Abstract
The quantitative measurement of environmental DNA (eDNA) from field-collected water samples is gaining importance for the monitoring of fish communities and populations. The interpretation of these signal strengths depends, among other factors, on the amount of target eDNA shed into the water. However, shedding rates are presumably associated with species-specific traits such as physiology and behavior. Although such differences between juvenile and adult fish have been previously detected, the general impact of movement and energy use in a resting state on eDNA release into the surrounding water remains hardly addressed. In an aquarium experiment, we compared eDNA shedding between seven fish species occurring in European freshwaters. The investigated salmonids, cyprinids, and sculpin exhibit distinct adaptions to microhabitats, diets, and either solitary or schooling behavior. The fish were housed in aquaria with constant water flow and their activity was measured by snapshots taken every 30 s. Water samples for eDNA analysis were taken every 3 h and energy use was determined in an intermittent flow respirometer. After controlling for the effect of fish mass, our results demonstrate a positive correlation between target eDNA quantities as measured with digital PCR, fish activity, and energy use, as well as species-specific differences. For cyprinids, the model based on data from individual fish was only partly transferable to groups, which showed lower activity and higher energy use. Our findings highlight the importance of fish physiology and behavior for the comparative interpretation of taxon-specific eDNA quantities. Species traits should therefore be incorporated into eDNA-based monitoring and conservation efforts.
Introduction
The sensitivity, non-invasiveness, and cost-efficiency of environmental DNA (eDNA) based methods have been proven for diverse habitats and species making them powerful new tools for conservation biology and biodiversity assessments (; ; ). Regarding the detection of fish species, eDNA-based monitoring outperforms traditional methods such as electrofishing: for example, for the detection of the endangered European weather loach, Misgurnus fossilis (Sigsgaard et al., 2015), the assessment of fish communities in Australian streams (), and the distribution of brook trout, Salvelinus fontinalis in a US watershed (). The manifold successes of eDNA-based species detection lead to a call for more standardization and better reporting practices (; ; Thalinger et al., 2021a) and to an international effort for implementing the technology into routine species monitoring (; ). Although reporting the presence/absence of particular species is the starting point of these endeavors, a more quantitative interpretation of field-derived eDNA data is key for the general application of this technology.
Different processes influence the distribution of eDNA in space and time and the detection probabilities of species from environmental samples, namely the origin, degradation, suspension, resuspension, and transport of eDNA (; ). The latter processes are directly linked to local hydrology [e.g., flow and substrate type (Shogren et al., 2017; ; Thalinger et al., 2021b)] and environmental conditions [e.g., water temperature, pH, UV-radiation (Strickler et al., 2015; ; Tsuji et al., 2017)]. The amount of eDNA in the water column is directly linked to fish biomass and originally, this was confirmed for common carp (Cyprinus carpio) in an aquarium trial and in experimental ponds (Takahara et al., 2012). In subsequent experiments, the positive relationship was confirmed for a range of freshwater and marine fish species (; ; Sassoubre et al., 2016; ; ). However, these results were primarily obtained for individuals at the same life stage.
Environmental DNA is released into the environment in the form of mucus, feces, scales, and gametes (; ; Sassoubre et al., 2016; ). Under natural conditions, differences in fish physiology, diet, and behavior are likely to affect this process and confound the interpretation of eDNA-based results from a water body (). For perch and eel, and Takeuchi et al. (2019), respectively, found lower mass-specific eDNA shedding rates for adults in comparison to juveniles, which is likely caused by the scaling in metabolic rates, excretion rates, and surface area with body mass (discussed in Yates et al., 2020). However, these findings could not be confirmed in another experiment with a salmonid species (). In general, the metabolic rate and activity differ between fish species due to distinct physiology and behavior with pelagic species being more active and displaying higher resting metabolic rates than benthic species (; ). A stress response characterized by elevated metabolism and activity is frequently hypothesized as underlying cause for spiking eDNA levels at the beginning of aquarium experiments. Furthermore, metabolism and activity could generally explain mismatching quantitative results in studies comparing eDNA levels between species in the same water body (Takahara et al., 2012; ; ).
Here, we investigate the effect of fish activity (i.e., movement), energy use (i.e., oxygen use × oxycaloric factor), and species identity in an aquarium experiment with seven fish species commonly occurring in European rivers and streams (Figure 1). We hypothesized that higher activity leads to higher eDNA concentrations as there is more shearing between the fish surface and the surrounding water, and higher volumes are pumped through the gills due to the elevated oxygen demand. Independent of activity, fish species with higher energy use in a resting state potentially also emit more eDNA. Additionally, the species-specific composition of the constantly renewed cutaneous mucus layer () might lead to differences between individual taxa.
FIGURE 1
Materials and Methods
Study Species
The examined species comprised four salmonids (Salmo trutta, S. fontinalis, Oncorhynchus mykiss, and Thymallus thymallus), two cyprinids (Phoxinus phoxinus and Squalius cephalus), and one sculpin (Cottus gobio;Figure 1). S. trutta is a rhithral species, territorial especially in later life stages, and primarily feeds on benthic organisms and insect drift on the surface. S. fontinalis and O. mykiss were anthropogenically introduced into European freshwaters and are less territorial than S. trutta (
Experimental Setup
The aquarium experiment was carried out between March 2, 2017 and July 17, 2017 at the Research Department for Limnology, Mondsee of the University of Innsbruck, Austria. The juvenile salmonid individuals were purchased from commercial hatcheries, P. phoxinus and S. cephalus were caught with permission in Lake Mondsee and C. gobio were caught with permission in rivers in Tyrol (Austria). Fish individual sizes were chosen as similar as possible within and between species. As P. phoxinus and C. gobio are smaller in comparison to the other species (Figure 1), these individuals were supposedly closer to reproductive maturity. Until the start of the experiment, the fish species were kept separately in aquaria fed with lake water.
In accordance with the regulations of the Austrian Animal Experiment Act (December 28, 2012) (Tierversuchsrechtsänderungsgesetz, part 1, section 1, §1, and point 2), and with the Directive 2010/63/EU of the European Parliament and of the Council of the European Union (September 22, 2010) on the protection of animals used for scientific purposes (chapter 1, article 1, and point 5a), all fish were reared according to regular agriculture (aquaculture) practice, including the provision of appropriate tank size, sufficient rate of waterflow, natural photoperiod, ad libitum food supply, and temperatures within the species’ thermal tolerance range. This ensured that no pain, suffering, distress or lasting harm was inflicted on the animals, confirmed by the fact that mortality rates were low and equal between rearing groups. Based on the legislative provisions above, no ethics approval and no IACUC protocol was required for the experiments performed. In particular, the respirometry experiments were discussed with the legislative authorities (Austrian Federal Ministry of Education, Science and Research and the University of Veterinary Medicine, Vienna) and the conclusion was that the assessment of basic metabolism under these conditions (small fish sizes in relatively large chambers) does not incur pain, suffering or distress to the fish and no formal animal experimentation protocol was required.
