ. A.AnandharamakrishnanC. (2022). Targeted delivery of probiotics: perspectives on research and commercialization. Probiotics Antimicro. Prot.14, 1548. doi: 10.1007/s12602-021-09791-7

  • 72

    ZankariE.HasmanH.CosentinoS.VestergaardM.RasmussenS.LundO.et al. (2012). Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother.67, 26402644. doi: 10.1093/jac/dks261

  • 73

    ZhangZ.SchwartzS.WagnerL.MillerW. (2000). A greedy algorithm for aligning DNA sequences. J. Comput. Biol.7, 203214.

  • 74

    ZhengJ.WittouckS.SalvettiE.FranzC. M. A. P.HarrisH. M. B.MattarelliP.et al. (2020). A taxonomic note on the genus lactobacillus: description of 23 novel genera, emended description of the genus lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol.70, 27822858. doi: 10.1099/ijsem.0.004107

  • 75

    ZhouY.LiangY.LynchK.DennisJ. J.WishartD. S. (2011). PHAST: a fast phage search tool. Nucl. Acids Res.39, W347W352. doi: 10.1093/nar/gkr485

  • 76

    ZottaT.GiavaliscoM.ParenteE.PicarielloG.SianoF.RicciardiA. (2022). Selection of Lactiplantibacillus strains for the production of fermented table olives. Microorganisms10:625. doi: 10.3390/microorganisms10030625

Summary

Keywords

Aloreña table olives, Lactiplantibacillus pentosus, probiotics, in silico analysis, safety, functional properties

Citation

Abriouel H, Manetsberger J, Caballero Gómez N and Benomar N (2022) In silico genomic analysis of the potential probiotic Lactiplantibacillus pentosus CF2-10N reveals promising beneficial effects with health promoting properties. Front. Microbiol. 13:989824. doi: 10.3389/fmicb.2022.989824

Received

08 July 2022

Accepted

04 October 2022

Published

03 November 2022

Volume

13 - 2022

Edited by

Joaquin Bautista-Gallego, University of Extremadura, Spain

Reviewed by

Gloria Díaz-Ruiz, National Autonomous University of Mexico, Mexico; Zhihong Sun, Inner Mongolia Agricultural University, China; Alex Galanis, Democritus University of Thrace, Greece

Updates

Copyright

*Correspondence: Hikmate Abriouel,

This article was submitted toFood Microbiology, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics