ORIGINAL RESEARCH article

Front. Sustain. Food Syst., 19 April 2021

Sec. Agroecology and Ecosystem Services

Volume 5 - 2021 | https://doi.org/10.3389/fsufs.2021.663238

Transcriptome Analysis Identified Gene Regulation Networks in Soybean Leaves Perturbed by the Coronatine Toxin

  • 1. School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, China

  • 2. Institute of Quality and Safety Testing Center for Agro-Products, Xining, China

  • 3. College of Horticulture, Shanxi Agricultural University, Jinzhong, China

  • 4. Department of Plant and Environmental Sciences, Edisto Research and Education Center, Clemson University, Blackville, SC, United States

  • 5. Biology Program, Division of Science, New York University Abu Dhabi, Abu Dhabi, United Arab Emirates

Article metrics

View details

3

Citations

2,2k

Views

907

Downloads

Abstract

The non-host specific Pseudomonas syringae phytotoxin Coronatine (COR) causes chlorosis and promotes toxicity by inducing physiological changes in plants. We performed transcriptome analysis to better understand plants' transcriptional and metabolic response to COR. Toward this end, mock-treated and COR-treated soybean plants were analyzed by RNA-Seq. A total of 4,545 genes were differentially expressed between the two treatments, of which 2,170 were up-regulated whereas 2,375 were down-regulated in COR treated samples. Gene annotation and pathway analysis conducted using the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) databases revealed that the differential genes were involved in photosynthesis, jasmonic acid (JA) synthesis, signal transduction, and phenylpropane metabolism. This study will provide new insights into COR mediated responses and extend our understanding of COR function in plants.

Introduction

Soybean [Glycine max (L.) Merr.] is one of the most important economic crops in the world but is vulnerable to various pests and diseases which drastically affect yield and quality. Soybean speck caused by Pseudomonas syringae pv. glycinea (Pgy) is a common disease, threatening soybean yield worldwide (Keen and Buzzell, 1991; Wrather et al., 1997). Pathogenic bacteria inject type three effectors (TTEs) through the type three secretion system (TTSS) in order to inhibit the plant immune response and cause virulence in compatible hosts. Besides effector proteins, pathogens also secrete phytotoxins to increase pathogenicity on plants. Phytotoxins promote pathogen growth by modifying host cell processes and by altering host metabolism (Galán, 2009). Coronatine (COR) is a non-host specific phytotoxin secreted by Pseudomonas syringae pathovars atropurpurea, glycinea, maculicola, morsprunorum, and tomato (Bender et al., 1999). Coronatine can be detected in healthy tissues adjacent to the bacterial lesions, indicating that COR could move systemically (Zhao et al., 2001). The main symptom caused by COR is chlorosis, however, COR does not destroy organelles or membrane systems (Palmer and Bender, 1995). In addition to causing chlorosis in plants, the compound can reopen stomata, which can promote bacterial invasion, proliferation, and development of plant disease symptoms (Geng et al., 2012).

Coronatine (C18H25NO4) has a relative molecular weight of 319 g/mol and is a structural and functional analog of JA-Ile. It is formed by linking the α-amino acid Coronamic Acid (CMA) with the polyketone Coronafacic Acid (CFA) through an amide linkage (Brooks et al., 2004). Coronafacic Acid structure partially mimics the plant hormone jasmonic acid (JAs), and similar to Jasmonate, its activity is mediated by binding to the Coranatine Insensitive1 (COI1) receptor (Feys et al., 1994). The affinity of COR for COI1 is more than 1,000 times that of JA-Ile (Katsir et al., 2008). Coronatine induces JA biosynthesis and inhibits SA signaling, thereby dampening SA-dependent disease resistance (Zheng et al., 2012). The treatment of COR in plants also induces ethylene production and the release rate of ethylene is proportional to the concentration of COR in tobacco leaves (Ferguson and Mitchell, 1985; Kenyon and Turner, 1992). Although CMA is structurally similar to the ethylene precursor 1-aminocyclopropene 1-carboxylic acid (ACC), it does not induce the production of ethylene responsive genes (Uppalapati et al., 2005). Furthermore, treatment with CFA, CMA, MeJA, or ACC does not induce chlorosis, indicating that COR has additional functions than those attributed to either CFA or CMA (Uppalapati et al., 2005).

High-throughput RNA-Seq is a powerful tool to study gene expression changes in plants (Gao et al., 2014). In order to better understand the function of COR in soybean, we treated soybean plant leaves with COR which was followed by transcriptome analysis. The biological annotation of differentially expressed genes (DEGs) under treatment of COR provided new insights into COR mediated plant responses on soybeans, thereby extending our understanding of COR function in plants.

Materials and Methods

Plant Material and Treatment

Soybean [Glycine max (L.) Merrill cv. Williams 82] was grown under a 12 h light /12 h dark period with light and dark temperatures of 25 and 20°C, respectively. Four-week-old soybean plants were used in the study. Coronatine purchased from Sigma-Aldrich (St. Louis, MO) was dissolved in methanol to make a stock solution (600 μM, stored at −20°C) which was subsequently diluted with water to a final concentration of 3 μM. After the addition of 0.004% Silwet L-77, the working solution was sprayed on soybean leaves and leaf samples were collected 10 h post spray. For control treatment, only water containing 0.004% Silwet L-77 solution was sprayed onto the plant leaves. Harvested samples were immediately frozen in liquid nitrogen and stored at −80°C.

Library Construction and RNA-Seq

Each treatment (COR or mock) was carried out in triplicate. Total RNA was extracted from leaves of COR-treated and control plants using Trizol reagent (Invitrogen, Carlsbad, CA, USA; Rio et al., 2010), and the concentration of RNA was quantified using a NanoDrop-2000 nucleic acid spectrophotometer (Thermo Fisher Scientific, Wilmington, DE). Nucleic acid integrity was assessed by resolving RNA on a 1% (w/v) agarose gel. Quality control and library construction were entrusted to Huada Gene Technology Company (Wuhan, Hubei, China). In brief, from a pool of total RNA, the mRNA fraction was enriched with the help of Oligo-dT magnetic beads (Vazyme Biotech Company, Jiangsu, China). This was followed by RNA fragmentation and first strand cDNA synthesis using the random hexamer primers (Illumina, San Diego, CA, USA). Following second strand cDNA synthesis, the fragments were ligated with adapters and PCR amplified to construct cDNA libraries. BGISEQ-500 platform from Huada Gene Technology Co., Ltd. (Wuhan, Hubei, China) was used to generate raw library reads. The base quaility of the raw data was the ASCII (American standard code for information interchange) value of each character in the fourth line of the FASTQ format minus 64. Reads where more than half of the component bases had a quality score below 15 was considered a low-quality read and removed by Soapnuk. Hierarchical Indexing for Spliced Alignment of Transcripts (HISAT) was used to align the filtered data to the reference genome (GCF_000004515.4_Glycine_max_v2.0; Kim et al., 2015). The RNA-seq data has been uploaded to NCBI gene expression omnibus server (accession number: PRJNA690873, Biosample ID: SAMN17266875, COR SRA ID: SRR13389957, and Mock SRA ID: SRR13389956).

Gene Annotation and Classification

Fragments Per Kilobase of exon model per Million mapped fragments (FPKM) was used to evaluate gene expression levels, and DEGseq R package (Anders and Huber, 2010) was used to determine the DEGs between the two samples. The screening threshold for differential genes was | log2 Fold Change | ≥ 1, FDR < 0.01, FPKM ≥ 1.

Based on Gene Ontology (GO) (http://www.geneontology.org/) analysis, DEGs were divided into three major functional categories including molecular function, cellular component, and biological process. These genes were further classified into biological pathways based on Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/) annotation and the phyper function in R was used for enrichment analysis.

Quantitative Real Time PCR (qRT-PCR) Validation

In order to assess the reliability of the data obtained from RNA-Seq, we measured the relative fold change of five genes by qRT-PCR analysis (Yu et al., 2014). RNA was extracted from frozen leaf tissue using Trizol reagent. In order to determine RNA integrity, the RNA samples were resolved on a 1% (w/v) agarose gel. For first strand cDNA synthesis, the PrimeScript™ RT (TaKaRa, Mountain View, CA), and the gDNA Eraser (TaKaRa, Mountain View, CA) kits were used. For qPCR analysis, the TB GreenTM Premix Ex Taq™ (TaKaRa, Mountain View, CA) kit was used under the following set of conditions. A pre-denaturation step of 95°C for 30 s, 40 cycles with each cycle employing a denaturation temperature of 95°C for 5 s, and an annealing/extension step with a temperature of 60°C for 30 s followed by melt curve analysis. For each treatment, we analyzed a total of three biological replicates, each of which included three technical repeats. The 2−ΔΔCT method was used for the relative quantification of the five genes. The primers used for the qRT-PCR analysis are listed in Table 1. The GLYMA_20G141600 gene that encodes for polyubiquitin served as an internal control.

Table 1

Gene numberPrimer sequenceDescription
GLYMA_18G057900GACATCGACTCCATTGCCDihydroflavonol reductase
CCGCCTTCAACACATTAACTG
GLYMA_05G039900GACCCAGTTCAAGACACCCReceptor-like protein kinase
CCGAGTTCCACAAGTTCAC
GLYMA_17G023100AAAGAAAGAGAAGTGATGGTGGCASP-like protein 5
GAGGGCAAGGAGTAGAGAC
GLYMA_04G166900CCAAACACCAGCCAATCTCTranscription repressor MYB6
GTCACTTTCTAACCCAATACCA
GLYMA_18G072200GTTCTACACTACACTCACACTGVacuolar cation/ proton exchanger 5
GTTTCCATTCTGACTCTCATCC
GLYMA _ 20G141600GTGTAATGTTGGATGTGTTCCCPolyubiquitin
ACACAATTGAGTTCAACAC
AAACCG

Primer Sequence used for RT-PCR validation.

Results

Overview of the Soybean Transcriptome

Transcriptome sequencing was performed on samples of COR and mock treated soybean leaves. A high proportion of clean reads (>96%) were obtained after filtration of the raw reads and more than 90% of the total reads had a quality value of 30, suggesting the sequencing reads were of high quality. Hierarchical Indexing for Spliced Alignment of Transcripts (HISAT) was used to align the filtered data to the reference genome, and the mapping result statistics are shown in Table 2 (Kim et al., 2015).

Table 2

SampleTotal readsaClean readsbClean reads Q30 (%)cTotal mapped readsdUniquely mappede
COR treat21,851,26721,013,001 (95.98%)90.3320,319,572 (96.7%)21,833,299 (72.26%)
H2O treat24,011,53123,048,199 (96.24%)90.3222,359,058 (97.01)16,348,088 (70.93%)

Data quality statistics of mapped and sequenced reads.

a

The number of raw reads obtained by RNA sequencing.

b

The number of reads after filtering low-quality reads (Q ≤ 15 bases), reads with high content of unknown base N and Joint contamination.

c

The number of reads with a read quality score >30.

d

The number of reads uniquely mapped to the reference genome.

e

Number of reads mapped to unique positions in the reference genome.

Gene expression based on fragments per kilobase per million mapped reads (FPKM), generated sequence information for 41,290 and 40,505 reference genes from the COR and mock samples, respectively. Most of the expressed genes were distributed between 10 and 100 FPKM (Table 3). Transcriptome sequencing analysis was carried out on soybean leaves from the COR and the mock groups. The overall transcriptome data analysis showed that the transcriptome sequencing data was of high quality and could meet the basic requirements necessary for downstream analysis.

Table 3

Sample0 < FPKMaFPKM ≤ 11 < FPKM ≤ 1010 < FPKM ≤ 100100 < FPKM
COR treatment40,50513,937 (33.824%)15,189 (39.828%)10,367 (24.102%)1,012 (2.245%)
Mock treatment41,29013,966 (34.408%)16,445 (37.499%)9,952 (25.594%)927 (2.498%)

Distribution of FPKM-quantified expression level of detected genes in COR and mock treated samples.

a

Fragment per kilobase per million reads.

Analysis of Differentially Expressed Genes

Our results showed that the COR-vs.-mock comparison yielded 4,531 DEGs. In order to summarize the results obtained from our analysis, and to make visualization of the regulatory patterns more intuitive, we have drawn a volcanic map (Figure 1). The volcano diagram clearly and intuitively shows the expression profile of differential genes in soybeans under different treatments. Although COR-treatment resulted in a greater number of down-regulated genes (2,370), most of the genes with large fold differences were up-regulated (2,161; Figure 1).

Figure 1

Gene Ontology Enrichment Analysis

The GO database was used to functionally annotate DEGs into the following three major categories: Biological process, Cellular component, and Molecular function. There were 4,545 significant DEGs between COR and mock treated samples. Twelve GO subclasses belonged to biological processes sub-category, 12 subclasses were found within the cellular components category while 9 subclasses were enriched in the molecular function category (Figure 2). Within the biological process category, cellular processes, and metabolic processes accounted for a relatively high proportion of hits. In the cell components category, cell, organelle, membrane, and membrane part were the four subclasses with higher percentage representation whereas within the molecular function category, binding, and catalytic activity were the two majorly represented subclasses.

Figure 2

KEGG Annotation of DEGs

The KEGG database integrates gene catalogs obtained from a completely sequenced genome with higher-level system functions at the cell, species, and ecosystem level. The integrative function of the database transforms the expressed gene data into gene networks. By mapping DEGs to the reference genes in the KEGG database, we identified 2,100 DEGs involved in 131 KEGG pathways. Enrichment analysis showed that KEGG enrichment with a Q-value < 0.05 was reliable, and on the basis of that threshold, a total of 30 KEGGs were found to be significantly enriched (Figure 3, Supplementary Table 3). The KEGG pathway with the largest number of enriched genes was related to “plant hormone signal transduction” (ko04075), with 181 genes annotated in this pathway. Although there were only 26 genes in the “Photosynthesis—antenna proteins” (ko00196) pathway, the enrichment factor reached 0.764, which was the highest of all annotated pathways. Analysis of the enriched KEGG pathway showed that the vast majority of KEGG genes belonged to the “metabolic branch” and were related to photosynthesis, hormone transduction, and secondary metabolism (Figure 3, Supplementary Table 3).

Figure 3

Chlorophyll and Photosynthesis Related Genes Were Down-Regulated by COR Treatment

Coronatine treatment resulted in the down-regulation of a large number of genes involved in chloroplast metabolism (Supplementary Table 3), indicating that COR had a significant influence on plant health. Chlorophyll a/b binding protein was significantly down-regulated, whereas genes related to magnesium removal, such as magnesium dechelatase, chlorophyllase, uroporphyrin-III C-methyltransferase, pheophorbidase, pheophorbide an oxygenase, and glucuronosyltransferase were significantly upregulated (Supplementary Table 3). Furthermore, COR induced the expression of chlorophyllase, an enzyme that degrades chlorophyll (Takamiya et al., 2000; Xie et al., 2008). In the three photosynthetic pathways: Photosynthesis-antenna proteins (ko00196), Carbon fixation in photosynthetic organisms (ko00710), Photosynthesis (ko00195), there were 129 genes with significant gene expression changes (Supplementary Table 1). Out of these, only 15 genes were up-regulated while 114 genes were down-regulated, indicating that photosynthesis was significantly downregulated upon COR treatment.

Genes Related to ROS Generation Were Upregulated in Response to COR Treatment

When plants are under biological stress, rapid generation of reactive oxygen species (ROS) can be observed (Wojakowska et al., 2013; Gao et al., 2017). While ROS cannot prevent the development of macroscopic symptoms, its production limits the invasiveness of pathogens (Zou et al., 2005). Reactive oxygen species strengthens cell walls through oxidative crosslinking of glycoproteins, and acts as a second messenger in some cell signaling pathways (Lamb and Dixon, 1997). However, ROS also exhibits potential toxicity as its increased accumulation can accelerate membrane lipid peroxidation (Mittler, 2002; Mittler et al., 2004). In order to increase their resistance to oxidative damage, plants require high levels of antioxidant enzymes (Sudhakar et al., 2001). The antioxidant enzymes or ROS scavengers can reduce ROS levels (Keppler and Baker, 1989). Various ROS scavengers, including ascorbic acid peroxidase (PER), glutathione, superoxide dismutase (SOD), and catalase (CAT) maintain ROS homeostasis in different compartments of plant cells (Mittler et al., 2004). Most of the enzymes involved in ROS detoxification, such as glutathione S-transferase (GST), CAT, PER, and glutathione reductase (GR), were up-regulated in COR treated samples, while SOD-related enzymes were down-regulated (Table 4).

Table 4

Gene IDLocus tagAnnotationLog2(COR/H2O)FDR
Glutathione reductase
LOC100787748GLYMA_12G188600Transcription factor LHW1.5743.77E-54
Catalase
LOC100037447GLYMA_14G223500Catalase1.6872.62E-233
Superoxide dismutase (sod)
LOC100778673GLYMA_20G050800Superoxide dismutase [Fe] 3, chloroplastic−1.2316257015.80E-09
LOC100784752GLYMA_12G081300Superoxide dismutase [Cu-Zn], chloroplastic−3.9841894851.35E-292
LOC100814802GLYMA_02G087700Superoxide dismutase [Fe], chloroplastic−1.1936811253.71E-13
LOC100815376GLYMA_11G192700Superoxide dismutase [Cu-Zn], chloroplastic−3.0660156980
Vegetable storage protein (vsp)
LOC100778379GLYMA_07G014600Stem 28 kDa glycoprotein1.9185423434.33675E-68
LOC102661443GLYMA_16G220900Acid phosphatase 12.3201676376.39352E-40
LOC547483GLYMA_03G001500Syringolide-induced protein B15-3-51.6063972211.49774E-25
LOC547669GLYMA_08G200200Acid phosphatase1.3660061464.70121E-80
LOC547820GLYMA_08G20010031 kDa protein4.9123872180
LOC547821GLYMA_07G01450028 kDa protein1.1474666770
Glutathione s-transferase (gst)
LOC100306196GLYMA_07G140200Tau class glutathione S-transferase1.2917661241.02E-27
LOC100527851GLYMA_07G139700Probable glutathione S-transferase3.6995542090
LOC100775492GLYMA_13G135600Glutathione S-transferase L3-like−1.1346715361.11E-14
LOC100807613GLYMA_07G139800Probable glutathione S-transferase3.7630460267.75E-292
LOC100808141GLYMA_07G139900Probable glutathione S-transferase3.4637489144.72E-63
LOC547576GLYMA_01G040200Glutathione S-transferase GST 5−1.3476949630
LOC547583PROVISIONALProbable glutathione S-transferase1.7750845364.89E-81
LOC547584GLYMA_10G192900Glutathione S-transferase GST 151.0870319936.91E-14
LOC547586GLYMA_20G101100Glutathione S-transferase GST 181.3073619820.000115395
LOC547925GLYMA_15G252200Lactoylglutathione lyase1.8975527314.66E-71
LOC547951GLYMA_14G031000Glutathione S-transf erase 241.9513032171.39E-252
Glucosinolate (gs)
LOC100785254GLYMA_11G197300Isoleucine N-monooxygenase 210.837004170
LOC100786887GLYMA_20G065100Isoleucine N-monooxygenase 110.1291710
LOC100787378GLYMA_11G197400Isoleucine N-monooxygenase 13.3504972470.000308612
LOC100787727GLYMA_03G031400Cytochrome P450 71A11.5435425732.26E-15
LOC100787855GLYMA_01G036000UDP-glycosyltransferase 74B12.0171473072.22E-30
LOC100796528GLYMA_03G029900Cytochrome P450 83B1-like2.4079058070
LOC100801312GLYMA_03G030800Cytochrome P450 83B11.3919686511.11E-11
LOC100805576GLYMA_03G030400Cytochrome P450 83B11.4689804746.77E-53
LOC100806069GLYMA_02G029900UDP-glycosyltransferase 74B12.9289169026.67E-06
LOC100806470GLYMA_U013600Cytochrome P450 83B11.4388392778.12E-31
LOC100809902GLYMA_13G051600Isoleucine N-monooxygenase 25.5269034630
LOC1026620472.8624964762.18E-05
Lipoxygenase (lox)
LOC100127399GLYMA_07G034800Lipoxygenase-92.0300883790
LOC100782973GLYMA_20G234000−1.4975737798.38E-43
LOC100786646GLYMA_11G130200Linoleate 13S-lipoxygenase 2-1, chloroplastic1.7241332990
LOC100791000GLYMA_16G008700Linoleate 13S-lipoxygenase 3-1, chloroplastic1.9548063410
LOC100795276GLYMA_13G030300Linoleate 13S-lipoxygenase 2-1, chloroplastic−1.4468193434.01E-76
LOC100797626GLYMA_12G054700Linoleate 13S-lipoxygenase 2-1, chloroplastic−1.105236952.67E-189
LOC100800451GLYMA_20G144600Linoleate 9S-lipoxygenase 51.2581820412.74E-22
LOC100802459GLYMA_07G034900Linoleate 9S-lipoxygenase 12.6061789871.93E-135
LOC100803358GLYMA_15G026400Linoleate 9S-lipoxygenase2.5581565130
LOC100814410GLYMA_08G102900Lipoxygenase 6, chloroplastic1.0604115173.25E-08
LOC547835GLYMA_07G007000Lipoxygenase1.0298176111.42E-35
LOC547836GLYMA_13G347700Lipoxygenase1.745069970
LOC547860GLYMA_13G347800Lipoxygenase2.7267348750
Chalcone synthase (chs)
LOC100775264GLYMA_19G105100Chalcone synthase 13−1.358414663.83E-66
LOC100777949GLYMA_11G001500Vacuolar-sorting receptor 11.8826605530
LOC100779649GLYMA_08G110700Chalcone synthase 4a1.8037089894.99E-25
LOC100789075GLYMA_08G110300Chalcone synthase 31.1675304865.39E-05
LOC100791524GLYMA_08G109300chalcone synthase 32.9836477951.16E-36
LOC100794652GLYMA_06G118500chalcone synthase−1.9794051323.27E-203
LOC100803958GLYMA_10G257300vacuolar-sorting receptor 11.0610129213.06E-66
LOC100804241GLYMA_15G242900Chalcone isomerase−1.9525132133.05E-30
LOC100820115GLYMA_01G242800Vacuolar-sorting receptor 11.6184508680
LOC106794283GLYMA_08G110900Chalcone synthase 32.3068387591.81E-28
LOC732546GLYMA_20G241700Chalcone–flavonone isomerase 2-A−1.3762450161.11E-05
LOC732575GLYMA_08G109400Chalcone synthase 13.0065337288.10E-165
LOC732649GLYMA_13G262500Chalcone isomerase 3A1−1.4950769971.94E-06
Phenylalanine ammonia lyase (pal)
LOC100787902GLYMA_03G181600Phenylalanine ammonia-lyase 11.6559132985.53E-87
LOC100803857GLYMA_13G145000Phenylalanine ammonia-lyase 2.31.5750015830
LOC100811101GLYMA_19G182300Phenylalanine ammonia-lyase 1.13.091864660
LOC100818777GLYMA_20G180800Phenylalanine ammonia-lyase 2.2−2.0170003531.09E-49

COR induced genes involved in the production of secondary metabolites.

COR Regulation of JA Biosynthesis and Related Hormone Pathways

Plant hormones not only play an essential role in growth and development, but they also contribute to how plants respond to both biotic and abiotic stressors. For instance, Jasmonate Acid (JA) modulates developmental as well as innate immune responses. Jasmonate Acid belongs to a small class of lipid-derived molecules and acts as a salicylic acid (SA) antagonist and an ethylene (ET) synergist (Gfeller et al., 2010). The first step in JA synthesis is accomplished by lipoxygenase (LOX)-catalyzed oxidation of linolenic acid (Vick and Zimmerman, 1984). In the JA synthesis pathway, 12 genes were up-regulated and only 2 genes were down-regulated. Among the genes encoding LOX, two genes were down-regulated, while five genes were up-regulated. In particular, the genes encoding allene oxide synthase (AOS) and allene oxide cyclase (AOC) were all up-regulated, suggesting that COR induced the activation of the JA biosynthetic pathway (Supplementary Table 2). Coronatine treatment also affected the expression of ethylene (ET) synthesis genes (Supplementary Table 2). In this study, a total of 14 DEGs involved in ethylene synthesis were identified, of which 13 genes were up-regulated and 1 gene was down-regulated (Supplementary Table 2), indicating that COR could promote ethylene biosynthesis.

COR Induced the Expression of Genes Involved in the Production of Stress Associated Proteins and Plant Secondary Metabolites

The accumulation of secondary metabolites constitutes an important component of plant stress response (Dixon et al., 2002). Some secondary metabolites play important defense roles during pathogen invasion (Erb and Kliebenstein, 2020). Vegetable Storage Protein (VSP) can be rapidly synthesized or degraded and plays an important role in the process of plant stress adaptation (Staswick et al., 1991). In our study VSP was up-regulated upon COR treatment (Table 4). Glucosinolates (GS) are also defense-related secondary metabolites, and related genes were also up-regulated in the presence of COR (Table 4). Coronatine also induced the expression of key enzymes in the phenylpropane pathway such as phenylalanineammonialyase (PAL), chalcone synthase (CHS), and phenylalanineammonialyase (PAL) (Table 4, Supplementary Table 3). These results suggest that COR may affect plant defense responses by regulating plant secondary metabolism, which is known to play important roles during plant pathogenesis.

qRT-PCR Validation of RNA-Seq Results

A total of 5 DEGs (GLYMA_18G057900, GLYMA_05G039900, GLYMA_17G023100, GLYMA_04G166900, and GLYMA_18G072200) identified through RNA-Seq analysis were selected for qRT-PCR verification. Our comparison results (Figure 4) showed that the relative expression levels of these genes in RNA-seq and qRT-PCR followed the same trend, suggesting that the results of RNA-seq were reliable.

Figure 4

Discussion

Bacterial COR has been shown to induce the activation of LOXs, which catalyze the synthesis of JA and MeJA. Through a positive feedback loop, JA can also activate LOXs and promote JA accumulation even further (Bell and Mullet, 1991). Both COR and JA induce ethylene biosynthesis (Czapski and Saniewski, 1992; Uppalapati et al., 2005) which plays an important role in the development of chlorotic symptoms associated with soybean speck disease (Lund et al., 1998). During plant–pathogen interactions, SA signaling activates resistance against biotrophic and hemi-biotrophic pathogens, whereas JA and ethylene (ET) activate resistance against necrotrophic pathogens while suppressing SA dependent signaling (Glazebrook, 2005). As bacteria expressing COR induce the production of JA and ET, we would expect a dampening of SA-dependent responses and enhanced growth of biotrophic pathogens. Coronatine-induced ethylene has also been shown to accelerate plant senescence and inhibit photosynthesis in a dose-dependent manner (Ueda and Kato, 1980; Stall and Hall, 1985; Kenyon and Turner, 1990; Bleecker and Kende, 2000; He et al., 2002; Uppalapati et al., 2005). Consistent with previous studies, we showed that in COR-treated soybean leaves, photosynthetic related genes were down-regulated, suggesting that COR is involved in inducing chlorotic symptoms through the inhibition of the photosynthetic machinery.

Reactive oxygen species generation is one of the initial responses to pathogen invasion (Lamb and Dixon, 1997). High levels of ROS are produced in plant cells undergoing stress. Superoxide anion (O2−), hydrogen peroxide (H2O2), and hydroxyl radical (OH) are the main forms of ROS produced during photosynthesis (Karpinski et al., 2003; Apel and Hirt, 2004). Pseudomonas syringae infection is reported to result in COR-induced decomposition of chlorophyll, which in turn promotes ROS production (Mur et al., 2010). As high level of ROS leads to cell toxicity (Mittler, 2002), its overproduction usually results in the generation of free radical scavenging enzymes. GST is one such enzyme, which is known to be involved in regulating redox potential of infected tissues (Zhang et al., 2015). Consistent with these findings, COR has been reported to cause GST mRNA accumulation 4–9 h after bacterial inoculation (Greulichi et al., 1995). However, not all antioxidant enzymes are up-regulated upon ROS generation. As some studies show that COR inhibits the expression of thylakoid-localized Cu/Zn SOD (Ishiga et al., 2009). These results may explain why we observed a down-regulation of SOD expression and an upregulation of GSTs upon COR treatment.

In Arabidopsis, COR also induces the expression of genes related to phenylpropane metabolism (Attaran et al., 2014). Flavonoids are secondary metabolites that are synthesized via the phenylpropane pathway and are involved in imparting resistance against necrotrophic pathogens. Lamb and Dixon (1997) proposed that the isoflavone phytoalexin pathway may also be the main participant involved in the modulation of oxidative stress responses (Lamb and Dixon, 1997; Winkel-Shirley, 2001). The up-regulation of PAL and CHS indicated that COR targets the phenylpropane metabolic pathway and promotes the synthesis of flavonoids which in turn induce the production of ROS-scavenging enzymes. Of note, ROS scavengers may be beneficial to the host as well as the pathogen. To increase the resistance to oxidative damage induced upon bacterial infection and to improve plant health, plants need high levels of these antioxidants. However, COR can inhibit the early onset of pathogen-associated molecular patterns (PAMP)-triggered immunity (PTI) and induce disease-related necrotic cell death at later stages of disease progression. While COR has not been shown to function as a ROS scavenger, tomato plants infected with COR-producing bacterial strains have reduced ROS levels through the activity of ROS scavenging enzymes (Ishiga et al., 2009). It is therefore not surprising that most ROS scavenger-related genes were up-regulated in our study.

In addition to ROS scavengers, we focused on other genes that were specifically regulated by COR. These included the vegetative storage proteins (VSP) and glucosinolate (GS). Vegetative storage proteins is known to be upregulated during insect herbivory and is specifically induced by JA (Benedetti et al., 1995). Other plant hormones below a certain concentration threshold do not modulate VSP levels in plant cells (Anderson et al., 1989). In Arabidopsis, VSP expression was not detected in the Arabidopsis coi1 mutant seedlings, and VSP in wild-type Arabidopsis seedlings was induced upon MeJA and COR treatments (Benedetti et al., 1995). Thioglucoside and its hydrolyzed metabolites are involved in multiple functions including antioxidant activity, chemical protection, and resistance to biotic and abiotic stressors (Guo et al., 2013). The ability of coi1 mutants to induce indole-GS through MeJA was severely impaired, suggesting that COI1 plays a positive role in inducing GS production (Mewis et al., 2006; Brader et al., 2007). It is worth noting that GS, VSP, and ethylene expression can be induced by both COR and JA, indicating that these genes may be induced by COR and JA in a similar manner. Interestingly, the ability of COR to induce chlorosis is also achieved through COI1 (Mecey et al., 2011). The above results indicate that COI1 plays a major role in the regulation of COR-induced responses in plants.

The phytotoxin COR plays an important role in promoting the pathogenicity of bacteria, and the virulent activity of bacteria lacking COR is significantly reduced (Geng et al., 2014). Our results showed that COR induced the expression of genes related to JA and ethylene synthesis, suggesting that COR may activate these two hormone pathways to regulate plant defenses. Coronatine also induced expression of Phenylalanine ammonia lyase (PAL), which is the key enzyme involved in the production of phenylpropane metabolites in plants. This indicated that COR could dampen plant defenses through perturbing phenylpropane metabolism. Our comprehensive transcriptional analysis of the interaction between COR and soybean through RNA-Seq would help better understand the non-host resistance (NHR) response in plants and would also provide a theoretical basis for the improvement of soybean resistance against non-adapted pathogens.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Author contributions

XZ, BH, and XG designed the research strategy and analyzed the sequenced data. SS, ZZ, and TL conducted part of experiments. XZ, AJA, and XG wrote the manuscript. HW, ZL analyzed part of data. All authors contributed to the article and approved the submitted version.

Funding

This work was funded by Shanghai international scientific and technological cooperation foundation (No. 19390743400) and the key R&D and transformation program of Xining city (CN) (No. 2019-y-35).

Acknowledgments

We would like to thank Huada gene institution in China for providing technical assistance with bioinformatics analysis.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fsufs.2021.663238/full#supplementary-material

References

  • 1

    AndersS.HuberW. (2010). Differential expression analysis for sequence count data. Genome Biol.11, 112. 10.1186/gb-2010-11-10-r106

  • 2

    AndersonJ. M.SpilatroS. R.KlauerS. F.FranceschiV. R. (1989). Jasmonic acid-dependent increase in the level of vegetative storage proteins in soybean. Plant Sci.62, 4552. 10.1016/0168-9452(89)90188-X

  • 3

    ApelK.HirtH. (2004). Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol.55, 373399. 10.1146/annurev.arplant.55.031903.141701

  • 4

    AttaranE.MajorI. T.CruzJ. A.RosaB. A.KooA. J.ChenJ.et al. (2014). Temporal dynamics of growth and photosynthesis suppression in response to jasmonate signaling. Plant Physiol.165, 13021314. 10.1104/pp.114.239004

  • 5

    BellE.MulletJ. E. (1991). Lipoxygenase gene expression is modulated in plants by water deficit, wounding, and methyl jasmonate. Mol. Gen. Genet.230, 456462. 10.1007/BF00280303

  • 6

    BenderC. L.AlarconchaidezF.GrossD. C. (1999). Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol. Mol. Biol. Rev.63, 266292. 10.1128/MMBR.63.2.266-292.1999

  • 7

    BenedettiC. E.XieD.TurnerJ. G. (1995). COI1-dependent expression of an Arabidopsis vegetative storage protein in flowers and siliques and in response to coronatine or methyl jasmonate. Plant Physiol.109, 567572. 10.1104/pp.109.2.567

  • 8

    BleeckerA. B.KendeH. (2000). Ethylene: a gaseous signal molecule in plants. Annu. Rev. Cell Dev. Biol.16, 118. 10.1146/annurev.cellbio.16.1.1

  • 9

    BraderG.DjameiA.TeigeM.PalvaE. T.HirtH. (2007). The MAP kinase kinase MKK2 affects disease resistance in Arabidopsis. Mol. Plant Microbe Interact.20, 589596. 10.1094/MPMI-20-5-0589

  • 10

    BrooksD. M.Hernández-GuzmánG.KloekA. P.Alarcón-ChaidezF.SreedharanA.RangaswamyV.et al. (2004). Identification and characterization of a well-defined series of coronatine biosynthetic mutants of Pseudomonas syringae pv. tomato DC3000. Mol. Plant Microbe Interact.17, 162174. 10.1094/MPMI.2004.17.2.162

  • 11

    CzapskiJ.SaniewskiM. (1992). Stimulation of ethylene production and ethylene-forming enzyme activity in fruits of the non-ripening nor and rin tomato mutants by methyl jasmonate. J. Plant Physiol.139, 265268. 10.1016/S0176-1617(11)80334-2

  • 12

    DixonD. P.LapthornA.EdwardsR. (2002). Plant glutathione transferases. Genome Biol.3:reviews3004. 10.1186/gb-2002-3-3-reviews3004

  • 13

    ErbM.KliebensteinD. J. (2020). Plant secondary metabolites as defenses, regulators, and primary metabolites: the blurred functional trichotomy. Plant Physiol.184, 3952. 10.1104/pp.20.00433

  • 14

    FergusonI.MitchellR. (1985). Stimulation of ethylene production in bean leaf discs by the pseudomonad phytotoxin coronatine. Plant Physiol.77, 969973. 10.1104/pp.77.4.969