Five aquaria (60 l) and corresponding plastic lids were used in the experiment, which were thoroughly cleaned with sodium hypochlorite (5%) and then rinsed with tap water (fish-DNA-free) prior to each experimental run (i.e., changing the fish under investigation). The flow-through rate for the tap-water fed aquaria was set to 5.45 l/min to mimic natural conditions and keep eDNA concentrations in the fish tanks constant based on the results of previous test runs (Supplementary Material 1). The water temperature in the aquaria was stabilized at 15°C by centrally heating the inflowing water to this temperature. Each tank was further equipped with an air-stone to ensure water mixing. At the start of each experimental run, a water sample (negative control) was taken from one of the aquaria and processed as described below. Then, five fish individuals per species were selected aiming at similar size. Each fish was placed individually in an aquarium using DNA-free fishnets (Figure 2). For P. phoxinus and S. cephalus, the experiment was carried out twice: once with individual fish, and once with groups of three fish per aquarium. The day before the experiment and for its duration, the respective fish were not fed to avoid contamination by fish feed and minimize the effects of defecation. Each run started with 1 day of familiarization.
FIGURE 2

The setup of the aquarium experiment carried out with seven fish species: five individual fish were put in fish tanks for water sampling (eDNA) and activity recordings (days 1 and 2) followed by respirometer measurements (three individuals on days 3 and 4; two individuals plus empty control chamber on days 5 and 6). For Phoxinus phoxinus and Squalius cephalus the experiment was repeated using groups of three individuals per tank and respirometer chamber.
Water Sampling, Filtration, and pH Measurements
All equipment used for this process was cleaned with sodium hypochlorite (5%) and rinsed with tap water prior to each use; DNA-free gloves were always worn. On the second day, 2 l water samples were taken every 3 h from 9:00 AM to 12:00 AM (six samples) at the back end of each aquarium (opposite to the inflow) using flexible tubes and 2 l wide neck bottles (Figure 2). Due to the high flow rates (entire water volume replaced every 11 min), the water level in each aquarium self-adjusted automatically after every sampling. The water samples were immediately filtered in an adjacent laboratory using glass microfiber filters (1.2 μm pore width, 47 mm diameter, Whatman GF/C) and one negative control (2 l MilliQ-water) was included per sampling event. Thereafter, the filters were individually placed in 2 ml reaction tubes and stored at –28°C until further processing in a special diagnostic molecular laboratory at the Department of Zoology, University of Innsbruck (Austria). After each sampling, pH was measured in three arbitrarily selected aquaria using a Hach HQ40 device.
Activity Measurement
During the familiarization time (day 1) and between water samplings, fish swimming activity was quantified using a custom-made activity monitoring system consisting of one high-definition USB camera (Ziggi HD Plus, IPEVO.COM) per aquarium. The cameras were placed at the front of each tank and the focus was set toward the back end (Figure 2). To enable recordings during the night, aquaria were lighted throughout the two recording days. Additionally, white polystyrene plates were used to cover the bottom and the sides to exclude influences from neighboring aquaria and standardize reflections. The signals from the cameras were acquired with a frame rate of 2 frames per minute (fpm) with a macro using the image analysis software FIJI1 (a distribution of ImageJ) for MacOS (Schindelin et al., 2012;
Respirometry
A custom-made intermittent-flow respirometer was used (
Filter Processing and Molecular Analysis
After defrosting, each filter was soaked with 200 μl of lysis buffer consisting of TES-buffer (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulfate; pH 8) and proteinase K (20 mg/ml) in a ratio of 19:1 and incubated at 56°C over night in a rocking platform. On the next day, filters were transferred with DNA-free forceps to a perforated inset which was repositioned in the top half of the original 2 ml reaction tube and centrifuged for 10 min at 20,000 g. Afterward, filters were discarded and the lysate at the bottom of the reaction tube (300–800 μl) was used for DNA extraction. Insets were cleaned in sodium hypochlorite (2.5%) for at least 30 min, thoroughly washed with MilliQ-water (10 wash steps) and reused.
DNA extraction was carried out with the Biosprint 96 instrument (Qiagen) using the Biosprint 96 DNA blood Kit (Qiagen) and the Biosprint 96 tissue extraction protocol following the manufacturer’s instructions except for using 100 μl of TE-buffer instead of AE-buffer for DNA elution. Extractions were carried out in 96-well plates and four negative controls (containing TES-buffer instead of lysate) were included per plate. To process the whole lysate volume, a custom DNA-uptake program was set up: three uptake plates were used and 300 μl of lysate, 300 μl AL-buffer and 300 μl isopropanol were mixed per well in each plate. Missing lysate volumes (i.e., if only a total of 400 μl were available after centrifugation) were replaced by TES-buffer. Additionally, 30 μl MagAttract was added per well in the first plate. Using custom “binding” steps of the robotic platform, the DNA contained in the first plate was transferred to the second one. Next, a binding step was carried out in the second plate before transferring and releasing the entire collected DNA into the third plate, which was then used for the Biosprint 96 tissue extraction protocol. After extraction, each eluate was transferred to a 1.5 μl reaction tube for subsequent PCR.
All used primers (Table 1) have been previously published after extensive specificity and sensitivity testing (Thalinger et al., 2016, 2021b) and additional specificity tests were carried out on the digital PCR (dPCR) system (see below) confirming the specificity of the molecular assays under the following conditions: each 22 μl dPCR master mix for droplet generation on the QX200 AutoDG (Biorad) consisted of one-time EvaGreen Supermix (Biorad), 0.25 μM forward and reverse primer (Table 1) and up to 10.5 μl DNA extract. Depending on the results of initial tests with capillary electrophoresis PCR (i.e., the Relative Fluorescence Units (RFU) of the resulting band; see Supplementary Material 3), extracts were diluted with molecular grade water for dPCR as follows: RFU < 0.2: undiluted; 0.2 ≤ RFU < 1.3: 1:1 dilution; 1.3 ≤ RFU < 2: 1:3 dilution; 2 ≤ RFU: 1:7 dilution. Optimized thermo-cycling conditions were 5 min at 95°C, 40 cycles of 30 s at 95°C, 1 min at 58°C (O. mykiss, P. phoxinus, and S. cephalus), or 60°C (C. gobio, S. fontinalis, S. trutta, and T. thymallus), 1 min at 72°C, followed by one step of 5 min at 4°C and 5 min at 90°C. dPCR results were analyzed on the QX200 Droplet Reader with the corresponding QuantaSoftTM Analysis Pro Software (Version 1.7; Biorad). As target signal amplitude varied with the length of the amplified fragment, amplitude thresholds were set individually per primer pair (Table 1) prior to determining target copy numbers per μl for each DNA extract. Each sample was subjected to dPCR once, based on previous studies indicating a high precision of dPCR for low target DNA concentrations (e.g.,
TABLE 1
| Target taxon | Primer name | Primer sequence (5′ – 3′) | Primer conc. in dPCR (μM) | Target gene | Fragment length (bp) | Amplitude threshold (dPCR) | Source |
| Cottus gobio | Cot-gob-S632 | GAATAAAGGACTAAACCAAGTGGG | 0.25 | 16S | 118 | 13,500 | Thalinger et al., 2016 |
| Cot-gob-A641 | GCTGTAGCTCTCAGTTGTAGGAAAA | 0.25 | |||||
| Salmo trutta | Sal-tru-S1002 | TCTCTTGATTCGGGCAGAACTC | 0.25 | COI | 89 | 8,400 | Thalinger et al., 2021b |
| Sal-tru-A1002 | CGAAGGCATGGGCTGTAACA | 0.25 | |||||
| Oncorhynchus mykiss | Onc-myk-S655 | TCTCCCTTCATTTAGCTGGAATC | 0.25 | COI | 82 | 12,500 | Thalinger et al., 2016 |
| Onc-myk-S655 | GCTGGAGGTTTTATGTTAATAATGGTC | 0.25 | |||||
| Salvelinus spp. | Sal-vel-S651 | ATAGTCGGCACCGCCCTT | 0.25 | COI | 112 | 14,000 | Thalinger et al., 2016 |
| Sal-vel-A651 | TAACGAAGGCATGGGCTGTT | 0.25 | |||||
| Thymallus thymallus | Thy-thy-S653 | ATCAAATTTATAATGTGATCGTCACG | 0.25 | COI | 179 | 14,000 | Thalinger et al., 2016 |
| Thy-thy-A653 | AAGAAAGGACGGGGGAAGC | 0.25 | |||||
| Phoxinus phoxinus | Pho-pho-S639 | CGTGCAGAAGCGGATATAAATAC | 0.25 | 16S | 128 | 15,750 | Thalinger et al., 2016 |
| Pho-pho-A648 | CCAACCGAAGGTAAAGTCTTATTG | 0.25 | |||||
| Squalius cephalus | Squ-cep-S669 | CAGTATACCCACCGCTTGCG | 0.25 | COI | 130 | 14,250 | Thalinger et al., 2016 |
| Squ-cep-A669 | TTAATAATTGTGGTAATGAAGTTGACC | 0.25 |
Digital PCR assays used to amplify fish eDNA.
Columns denote the target taxon of each primer combination, primer names, sequences, their respective concentration in dPCR, target gene, amplicon sizes, and threshold values for positive droplets in dPCR. Additionally, the source column shows the original publication. Please note that the Salvelinus spp. primer pair was designed to amplify both S. fontinalis and Salvelinus umbla.
Statistical Analysis
All calculations and visualizations were carried out in R Version 4.0.2 (
The cleared activity dataset was visually inspected and summarized for each time step: for example, data obtained during the preceding day were associated with the first eDNA sampling event at 9:00 AM and measurements between 9:00 AM and 12:00 PM were considered relevant for the second water sampling at 12:00 PM. Mean activity was calculated per time interval. No cleared activity data was available for one S. trutta and S. fontinalis individual, respectively, and for one P. phoxinus and T. thymallus individual at a single time step each.
The total respirometry dataset was cleared of all 15 min measurement series showing an increase in dissolved O2. As this value is expected to decrease linearly over the course of a measurement (Svendsen et al., 2016), a linear regression for the oxygen decrease in a measurement chamber over time was calculated for each measurement series. All intervals for which the obtained values showed an insufficient fit to a linear decrease (R2 < 0.8) were also excluded from further analyses. For each of the remaining measurement intervals, oxygen consumption (OC) in mg / h was calculated as OC = −s × 60 × vol where “s” denotes the slope of the linear regression and “vol” the volume of the respective measurement chamber minus the mass of the fish. Per fish species, the obtained value was corrected for the mean oxygen consumption in the empty chamber before calculating total energy use (oxygen consumption × 13.6 J/mg [oxycaloric factor (
Concerning the fish eDNA copy numbers obtained from dPCR, 21 filtered water samples did not lead to an amplification. They were removed from the dataset, as other fish individuals of comparable size and other samplings reliably produced positive results and/or eDNA was detected in celPCR. Hence, processing errors during sampling and in the laboratory were deemed the most likely cause for failing amplification. One group of P. phoxinus had to be excluded from further analyses, as two of three individuals were identified as S. cephalus when removed from the aquarium after the experiment. To determine whether the pH measurements, mean activity and eDNA copy numbers were significantly influenced by sampling (i.e., time of the day), a one-way repeated measurements ANOVA with rank transformation was calculated for each variable using a combination of fish species and aquarium as random factor. A significant trend could not be detected (Table 2). Despite efforts to standardize the mass of the chosen fish individuals within and between species, fish mass was identified as confounding variable (Supplementary Material 4). Hence, eDNA copies, mean activity, and energy use were normalized by the mass of the respective fish individual prior to all further analyses.
TABLE 2
| F-value | p-value | ||
| pH | Intercept | 34.52 | <0.001 |
| Sampling | 2.22 | 0.053 | |
| Mean activity | Intercept | 78.78 | <0.001 |
| Sampling | 0.76 | 0.57 | |
| Target copies per μl | Intercept | 39.00 | <0.001 |
| Sampling | 0.38 | 0.86 |
The results of one-way repeated measurements ANOVA with rank transformation examining a potential effect of sampling on pH, mean activity, and target eDNA copy numbers.
Significant differences (p < 0.05) are in bold.
Generalized Linear Mixed-Effects Models (GLMM) for a Gamma-distributed dependent variable (i.e., eDNA copies) were set up with a log-link function to investigate the effects of mean activity, energy use, fish species, and pH (
TABLE 3
| Model # | Covariate structure (fixed effects) |
| 1 | Mean activity + energy use + fish species + pH + sampling |
| 2 | Mean activity + energy use + fish species + sampling |
| 3 | Mean activity + energy use + fish species |
| 4 | Mean activity + energy use |
| 5 | Mean activity + fish species |
| 6 | Fish species |
Covariate structures of the candidate Gamma GLMM with a log link function.
The models were compared for their potential to explain the target eDNA copy numbers per gram fish and μl extract obtained from single-fish aquaria with the following parameters: fish species identity (seven species), mean activity (per gram fish), energy use (per gram fish), and pH. In all models, individual fish were included as random effect (random intercept) to account for repeated measurements and the sampling event was included primarily to show its insignificance.
To test the differences between single and grouped fish in the different stages of the experiment, a data subset containing only values obtained from single and grouped P. phoxinus and S. cephalus was analyzed. Target eDNA copies, energy use, and mean activity (all normalized by fish mass) of the four distinct fish categories were tested for normality and homogeneity of variance with Shapiro-Wilk and Bartlett tests. Then, differences between groups were examined via Kruskal-Wallis tests followed by Wilcoxon Rank Sum tests with Benjamini-Hochberg-corrected p-values. In a final step, target eDNA copies for groups of P. phoxinus and S. cephalus were predicted using the model previously established for single fish (only possible when not incorporating the random effect of fish individual). Pairwise Wilcoxon tests were used to verify whether there was a significant difference between predicted and measured target eDNA copy numbers for both species separately and combined.
Results
The mean mass of individually housed fish was 3.06 g ± 1.56 g (SD) and C. gobio individuals had the highest mass [5 g ± 2.1 g (SD); Table 4]. Water samples from P. phoxinus and T. thymallus aquaria had the highest eDNA copy numbers per μl extract and gram fish mass [31.13 ± 53.23 (SD) and 47.68 ± 41.13 (SD), respectively; Figure 3 and Table 4]. The normalized mean activity was highest for S. fontinalis [1.08 ± 0.33 (SD)] and lowest for C. gobio [0.34 ± 0.10 (SD); Figure 3 and Table 4]. The energy use per gram fish mass was highest for O. mykiss [1.81 J/h ± 0.91 J/h (SD)], while S. fontinalis and S. trutta aquaria had the lowest pH.
TABLE 4
| Mass [g] ± SD [g] | Activity ± SD | Energy use [J/h] ± SD [J/h] | eDNA copies ± SD | |
| Cottus gobio | 5.00 ± 2.10 | 0.34 ± 0.10 | 0.68 ± 0.17 | 2.48 ± 2.94 |
| Oncorhynchus mykiss | 3.30 ± 0.31 | 0.51 ± 0.10 | 1.81 ± 0.91 | 9.60 ± 5.16 |
| Phoxinus phoxinus | 3.48 ± 0.55 | 0.55 ± 0.09 | 0.67 ± 0.16 | 31.13 ± 53.23 |
| Salvelinus fontinalis | 1.40 ± 0.42 | 1.08 ± 0.33 | 1.06 ± 0.00 | 11.46 ± 8.72 |
| Salmo trutta | 2.22 ± 0.77 | 0.68 ± 0.29 | 0.92 ± 0.00 | 5.98 ± 8.08 |
| Squalius cephalus | 2.72 ± 0.66 | 0.69 ± 0.09 | 1.06 ± 0.44 | 14.14 ± 11.56 |
| Thymallus thymallus | 3.53 ± 1.42 | 0.56 ± 0.30 | 0.43 ± 0.01 | 47.68 ± 41.13 |
| Phoxinus phoxinus grouped | 12.06 ± 1.86 | 0.26 ± 0.09 | 1.00 ± 0.33 | 42.61 ± 48.04 |
| Squalius cephalus grouped | 7.75 ± 1.30 | 0.32 ± 0.11 | 1.41 ± 0.50 | 18.04 ± 13.69 |
The means and standard deviations of mass, activity, and energy use for each fish species in the experiment.
The eDNA copies (per μl extract), activity, and energy use are provided per gram fish mass; for grouped fish, the mass is displayed per aquarium (i.e., sum of three fish individuals).
FIGURE 3

Key parameters obtained during the experiment for single fish. Boxplots display target eDNA copies per μl extract, energy use [J/h], mean activity, and pH per fish species. Fish species are abbreviated: “Cot gob,” Cottus gobio; “Onc myk,” Oncorhynchus mykiss; “Pho pho,” Phoxinus phoxinus; “Sal fon,” Salvelinus fontinalis; “Sal tru,” Salmo trutta; “Squ cep,” Squalius cephalus; “Thy thy,” Thymallus thymallus. The variables target eDNA copies, mean activity, and energy use were normalized by fish mass to control for the effect of this confounding variable.
The ΔAICc-based comparison of model weight (single fish only) resulted in model #3 outperforming five other candidate models (Tables 3, 5). Therein, mean activity, energy use, and fish species were contained as explanatory variables (conditional pseudo-R2 = 0.59). Increased activity had a significantly positive effect on eDNA copy numbers (p < 0.05) and P. phoxinus, S. cephalus, and T. thymallus displayed significantly higher copy numbers compared to C. gobio (base group) after controlling for the effect of fish mass. The relationship between energy use and copy numbers was also positive, but not significant (p = 0.08; Table 6 and Figure 4).
TABLE 5
| Model # | K | AICc | Δ AICc | ω | Marginal pseudo-R2 | Conditional pseudo-R2 |
| 3 | 11 | 159.57 | 0 | 0.52 | 0.56 | 0.59 |
| 5 | 10 | 160.28 | 0.71 | 0.36 | 0.56 | 0.60 |
| 6 | 9 | 162.74 | 3.17 | 0.11 | 0.53 | 0.60 |
| 2 | 16 | 167.10 | 7.53 | 0.01 | 0.57 | 0.60 |
| 1 | 17 | 169.55 | 9.98 | 0.00 | 0.57 | 0.60 |
| 4 | 5 | 194.18 | 34.6 | 0.00 | 0.04 | 0.52 |
Results of the ordinal ranking based on ΔAICc for the GLMM (Table 3).
Models are sorted from high to low weight and K denotes for the number of estimable parameters, AICc for the second-order variant of Akaike’s Information Criterion, ΔAICc for AICc difference, ω for Akaike weight, and marginal/conditional pseudo-R2 represent the variance explained by the fixed effects only and by the entire model, respectively.
TABLE 6
| (A) | Parameter estimate | Standard error | Lower 95% CI | Upper 95% CI | t-value | p-value |
| Intercept | 0.19 | 0.31 | –0.55 | 0.85 | 0.63 | 0.53 |
| Mean activity | 1.00 | 0.42 | 0.19 | 1.95 | 2.39 | 0.02 |
| Energy use [J/h] | 0.41 | 0.23 | –0.07 | 0.94 | 1.77 | 0.08 |
| Oncorhynchus mykiss | 0.79 | 0.43 | –0.21 | 1.57 | 1.85 | 0.06 |
| Phoxinus phoxinus | 2.40 | 0.35 | 1.71 | 3.17 | 6.78 | < 0.001 |
| Salvelinus fontinalis | 0.65 | 0.47 | –0.45 | 1.67 | 1.38 | 0.17 |
| Salmo trutta | 0.32 | 0.38 | –0.58 | 1.28 | 0.83 | 0.40 |
| Squalius cephalus | 1.25 | 0.38 | 0.41 | 2.01 | 3.28 | < 0.01 |
| Thymallus thymallus | 2.93 | 0.33 | 2.30 | 3.58 | 8.75 | < 0.001 |
| (B) | Variance | Standard deviation | ||||
| Fish individual (intercept) | 0.06 | 0.24 |
The highest weight (ω = 0.52) GLMM (model #3) describing the measured eDNA copy numbers via (A) the fixed effects: mean activity, energy use and fish species identity, and (B) the random effect fish individual (31 groups, σ = 0.88).
Significant p-values of fish species in the model refer to a significant difference between Cottus gobio (used as base category for dummy coding) and the respective fish species. Significant differences (p < 0.05) are in bold.
FIGURE 4

Graphic representation of the GLMM estimates (model #3) best describing the obtained target eDNA copy numbers: (A) fixed effects and (B) random effect of individual fish. Coefficients are exponentiated, significance codes of denoted fish species indicate differences in comparison to the base category Cottus gobio, whiskers display the 95%-CI. Fish species are abbreviated: “Cot gob,” Cottus gobio; “Onc myk,” Oncorhynchus mykiss; “Pho pho,” Phoxinus phoxinus; “Sal fon,” Salvelinus fontinalis; “Sal tru,” Salmo trutta; “Squ cep,” Squalius cephalus; “Thy thy,” Thymallus thymallus in addition to individual numbers from 1 to 5. Asterisks denote p-values smaller than: 0.05 (*), 0.01 (**), and 0.001 (***).
For single and grouped individuals of P. phoxinus and S. cephalus, target eDNA copies per gram fish were significantly higher for grouped fish in general [28.96 ± 35.44 (SD) compared to 22.44 ± 38.64 (SD); Chi2 = 5.96; p < 0.05]. Specifically, they were significantly higher for grouped P. phoxinus [42.61 ± 48.04 (SD)] compared to single P. phoxinus and single and grouped S. cephalus and characterized by few outliers with particularly high eDNA concentration (Figures 3, 5). Significant differences were also detected between the four groups regarding mean activity (Chi2 = 80.95; p < 0.001) and energy use (Chi2 = 36.77; p < 0.001): mean activity was significantly higher when fish were kept solitary compared to having them in groups for both species (p < 0.001). Contrastingly, energy use was significantly higher for grouped individuals of P. phoxinus and S. cephalus (p < 0.01).
FIGURE 5

Comparison of target eDNA copies, mean activity, and energy use (normalized by fish mass) in aquaria obtained from single and grouped individuals of Phoxinus phoxinus and Squalius cephalus. Different lower case letters above boxplots code for significant differences (p < 0.05) between categories, which are abbreviated as: “Pho pho,” Phoxinus phoxinus (single fish); “Pho pho g,” Phoxinus phoxinus grouped fish; “Squ cep,” Squalius cephalus (single fish); “Squ cep g,” Squalius cephalus grouped fish.
To test the suitability of model #3 for describing eDNA shedding also for grouped fish, model #3-predicted eDNA copies were compared to the measured copy numbers in the group treatments. For the two species combined, there was no significant difference between predicted and measured copy numbers (W = 1612, p = 0.35). For P. phoxinus alone, no such difference was detected either (W = 274; p = 0.78; Figure 6), while predicted and measured copy numbers of S. cephalus showed a significant difference (W = 609; p < 0.05; Figure 6).
FIGURE 6

For groups of Phoxinus phoxinus (Pho pho g) and Squalius cephalus (Squ cep g) measured and predicted copy numbers are plotted: left, against each other; middle, predicted copy numbers are compared between species; right, comparison of measured copy numbers between the two species. The measured copy numbers were log-transformed to enable a direct comparison with the values predicted by the Gamma GLMM with log-link function; the random effect of individual fish could not be taken into account for this prediction. For S. cephalus a significant difference between measured and predicted copy numbers was detected (W = 609; p < 0.05).
Discussion
This experiment confirms the hypothesized positive relationship between eDNA shedding and fish activity. The species identity and thereby associated physiological differences were found to influence the amount of released eDNA, and the positive relationship between energy use and eDNA signals was not significant. Furthermore, our data show that models of eDNA shedding cannot always be generalized from experiments with individual fish to fish groups. For a conclusive habitat-scale estimation of fish communities with eDNA-based methods it is therefore necessary to incorporate species physiology and behavior into the analysis.
In early aquarium experiments, the strongest eDNA signals were found right after the introduction of fish into tanks without water circulation and often explained by elevated stress levels through handling and adaption to the new environment (Takahara et al., 2012;
Energy use in a resting state as measured with an intermittent-flow respirometer, was also positively correlated with eDNA production, albeit not significant. In case this trend is confirmed in the future, it could be attributed to the higher metabolic rate and larger gill size of active species in combination with higher water volumes pumped through them (Wegner et al., 2009). However, the elevated eDNA signals could also stem from other physiological processes (e.g., defecation), which are known to positively influence eDNA production rates (
There were distinct differences in eDNA shedding between the species, with T. thymallus, P. phoxinus, and S. cephalus emitting the most eDNA. The adaptation to habitats with stronger currents (
Generally, the measured eDNA concentrations per μl DNA extract were right-skewed and a few exceptionally high values showed a considerable influence on the size of standard deviations. These results were independent of fish handling and stress during the introduction phase as eDNA sampling started only after 24 h and the aquaria had constant flow with the entire volume being renewed every 11 min. Such “outliers” were also detected in other aquarium experiments (
The influence of fish mass on eDNA concentrations was not in the focus of this experiment and fish individuals were as similar in size/mass as possible. However, adult fish of P. phoxinus and C. gobio are considerably smaller in comparison to the other species (
Our results demonstrate that for the successful application of eDNA-based methods on a habitat scale it is necessary to incorporate fish physiology and behavior not only in the study design and sampling process [e.g., by sampling at different depths and in different micro-habitats (
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: All data on eDNA signals, fish activity, energy use, fish mass, and pH have been uploaded to Figshare and are available at https://doi.org/10.6084/m9.figshare.13151180.v1.