  • 15

    FeysB. J.BenedettiC. E.PenfoldC. N.TurnerJ. G. (1994). Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell6, 751759. 10.2307/3869877

  • 16

    GalánJ. E. (2009). Common themes in the design and function of bacterial effectors. Cell Host Microbe5, 571579. 10.1016/j.chom.2009.04.008

  • 17

    GaoJ.-X.YuC.-J.WangM.SunJ.-N.LiY.-Q.ChenJ. (2017). Involvement of a velvet protein ClVelB in the regulation of vegetative differentiation, oxidative stress response, secondary metabolism, and virulence in Curvularia lunata. Sci. Rep.7, 113. 10.1038/srep46054

  • 18

    GaoS.LiY.GaoJ.SuoY.FuK.LiY.et al. (2014). Genome sequence and virulence variation-related transcriptome profiles of Curvularia lunata, an important maize pathogenic fungus. BMC Genomics15:627. 10.1186/1471-2164-15-627

  • 19

    GengX.ChengJ.GangadharanA.MackeyD. (2012). The coronatine toxin of Pseudomonas syringae is a multifunctional suppressor of Arabidopsis defense. Plant Cell24, 47634774. 10.1105/tpc.112.105312

  • 20

    GengX.JinL.ShimadaM.KimM. G.MackeyD. (2014). The phytotoxin coronatine is a multifunctional component of the virulence armament of Pseudomonas syringae. Planta240, 11491165. 10.1007/s00425-014-2151-x

  • 21

    GfellerA.LiechtiR.FarmerE. E. (2010). Arabidopsis jasmonate signaling pathway. Sci. Signal.3:cm4. 10.1126/scisignal.3109cm4

  • 22

    GlazebrookJ. (2005). Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol.43, 205227. 10.1146/annurev.phyto.43.040204.135923

  • 23

    GreulichiF.YoshiharaT.IchiharaA. (1995). Coronatine, a bacterial phytotoxin, acts as a stereospecific analog of jasmonate type signals in tomato cells and potato tissues. J. Plant Physiol.147, 359366. 10.1016/S0176-1617(11)82168-1

  • 24

    GuoR.ShenW.QianH.ZhangM.LiuL.WangQ. (2013). Jasmonic acid and glucose synergistically modulate the accumulation of glucosinolates in Arabidopsis thaliana. J. Exp. Bot.64, 57075719. 10.1093/jxb/ert348

  • 25

    HeY.FukushigeH.HildebrandD. F.GanS. (2002). Evidence supporting a role of jasmonic acid in Arabidopsis leaf senescence. Plant Physiol.128, 876884. 10.1104/pp.010843

  • 26

    IshigaY.UppalapatiS. R.IshigaT.ElavarthiS.MartinB.BenderC. L. (2009). Involvement of coronatine-inducible reactive oxygen species in bacterial speck disease of tomato. Plant Signal. Behav.4, 237239. 10.4161/psb.4.3.7915

  • 27

    KarpinskiS.GabrysH.MateoA.KarpinskaB.MullineauxP. M. (2003). Light perception in plant disease defence signalling. Curr. Opin. Plant Biol.6, 390396. 10.1016/S1369-5266(03)00061-X

  • 28

    KatsirL.SchilmillerA. L.StaswickP. E.HeS. Y.HoweG. A. (2008). COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc. Natl. Acad. Sci. U.S.A.105, 71007105. 10.1073/pnas.0802332105

  • 29

    KeenN.BuzzellR. (1991). New disease resistance genes in soybean against Pseudomonas syringae pv glycinea: evidence that one of them interacts with a bacterial elicitor. Theor. Appl. Genet.81, 133138. 10.1007/BF00226123

  • 30

    KenyonJ.TurnerJ. (1990). Physiological changes in Nicotiana tabacum leaves during development of chlorosis caused by coronatine. Physiol. Mol. Plant Pathol.37, 463477. 10.1016/0885-5765(90)90037-X

  • 31

    KenyonJ. S.TurnerJ. G. (1992). The stimulation of ethylene synthesis in Nicotiana tabacum leaves by the phytotoxin coronatine. Plant Physiol.100, 219224. 10.1104/pp.100.1.219

  • 32

    KepplerL. D.BakerC. J. (1989). O2-initiated lipid peroxidation in a bacteria-induced hypersensitive reaction in tobacco cell suspensions. Phytopathology79, 555562. 10.1094/phyto-79-555

  • 33

    KimD.LangmeadB.SalzbergS. L. (2015). HISAT: a fast spliced aligner with low memory requirements. Nat. Methods12, 357360. 10.1038/nmeth.3317

  • 34

    LambC.DixonR. A. (1997). The oxidative burst in plant disease resistance. Annu. Rev. Plant Biol.48, 251275. 10.1146/annurev.arplant.48.1.251

  • 35

    LundS. T.StallR. E.KleeH. J. (1998). Ethylene regulates the susceptible response to pathogen infection in tomato. Plant Cell10, 371382. 10.2307/3870595

  • 36

    MeceyC.HauckP.TrappM.PumplinN.PlovanichA.YaoJ.et al. (2011). A critical role of STAYGREEN/Mendel's I locus in controlling disease symptom development during Pseudomonas syringae pv tomato infection of Arabidopsis. Plant Physiol.157, 19651974. 10.1104/pp.111.181826

  • 37

    MewisI.TokuhisaJ. G.SchultzJ. C.AppelH. M.UlrichsC.GershenzonJ. (2006). Gene expression and glucosinolate accumulation in Arabidopsis thaliana in response to generalist and specialist herbivores of different feeding guilds and the role of defense signaling pathways. Phytochemistry67, 24502462. 10.1016/j.phytochem.2006.09.004

  • 38

    MittlerR. (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci7, 405410. 10.1016/S1360-1385(02)02312-9

  • 39

    MittlerR.VanderauweraS.GolleryM.Van BreusegemF. (2004). Reactive oxygen gene network of plants. Trends Plant Sci.9, 490498. 10.1016/j.tplants.2004.08.009