Ethics statement
Ethical review and approval was not required for the animal study because of Austrian legislative provisions. For a detailed statement describing the regulations and recommendations given by the legislative authorities (Austrian Federal Ministry of Education, Science and Research and University of Veterinary Medicine, Vienna) see section “Materials and Methods.”
Author contributions
MT and JW conceived the study. BT, MT, TS, and JW designed the experiments. AR and AT carried out the experiments under the supervision of BT and JW. TS was responsible for the processing of activity data. AR, AT, and YP were responsible for laboratory processing of the eDNA samples under the supervision of BT who also carried out statistical analysis and wrote the first draft of the manuscript which was revised by all co-authors. All authors contributed to the article and approved the submitted version.
Funding
This research was conducted within the eDNA-Alpfish project funded by the Austrian Research Promotion Agency (FFG); project number 853219, and this open access publication was co-funded by the University of Innsbruck.
Acknowledgments
We thank R. Vogt for his support during the experiment, M. Böcker for assistance with the background literature, J. Harvie for input on the statistical analysis, and C. Moritz and D. Kirschner for their help in obtaining the C. gobio individuals. We also thank two reviewers for their extensive and constructive feedback on the original manuscript. This manuscript has been uploaded as preprint to bioRxiv https://doi.org/10.1101/2020.10.28.359653 (Thalinger et al., 2020).
Conflict of interest
MT is the co-founder of Sinsoma GmbH, a for profit company dedicated to DNA analyses in environmental studies. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fevo.2021.623718/full#supplementary-material
Footnotes
References
1
Ángeles EstebanM. (2012). An overview of the immunological defenses in fish skin.Isrn Immunol.2012:853470. 10.5402/2012/853470
2
AuguieB. (2017). gridExtra: Miscellaneous Functions for “Grid” Graphics. Available online at: https://cran.r-project.org/package=gridExtra(accessed September 15, 2020).
3
BarnesM. A.TurnerC. R. (2016). The ecology of environmental DNA and implications for conservation genetics.Conserv. Genet.171–17. 10.1007/s10592-015-0775-4
4
BartonK. (2019). MuMIn: Multi-Model Inference. Available online at: https://cran.r-project.org/package=MuMIn10.5402/2012/853470(accessed September 15, 2020).
5
BatesD.MächlerM.BolkerB.WalkerS. (2015). Fitting linear mixed-effects models using lme4.J. Stat. Softw.671–48. 10.18637/jss.v067.i01
6
BolkerB. M.BrooksM. E.ClarkC. J.GeangeS. W.PoulsenJ. R.StevensM. H. H.et al (2009). Generalized linear mixed models: a practical guide for ecology and evolution.Trends Ecol. Evol.24127–135. 10.1016/j.tree.2008.10.008
7
BrettJ. R.GrovesT. D. D. (1979). “Physiological energetics,” in Fish Physiology, Bioenergetics and Growt, Vol. 8edsHoarW. S.RandallD. J.BrettJ. R. (New York, NY: Academic Press).
8
BrownJ. H.GilloolyJ. F.AllenA. P.SavageV. M.WestG. B. (2004). Toward a metabolic theory of ecology.Ecology851771–1789.
9
BurnhamK. P.AndersonD. R. (2002). Model Selection and Multimodel Inference, 2nd Edn. (New York, NY: Springer). 10.1007/b97636
10
BylemansJ.FurlanE. M.HardyC. M.McGuffieP.LintermansM.GleesonD. M. (2017). An environmental DNA-based method for monitoring spawning activity: a case study, using the endangered Macquarie perch (Macquaria australasica).Methods Ecol. Evol.8646–655. 10.1111/2041-210X.12709
11
DeinerK.BikH. M.MächlerE.SeymourM.Lacoursière-RousselA.AltermattF.et al (2017). Environmental DNA metabarcoding: transforming how we survey animal and plant communities.Mol. Ecol.265872–5895. 10.1111/mec.14350
12
DoiH.UchiiK.TakaharaT.MatsuhashiS.YamanakaH.MinamotoT. (2015). Use of droplet digital PCR for estimation of fish abundance and biomass in environmental DNA surveys.PLoS One10:e0122763. 10.1371/journal.pone.0122763
13
EvansN. T.OldsB. P.RenshawM. A.TurnerC. R.LiY.JerdeC. L.et al (2016). Quantification of mesocosm fish and amphibian species diversity via environmental DNA metabarcoding.Mol. Ecol. Resour.1629–41. 10.1111/1755-0998.12433
14
EvansN. T.ShireyP. D.WieringaJ. G.MahonA. R.LambertiG. A. (2017). Comparative cost and effort of fish distribution detection via environmental DNA analysis and electrofishing.Fisheries4290–99. 10.1080/03632415.2017.1276329
15
FarawayJ. J. (2016). Extending the Linear Model with R. Generalized Linear, Mixed Effects and Nonparametric Regression Models, 2nd Edn. (New York, NY: Chapman and Hall). 10.1201/9781315382722
16
ForstnerH. (1983). “An automated multiple-chamber intermittent-flow respirometer,” in Polarographic Oxygen Sensors, edsGnaigerD. E.ForstnerD. H. (Berlin: Springer), 111–126. 10.1007/978-3-642-81863-9_12
17
FreyhofJ.KottelatM. (2007). Handbook of European Freshwater Fishes. Berlin: Springer.
18
GoldbergC. S.TurnerC. R.DeinerK.KlymusK. E.ThomsenP. F.MurphyM. A.et al (2016). Critical considerations for the application of environmental DNA methods to detect aquatic species.Methods Ecol. Evol.71299–1307. 10.1111/2041-210X.12595
19
HarrisonJ. B.SundayJ. M.RogersS. M. (2019). Predicting the fate of eDNA in the environment and implications for studying biodiversity.Proc. R. Soc. B Biol. Sci.286:20191409. 10.1098/rspb.2019.1409
20
HartigF. (2020). DHARMa: Residual Diagnostics for Hierarchical (Multi-Level / Mixed) Regression Models. Available online at: https://cran.r-project.org/package=DHARMa(accessed January 5, 2021).
21
HelfmanG. S. (1986). “Fish behaviour by day, night and twilight,” in The Behaviour of Teleost Fishes, ed.PitcherT. J. (Boston, MA: Springer), 366–387. 10.1007/978-1-4684-8261-4_14
22
HoriuchiT.MasudaR.MurakamiH.YamamotoS.MinamotoT. (2019). Biomass-dependent emission of environmental DNA in jack mackerel Trachurus japonicus juveniles.J. Fish Biol.95:jfb.14095. 10.1111/jfb.14095
23
HuerlimannR.CooperM. K.EdmundsR. C.Villacorta-RathC.Le PortA.RobsonH. L. A.et al (2020). Enhancing tropical conservation and ecology research with aquatic environmental DNA methods: an introduction for non-environmental DNA specialists.Anim. Conserv.23632–645. 10.1111/acv.12583
24
JoT.ArimotoM.MurakamiH.MasudaR.MinamotoT. (2020). Estimating shedding and decay rates of environmental nuclear DNA with relation to water temperature and biomass.Environ. DNA2140–151. 10.1002/edn3.51
25
JoT.MurakamiH.YamamotoS.MasudaR.MinamotoT. (2019). Effect of water temperature and fish biomass on environmental DNA shedding, degradation, and size distribution.Ecol. Evol.91135–1146. 10.1002/ece3.4802
26
JohnstonI. A.CammJ. P.WhiteM. (1988). Specialisations of swimming muscles in the pelagic antarctic fish Pleuragramma antarcticum.Mar. Biol.1003–12. 10.1007/BF00392949
27
KassambaraA. (2019). ggpubr: “ggplot2” Based Publication Ready Plots. Available online at: https://cran.r-project.org/package=ggpubr(accessed September 15, 2020).
28
KillenS. S.AtkinsonD.GlazierD. S. (2010). The intraspecific scaling of metabolic rate with body mass in fishes depends on lifestyle and temperature.Ecol. Lett.13184–193. 10.1111/j.1461-0248.2009.01415.x
29
KlymusK. E.RichterC. A.ChapmanD. C.PaukertC. (2015). Quantification of eDNA shedding rates from invasive bighead carp Hypophthalmichthys nobilis and silver carp Hypophthalmichthys molitrix.Biol. Conserv.18377–84. 10.1016/j.biocon.2014.11.020
30
Lacoursière-RousselA.RosabalM.BernatchezL. (2016). Estimating fish abundance and biomass from eDNA concentrations: variability among capture methods and environmental conditions.Mol. Ecol. Resour.161401–1414. 10.1111/1755-0998.12522
31
LeeseF.AltermattF.BouchezA.EkremT.HeringD.MeissnerK.et al (2016). DNAqua-Net: developing new genetic tools for bioassessment and monitoring of aquatic ecosystems in Europe.Res. Ideas Outcomes2:e11321. 10.3897/rio.2.e11321
32
LittlefairJ. E.HrenchukL. E.BlanchfieldP. J.RennieM. D.CristescuM. E. (2020). Thermal stratification and fish thermal preference explain vertical eDNA distributions in lakes.Mol. Ecol.1–14. 10.1111/mec.15623
33
LüdeckeD. (2020). sjPlot: Data Visualization for Statistics in Social Science. Available online at: https://cran.r-project.org/package=sjPlot(accessed September 15, 2020).
34
MaruyamaA.NakamuraK.YamanakaH.KondohM.MinamotoT. (2014). The release rate of environmental DNA from juvenile and adult fish.PLoS One9:e0114639. 10.1371/journal.pone.0114639
35
MazerolleM. J. (2020). AICcmodavg: Model Selection and Multimodel Inference Based on (Q)AIC(c). Available online at: https://cran.r-project.org/package=AICcmodavg(accessed September 15, 2020).
36
McColl-GausdenE.WeeksA.ColemanR.RobinsonK.SongS.RaadikT.et al (2020). Multi-species models reveal that eDNA metabarcoding is more sensitive than backpack electrofishing for conducting fish surveys in freshwater streams.Mol. Ecol.1–16. 10.1111/mec.15644
37
MerkesC. M.McCallaS. G.JensenN. R.GaikowskiM. P.AmbergJ. J. (2014). Persistence of DNA in carcasses, slime and avian feces may affect interpretation of environmental DNA data.PLoS One9:e113346. 10.1371/journal.pone.0113346
38
MetcalfeN. B.Van LeeuwenT. E.KillenS. S. (2016). Does individual variation in metabolic phenotype predict fish behaviour and performance?J. Fish Biol.88298–321. 10.1111/jfb.12699
39
MinamotoT.MiyaM.SadoT.SeinoS.DoiH.KondohM.et al (2020). An illustrated manual for environmental DNA research: water sampling guidelines and experimental protocols.Environ. DNA38–13. 10.1002/edn3.121
40
MizumotoH.UrabeH.KanbeT.FukushimaM.ArakiH. (2018). Establishing an environmental DNA method to detect and estimate the biomass of Sakhalin taimen, a critically endangered Asian salmonid.Limnology19219–227. 10.1007/s10201-017-0535-x
41
MuusB. J.DahlströmP. (1968). Süßwasserfische. Munich: BLV Verlagsgesellschaft.
42
NakagawaS.SchielzethH. (2013). A general and simple method for obtaining R2 from generalized linear mixed-effects models.Methods Ecol. Evol.4133–142. 10.1111/j.2041-210x.2012.00261.x
43
O’SheaB.Mordue-LuntzA. J.FryerR. J.PertC. C.BricknellI. R. (2006). Determination of the surface area of a fish.J. Fish Dis.29437–440. 10.1111/j.1365-2761.2006.00728.x
44
PilliodD. S.LaramieM. B.MacCoyD.MacleanS. (2019). Integration of eDNA-Based Biological Monitoring within the U.S. Geological Survey’s National Streamgage Network.JAWRA J. Am. Water Resour. Assoc.551505–1518. 10.1111/1752-1688.12800
45
PontD.RocleM.ValentiniA.CivadeR.JeanP.MaireA.et al (2018). Environmental DNA reveals quantitative patterns of fish biodiversity in large rivers despite its downstream transportation.Sci. Rep.8:10361. 10.1038/s41598-018-28424-8
46
PowellM. J. D. (2009). The BOBYQA Algorithm for Bound Constrained Optimization Without Derivatives. Rep. No. DAMTP 2009/NA06. Available online at: http://www.damtp.cam.ac.uk/user/na/NA_papers/NA2009_06.pdf(accessed January 5, 2021).
47
R Core Team (2020). R: A Language and Environment for Statistical Computing. Available online at: https://www.r-project.org/(accessed September 15, 2020).
48
RobertsJ. L. (1975). Active branchial and ram gill ventilation in fishes.Biol. Bull.14885–105. 10.2307/1540652
49
RuedenC. T.SchindelinJ.HinerM. C.DeZoniaB. E.WalterA. E.ArenaE. T.et al (2017). ImageJ2: ImageJ for the next generation of scientific image data.BMC Bioinformatics18:529. 10.1186/s12859-017-1934-z
50
SassoubreL. M.YamaharaK. M.GardnerL. D.BlockB. A.BoehmA. B. (2016). Quantification of environmental DNA (eDNA) shedding and decay rates for three marine fish.Environ. Sci. Technol.5010456–10464. 10.1021/acs.est.6b03114
51
SchindelinJ.Arganda-CarrerasI.FriseE.KaynigV.LongairM.PietzschT.et al (2012). Fiji: an open-source platform for biological-image analysis.Nat. Methods9676–682. 10.1038/nmeth.2019
52
ShogrenA. J.TankJ. L.AndruszkiewiczE.OldsB.MahonA. R.JerdeC. L.et al (2017). Controls on eDNA movement in streams: transport, Retention, and Resuspension.Sci. Rep.7:5065. 10.1038/s41598-017-05223-1
53
SigsgaardE. E.CarlH.MøllerP. R.ThomsenP. F. (2015). Monitoring the near-extinct European weather loach in Denmark based on environmental DNA from water samples.Biol. Conserv.18346–52. 10.1016/j.biocon.2014.11.023
54
SpindlerT. (1997). Fischfauna in Osterreich. Ökologie – Gefahrdung – Bioindikation – Fischerei – Gesetzgebung. Vienna: Umweltbundesamt.
55
StricklerK. M.FremierA. K.GoldbergC. S. (2015). Quantifying effects of UV-B, temperature, and pH on eDNA degradation in aquatic microcosms.Biol. Conserv.18385–92. 10.1016/j.biocon.2014.11.038
56
SvendsenM. B. S.BushnellP. G.SteffensenJ. F. (2016). Design and setup of intermittent-flow respirometry system for aquatic organisms.J. Fish Biol.8826–50. 10.1111/jfb.12797
57
TakaharaT.MinamotoT.YamanakaH.DoiH.KawabataZ. (2012). Estimation of fish biomass using environmental DNA.PLoS One7:e35868. 10.1371/journal.pone.0035868
58
TakeuchiA.IijimaT.KakuzenW.WatanabeS.YamadaY.OkamuraA.et al (2019). Release of eDNA by different life history stages and during spawning activities of laboratory-reared Japanese eels for interpretation of oceanic survey data.Sci. Rep.9:6074. 10.1038/s41598-019-42641-9
59
ThalingerB.RiederA.TeuffenbachA.PutzY.SchwerteT.WanzenböckJ.et al (2020). The effect of activity, energy use, and species identity on environmental DNA shedding of freshwater fish.bioRxiv[Preprint]. 10.1101/2020.10.28.359653
60
ThalingerB.DeinerK.HarperL.ReesH.BlackmanR.SintD.et al (2021a). A validation scale to determine the readiness of environmental DNA assays for routine species monitoring.bioRxiv[Preprint]. 10.1101/2020.04.27.063990
61
ThalingerB.KirschnerD.PützY.MoritzC.SchwarzenbergerR.WanzenböckJ.et al (2021b). Lateral and longitudinal fish environmental DNA distribution in dynamic riverine habitats.Environ. DNA3305–318. 10.1002/edn3.171
62
ThalingerB.OehmJ.MayrH.ObwexerA.ZeislerC.TraugottM. (2016). Molecular prey identification in Central European piscivores.Mol. Ecol. Resour.16123–137. 10.1111/1755-0998.12436
63
TsujiS.UshioM.SakuraiS.MinamotoT.YamanakaH. (2017). Water temperature-dependent degradation of environmental DNA and its relation to bacterial abundance.PLoS One12:e0176608. 10.1371/journal.pone.0176608
64
VanniM. J.McIntyreP. B. (2016). Predicting nutrient excretion of aquatic animals with metabolic ecology and ecological stoichiometry: a global synthesis.Ecology973460–3471. 10.1002/ecy.1582
65
WegnerN. C.SepulvedaC. A.BullK. B.GrahamJ. B. (2009). Gill morphometrics in relation to gas transfer and ram ventilation in high-energy demand teleosts: scombrids and billfishes.J. Morphol.27136–49. 10.1002/jmor.10777
66
WickhamH. (2016). ggplot2: Elegant Graphics for Data Analysis. New York, NY: Springer-Verlag.
67
WilcoxT. M.McKelveyK. S.YoungM. K.SepulvedaA. J.ShepardB. B.JaneS. F.et al (2016). Understanding environmental DNA detection probabilities: a case study using a stream-dwelling char Salvelinus fontinalis.Biol. Conserv.194209–216. 10.1016/j.biocon.2015.12.023
68
YatesM. C.GlaserD. M.PostJ. R.CristescuM. E.FraserD. J.DerryA. M. (2020). The relationship between eDNA particle concentration and organism abundance in nature is strengthened by allometric scaling.Mol. Ecol.1–15. 10.1111/mec.15543
69
ZhangD. (2020). rsq: R-Squared and Related Measures. Available online at: https://cran.r-project.org/package=rsq(accessed January 5, 2021).
Summary
Keywords
digital PCR, video-analysis, respirometry, aquarium experiment, environmental DNA, fish tank
Citation
Thalinger B, Rieder A, Teuffenbach A, Pütz Y, Schwerte T, Wanzenböck J and Traugott M (2021) The Effect of Activity, Energy Use, and Species Identity on Environmental DNA Shedding of Freshwater Fish. Front. Ecol. Evol. 9:623718. doi: 10.3389/fevo.2021.623718
Received
30 October 2020
Accepted
29 January 2021
Published
26 February 2021
Volume
9 - 2021
Edited by
Hiroki Yamanaka, Ryukoku University, Japan
Reviewed by
Matthew Yates, Université du Québec à Montréal, Canada; Meredith B. Nevers, United States Geological Survey (USGS), United States
Updates

Check for updates
Copyright
© 2021 Thalinger, Rieder, Teuffenbach, Pütz, Schwerte, Wanzenböck and Traugott.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Bettina Thalinger, Bettina.Thalinger@gmail.com
This article was submitted to Conservation and Restoration Ecology, a section of the journal Frontiers in Ecology and Evolution
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.