  • 40

    MurL. A. J.AubryS.MondheM.KingstonsmithA. H.GallagherJ.TimmstaravellaE.et al. (2010). Accumulation of chlorophyll catabolites photosensitizes the hypersensitive response elicited by Pseudomonas syringae in Arabidopsis. New Phytol.188, 161174. 10.1111/j.1469-8137.2010.03377.x

  • 41

    PalmerD.BenderC. (1995). Utrastructure of tomato leaf tissue treated with the pseudomonad phytotoxin coronatine and comparison with methyl jasmonate. Mol. Plant Microbe Interact. 8, 683692. 10.1094/MPMI-8-0683

  • 42

    RioD. C.AresM.HannonG. J.NilsenT. W. (2010). Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb. Protoc.2010:pdb.prot5439. 10.1101/pdb.prot5439

  • 43

    StallR.HallC. (1985). Chlorosis and ethylene production in pepper leaves infected by Xanthomonas campestris pv. vesicatoria. Phytopathology74, 373375.

  • 44

    StaswickP. E.HuangJ.-F.RheeY. (1991). Nitrogen and methyl jasmonate induction of soybean vegetative storage protein genes. Plant Physiol.96, 130136. 10.1104/pp.96.1.130

  • 45

    SudhakarC.LakshmiA.GiridarakumarS. (2001). Changes in the antioxidant enzyme efficacy in two high yielding genotypes of mulberry (Morus alba L.) under NaCl salinity. Plant Sci.161, 613619. 10.1016/S0168-9452(01)00450-2

  • 46

    TakamiyaK.-I.TsuchiyaT.OhtaH. (2000). Degradation pathway (s) of chlorophyll: what has gene cloning revealed?Trends Plant Sci.5, 426431. 10.1016/S1360-1385(00)01735-0

  • 47

    UedaJ.KatoJ. (1980). Isolation and identification of a senescence-promoting substance from wormwood (Artemisia absinthium L.). Plant Physiol.66, 246249. 10.1104/pp.66.2.246

  • 48

    UppalapatiS. R.AyoubiP.WengH.PalmerD. A.MitchellR. E.JonesW.et al. (2005). The phytotoxin coronatine and methyl jasmonate impact multiple phytohormone pathways in tomato. Plant J.42, 201217. 10.1111/j.1365-313X.2005.02366.x

  • 49

    VickB. A.ZimmermanD. C. (1984). Biosynthesis of jasmonic acid by several plant species. Plant Physiol.75, 458461. 10.1104/pp.75.2.458

  • 50

    Winkel-ShirleyB. (2001). Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol.126, 485493. 10.1104/pp.126.2.485

  • 51

    WojakowskaA.MuthD.NaroznaD.MadrzakC.StobieckiM.KachlickiP. (2013). Changes of phenolic secondary metabolite profiles in the reaction of narrow leaf lupin (Lupinus angustifolius) plants to infections with Colletotrichum lupini fungus or treatment with its toxin. Metabolomics9, 575589. 10.1007/s11306-012-0475-8

  • 52

    WratherJ. A.AndersonT.ArsyadD.GaiJ.PloperL.Porta-PugliaA.et al. (1997). Soybean disease loss estimates for the top 10 soybean producing countries in 1994. Plant Dis.81, 107110. 10.1094/PDIS.1997.81.1.107

  • 53

    XieZ.DuanL.TianX.WangB.EnejiA. E.LiZ. (2008). Coronatine alleviates salinity stress in cotton by improving the antioxidative defense system and radical-scavenging activity. J. Plant Physiol.165, 375384. 10.1016/j.jplph.2007.06.001

  • 54

    YuC.FanL.WuQ.FuK.GaoS.WangM.et al. (2014). Biological role of Trichoderma harzianum-derived platelet-activating factor acetylhydrolase (PAF-AH) on stress response and antagonism. PLoS ONE9:e100367. 10.1371/journal.pone.0100367

  • 55

    ZhangZ.ZhangX.HuZ.WangS.ZhangJ.WangX.et al. (2015). Lack of K-dependent oxidative stress in cotton roots following coronatine-induced ROS accumulation. PLoS ONE10:e0126476. 10.1371/journal.pone.0126476

  • 56

    ZhaoY.JonesW.SutherlandP.PalmerD.MitchellR.ReynoldsP.et al. (2001). Detection of the phytotoxin coronatine by ELISA and localization in infected plant tissue. Physiol. Mol. Plant Pathol.58, 247258. 10.1006/pmpp.2001.0334

  • 57

    ZhengX. Y.SpiveyN. W.ZengW.LiuP. P.FuZ. Q.KlessigD. F.et al. (2012). Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host Microbe11, 587596. 10.1016/j.chom.2012.04.014

  • 58

    ZouJ.Rodriguez-ZasS.AldeaM.LiM.ZhuJ.GonzalezD. O.et al. (2005). Expression profiling soybean response to Pseudomonas syringae reveals new defense-related genes and rapid HR-specific downregulation of photosynthesis. Mol. Plant Microbe Interact.18, 11611174. 10.1094/MPMI-18-1161

Summary

Keywords

soybean, Pseudomonas syringae, coronatine, RNA-Seq, differentially expressed genes

Citation

Zhang X, He B, Sun S, Zhang Z, Li T, Wang H, Liu Z, Afzal AJ and Geng X (2021) Transcriptome Analysis Identified Gene Regulation Networks in Soybean Leaves Perturbed by the Coronatine Toxin. Front. Sustain. Food Syst. 5:663238. doi: 10.3389/fsufs.2021.663238

Received

02 February 2021

Accepted

18 March 2021

Published

19 April 2021

Volume

5 - 2021

Edited by

Wei Li, Chinese Academy of Agricultural Sciences, China

Reviewed by

Gang Wei, Fudan University, China; Jinxin Gao, New York University, United States; Songbiao Chen, Minjiang University, China

Updates

Copyright

*Correspondence: Xueqing Geng

This article was submitted to Agroecology and Ecosystem Services, a section of the journal Frontiers in Sustainable Food Systems

†These authors have contributed equally to this work and share first authorship

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics