ORIGINAL RESEARCH article

Front. Ecol. Evol., 14 June 2022

Sec. Phylogenetics, Phylogenomics, and Systematics

Volume 10 - 2022 | https://doi.org/10.3389/fevo.2022.918908

Secondary DNA Barcodes (CAM, GAPDH, GS, and RpB2) to Characterize Species Complexes and Strengthen the Powdery Mildew Phylogeny

  • 1. Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, MA, United States

  • 2. Engineering Research Center of Edible and Medicinal Fungi, Ministry of Education, Jilin Agricultural University, Changchun, China

  • 3. Department of Environmental Studies, Dartmouth College, Hanover, NH, United States

  • 4. Department for Geobotany and Botanical Garden, Herbarium, Institute of Biology, Martin Luther University, Halle (Saale), Germany

  • 5. Department of Plant Pathology, College of Plant Protection, Jilin Agricultural University, Changchun, China

Abstract

Powdery mildews are a group of economically and ecologically important plant pathogens. In the past 25 years the use of ribosomal DNA (rDNA) in the powdery mildews has led to major taxonomic revisions. However, the broad scale use of rDNA has also revealed multiple species complexes that cannot be differentiated based on ITS + LSU data alone. Currently, there are only two powdery mildew taxonomic studies that took a multi-locus approach to resolve a species complex. In the present study, we introduce primers to sequence four additional regions (CAM, GAPDH, GS, and RPB2) that have the potential to improve support values in both broad and fine scale phylogenetic analyses. The primers were applied to a broad set of powdery mildew genera in China and the United States, and phylogenetic analyses included some of the common complexes. In taxa with nearly identical ITS sequences the analyses revealed a great amount of diversity. In total 154 non-rDNA sequences from 11 different powdery mildew genera were deposited in NCBI’s GenBank, laying the foundation for secondary barcode databases for powdery mildews. The combined and single loci phylogenetic trees constructed generally followed the previously defined species/genus concepts for the powdery mildews. Future research can use these primers to conduct in depth phylogenetic, and taxonomic studies to elucidate the evolutionary relationships of species and genera within the powdery mildews.

Introduction

Approximately 900 species of powdery mildews (Helotiales, Erysiphaceae) have been described in 19 genera infecting over 10,000 plant species worldwide (; ; ; ; ). The taxonomy and phylogeny of these obligate plant pathogens has undergone radical change in the past 25 years as molecular methods have been widely applied (; ; ; ). The taxonomic rank of the powdery mildews (i.e. Erysiphaceae) has been recently resolved (; ) using multiple loci from the full genomes of three different genera. Most of the molecular phylogenetic work conducted on this important group has focused solely on the ITS and adjacent LSU region. The biotrophic nature of powdery mildews has rendered it difficult to evaluate single copy gene regions and thus, at present, there have been only two multi-locus taxonomic studies (; ).

There are several instances of powdery mildew species complexes where morphologically distinct species cannot be delineated by ITS + LSU sequences. Examples include the Erysiphe aquilegiae complex (), the E. berberidis complex (Liu et al., 2022)1, the E. elevata complex (), the E. trifoliorum complex (), the Podosphaera aphanis complex (), and the P. xanthii complex (). Generally, the morphological differences among species within these complexes can be difficult to discern except by experts. This has led to misidentifications that have been propagated in the literature and on public databases. Other plant-pathogen complexes have been resolved by using non-ribosomal DNA (rDNA) markers, such as, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), calmodulin (CAL), glutamine synthetase synthase (GS), β-Tubulin (TUB2), and Actin (ACT) (Aspergillus-; Botrytis-; Penicillium-; Colletotrichum-). evaluated ACT, TUB2, CAL, CHS (chitin synthase), EF1- α (elongation factor 1 alpha), MCM7 (minichromosome maintenance protein 7), and TSR1 (20-S rRNA accumulation 1) to enhance identification accuracy of powdery mildews. The authors found success with MCM7 which led to a broad scale phylogenetic study by .

Markers to improve higher level support, including the powdery mildew phylogenetic backbone, have eluded this group. Recently, evaluated MCM7, LSU, and SSU (small subunit) sequences to improve the powdery mildew phylogeny. Although their analysis improved tree resolution, low support values (less than 80 posterior values in Maximum likelihood analysis) were still present throughout their trees. Markers for higher level phylogenetic analyses in the powdery mildews are needed since support for the morphologically distinct sections, i.e., Erysiphe sect. Microsphaera, Erysiphe sect. Uncinula etc. has been elusive. Additionally, some genera are paraphyletic (Leveillula is nested within the Phyllactinia clade). With the increase of multi-locus sequences, better resolution and backbone support will be achievable.

The influx of full genome sequences of powdery mildews (there are currently 33 genomes from 14 different species on GenBank) allows the generation of specific powdery mildew primers for a range of protein and single copy genomic regions. In this manuscript, we report multiple genetic markers, and their newly designed primers, that have the potential for broad and fine scale phylogenetic evaluations of the powdery mildews.

Materials and Methods

Sample Collection

Samples from the United States were collected at the University of Washington, Seattle, Washington, United States in 2019, the Arnold Arboretum, Boston, MA, United States, in 2021 and the Harvard University main campus, Cambridge, MA, United States in 2021 (Table 1). Samples from China were collected between 2017 and 2021. One herbarium specimen from the Farlow Herbarium (FH), Harvard University, was evaluated to assess the performance of the newly designed primers on an 83 year old specimen. Freshly collected specimens were deposited at the Farlow Herbarium, Harvard University (FH), and the Herbarium of Mycology of Jilin Agricultural University (HMJAU).

TABLE 1

Taxa evaluatedHostCollection yearVoucher*LocalityITSLSUGAPDHCAMRpB2GS
Arthrocladiella mougeotiiLycium chinense2017HMJAU-PM92019Changchun, Jilin, ChinaON073848ON073848ON101636ON119147ON075667
Cystotheca lanestrisQuercus rubra2018FH00941225Washington, United StatesON073849ON073849ON101637ON119146
Erysiphe aquilegiaeAquilegia sp.2021FH00941212Massachusetts, United StatesON073851ON073851ON075636ON101639ON119149ON075671
Erysiphe aquilegiaeStylophorum diphyllum2021FH00941239Delaware, United StatesON073852ON073852ON075637ON101640ON119150ON075672
Erysiphe aquilegiaeAquilegia coerulea2021FH00941236Idaho, United StatesON073850ON073850ON075633ON101638ON119148ON075670
Erysiphe aquilegiaeArgemone polyanthemos2021FH00941255ON073855ON101643ON075676
Erysiphe aquilegiaeClematis florida2020HMJAU-PM92020Changchun, Jilin, ChinaON101642ON119152ON075675
Erysiphe aquilegiaeRanunculus repens2018FH00941228Washington, United StatesON073854ON073854ON075674
Erysiphe aquilegiaeAsclepias tuberosa2021FH00941240Delaware, United StatesON073853ON073853ON075638ON101641ON119151ON075673
Erysiphe azaleaeRhododendron occidentale2018FH00941230Washington, United StatesON073856ON073856ON075639
Erysiphe caricae-papayaeCarica papaya2021HMJAU-PM92021Shenzhen, Guangdong, ChinaON073857ON073857ON101644
Erysiphe convolvuliConvolvulus arvensis2021FH00941244Colorado, United StatesON073858ON073858ON101645ON119153ON075677
Erysiphe convolvuliConvolvus sp.2021FH00941200Massachusetts, United StatesON073859ON073859ON075640ON101646ON119154ON075678
Erysiphe cruciferarumIsatis tinctoria2017HMJAU-PM92022Changchun, Jilin, ChinaON073860ON075641ON101647ON075679
Erysiphe digitataRhododendron sp.2018FH00941229Washington, United StatesON073861ON073861ON075642
Erysiphe necatorVitis vinifera2020HMJAU-PM92023Chengdu, Sichuan, ChinaON075644ON101649ON119156ON075681
Erysiphe necatorVitis sp.2021FH00941202Massachusetts, United StatesON073862ON073862ON075643ON101648ON119155ON075680
Erysiphe neolycopersiciExcoecaria cochinchinensis2021HMJAU-PM92024Shenzhen, Guangdong, ChinaON075635ON101673ON075668
Erysiphe neolycopersiciSolanum lycopersicum2021FH00941220Massachusetts, United StatesON073897ON073897ON075634ON101674ON075669
Erysiphe plataniPlatanus occidentalis2021FH00941224Massachusetts, United StatesON073863ON073863ON101650ON075682
Erysiphe pulchraCornus sp.2021FH00941217Massachusetts, United StatesON073864ON073864ON101651
Erysiphe sediCrassula capitella2017HMJAU-PM92025Changchun, Jilin, ChinaON073865ON073865ON101652ON119157ON075683
Erysiphe syringaeSyringa X hyacinthiflora2021FH00941218Massachusetts, United StatesON073866ON073866ON101653ON075685
Erysiphe takamatsuiNelumbo nucifera2020HMJAU-PM92026Changchun, Jilin, ChinaON073867ON073867ON075645ON101654ON075686
Erysiphe ulmiUlmus macrocarpa2020HMJAU-PM92027ChinaON073868ON119158
Erysiphe vacciniiVaccinium vacillans1938FH00112205Tennessee, United StatesON073870ON073870ON075646
Erysiphe vacciniiVaccinium corymbosum2021FH00941201Massachusetts, United StatesON073869ON073869ON101655ON119159ON075687
Erysiphe vacciniiVaccinium parvifolium2018WTU-F-073138Washington, United StatesOK959861ON101656ON075688
Erysiphe vignaeVigna unguiculata2018HMJAU-PM92028Guangzhou, Guangdong, ChinaON073844ON073844ON075647
Golovinomyces ambrosiaeSymphyotrichum patens2021FH00941234Minnesota, United StatesON073876ON073876ON101658ON119165ON075690
Golovinomyces ambrosiaeZinnia elegans2021FH00941245Colorado, United StatesON073878ON073878ON075631ON119167ON075691
Golovinomyces ambrosiaeRudbeckia fulgida2021FH00941203Massachusetts, United StatesON075630ON119164
Golovinomyces ambrosiaeAsclepias syriaca2021FH00941223Massachusetts, United StatesON073873ON073873ON075625
Golovinomyces ambrosiaeRatibida columnifera2021FH00941246Colorado, United StatesON073842ON073842ON075629ON119163ON075689
Golovinomyces ambrosiaeLiatris spicata2021FH00941247Colorado, United StatesON073875ON073875ON075628ON119162
Golovinomyces ambrosiaeEutrochium dubium2021FH00941204Massachusetts, United StatesON073874ON073874ON075627
Golovinomyces ambrosiaeAcalypha rhomboidea2021FH00941205Massachusetts, United StatesON073871ON073871ON075648ON101657ON119161
Golovinomyces ambrosiaeDhalia sp.2021FH00941248Colorado, United StatesON073841ON073841ON075626
Golovinomyces ambrosiaeVerbesina alternifolia2021FH00941235Minnesota, United StatesON073877ON073877ON119166
Golovinomyces ambrosiaeAcalypha rhomboidea2021FH00941206Massachusetts, United StatesON073872ON073872ON075624ON119160
Golovinomyces asterumSymphyotrichum novae-angliae2021FH00941249Colorado, United StatesON073879ON073879ON075650ON101659ON119168ON075692
Golovinomyces bolayiLactuca sativa var. ramosa2017HMJAU91770Changchun, Jilin, ChinaON073880ON073880ON119169
Golovinomyces cichoracearumBidens pilosa2021HMJAU-PM92029Shenzhen, Guangdong, ChinaON075651
Golovinomyces sp.Hydrophyllum canadense2021FH00941241Delaware, United StatesON073843ON073843ON075652ON101660
Golovinomyces latisporusHelianthus annuus2021FH00941243California, United StatesON075632
Golovinomyces latisporusHelianthus annuus2021FH00941221Massachusetts, United StatesON073881ON073881ON075649
Golovinomyces salviaeSalvia sp.2021FH00941213Massachusetts, United StatesON073884ON073884ON075655ON101663ON119171
Golovinomyces salviaeAgastache scrophulariifolia2021FH00941250Colorado, United StatesON073883ON073883ON075654ON101662ON119170ON075694
Golovinomyces sp.Phacecia bipinnetifida2021FH00941242Delaware, United StatesON073882ON073882ON075653ON101661ON075693
Leveillula tauricaCapsicum annuum2019HMJAU-PM92030Chifeng, Inner Mongolia, ChinaON073885ON073885ON101664
Leveillula tauricaCleome serrulata2021FH00941251Colorado, United StatesON073886ON073886ON101665ON119172
Leveillula tauricaCleome serrulata2021FH00941238Colorado, United StatesON073887ON073887ON101666
Neoërysiphe galeopsidisLamium purpureum2018FH00941231Washington, United StatesON073888ON075656
Phyllactinia betulaeBetula nigra2021FH00941214Massachusetts, United StatesON073889ON073889ON101667ON119173
Phyllactinia betulaeBetula nigra2021FH00941207Massachusetts, United StatesON073890ON073890ON101668ON119174
Phyllactinia maliCrataegus sp.2018FH00941226Washington, United StatesON073891ON073891ON119175
Phyllactinia moricolaMorus alba2019HMJAU-PM91933Yantai, Shangdong, ChinaMZ541088MZ540403ON101669ON119176
Phyllactinia populiPopulus simonii2020HMJAU-PM92031Changchun, Jilin, ChinaON101670ON119177
Phyllactinia pyri-serotinaePyrus ussuriensis2020HMJAU-PM92032Changchun, Jilin, ChinaON073892ON073892ON101671ON119178
Phyllactinia sp.Oemlaria cerasiformis2018FH00941232Washington, United StatesON101672
Podosphaera fuligineaVeronica spicata2021FH00941252Colorado, United StatesON073893ON073893ON119181
Podosphaera leucotrichaMalus ‘Williamette’2021FH00941208Massachusetts, United StatesON073894ON073894ON119182
Podosphaera sp.Rubus spectabilis2018FH00941227Washington, United StatesON119180
Podosphaera sp.Geranium viscosissimum2021FH00941237Idaho, United StatesON119184
Podosphaera sp.Geranium‘Gerwat’2021FH00941253Colorado, United StatesON119179
Podosphaera sp.Rhus typhina2021FH00941209Massachusetts, United StatesON119186
Podosphaera sp.Rhus glabra2021FH00941210Massachusetts, United StatesON119185
Podosphaera sp.Euphorbia alfredii2021FH00941233Georgia, United StatesON119183
Podosphaera tridactylaPadus racemosa2019HMJAU-PM92033Changchun, Jilin, ChinaON073895ON073895ON075657ON119187
Podosphaera xanthiiCucumis melo2019HMJAU-PM92034Changchun, Jilin, ChinaON075658
Podosphaera xanthiiCucumis sativus2018HMJAU-PM92041Changchun, Jilin, ChinaON075659
Podosphaera xanthiiCucurbita moschata2020HMJAU-PM92035Changchun, Jilin, ChinaON075660
Podosphaera xanthiiCucurbita pepo2020HMJAU-PM92036Changchun, Jilin, ChinaON075661
Podosphaera xanthiiImpatiens balsamina2019HMJAU-PM92037Yancheng, Jiangsu, ChinaON075662
Podosphaera xanthiiLagenaria siceraria2021FH00941254Colorado, United StatesON075663
Pseudoidium hortensiaeHydrangea macrophylla2021HMJAU-PM92038Shenzhen, Guangdong, ChinaON073896ON073896ON119188
Salmonomyces acalyphaeAcalypha supera2019HMJAU-PM91903Kunming, Yunnan, ChinaMZ603889MZ603889ON075684
Salmonomyces acalyphaeAcalypha supera2019HMJAU-PM91904Kunming, Yunnan, ChinaON101675ON119189
Sawadaea bicornisAcer sp.2021FH00941215Massachusetts, United StatesON075664
Sawadaea tulasneiAcer platanoides2021FH00941216Massachusetts, United StatesON075666
Takamatsuella circinataAcer pycananthum2021FH00941219Massachusetts, United StatesON075665
Ampelomyces quisqualisPodosphaera xanthii2021HMJAU-PM92039Shenzhen, Guangdong, ChinaON101677
Ampelomyces quisqualisPodosphaera xanthii2021HMJAU-PM92040Changchun, Jilin, ChinaON101676

Taxa evaluated and their associated barcodes and GenBank numbers.

*HMJAU, Herbarium Mycology of Jilin Agricultural University; FH, Farlow Herbarium, Harvard University, United States.

Primer Construction

Loci were chosen based on previous research on plant-fungal pathogen systems. For most of the regions, no powdery mildew sequences were available on GenBank. In cases where no powdery mildew sequences were available, sequences from other closely related fungi were used to blast the powdery mildew full genomes available on GenBank. There were 33 genome assemblies available on GenBank from 14 species. The blast results were downloaded into Geneious version 11.0.22 and aligned. From the alignment, primers were chosen and analyzed in OligoAnalyzer (integrated DNA Technologies). The following parameters were considered: primers ∼20 bps long, G/C content between 40 and 60%, double T’s or double A’s on the 5’ or 3’ end were avoided, primers ended with a GC clamp, hairpins less than ∼45°C, Delta G above ∼−9, and no more than 5°C difference in melting temperature between primer pairs.

DNA Extraction and Polymerase Chain Reaction

DNA extractions were done using the Chelex method (Walsh et al., 1991; ). Around 20 chasmothecia or 100 conidia were taken from the leaf surface using a sterile pipette tip for DNA extractions. Polymerase chain reaction (PCR) was carried out for the ITS and LSU region using the primer pair PM10/PM28R (). When PCR was unsuccessful, a nested approach was applied using the primers AITS () and TW14 (); followed by PM10 and PM28R or AITS and PM11 (); followed by PM10 and PM2 (). For the CAL, GAPDH, GS, and RPB2 regions the primer pairs from Table 2 were used.

TABLE 2

RegionPrimersPrimer sequenceAmplicon sizeGenera succesfully sequenced*
GAPDHPMGAPDH1GGAATGGCTATGCGTGTACC∼300 bpsErysiphe, Golovinomyces, Neoerysiphe, Podosphaera, Sawadaea, and Takamatsuella
PMGAPDH3RCCCCATTCGTTGTCGTACCATG
CAMPMCAM1CTTTGCATCATGAGTTGGAC∼300 bpsArthrocladiella, Cystotheca, Erysiphe, Golovinomyces, Leveillula, Phyllactinia, Podosphaera, and Salmonomyces.
PMCAM4RGGCTCGAAAAATGAAAGATACCG
GSGSPM2CCAATCAGTTACTGTTTGTTCCC∼500 bpsArthrocladiella, Erysiphe, Golovinomyces, and Salmonomyces.
GSPM3RGGACTTCCTGATATTATGCC
RpB2PmRpb2_4GCAAGCTCAACTGCTGGTG∼800 bpsArthrocladiella, Cystotheca, Erysiphe, Golovinomyces, Leveillula, Phyllactinia, Podosphaera, Salmonomyces, and Sawadaea
PMRpb2_6RTCCAGCGATGTGCTGTTGG

Primers generated in the present study and the genera in which amplicons were generated.

*All the genera were not available for sequencing i.e., if a genus is not listed it does not mean the primers will not anneal to it. For some genera, new primers will need to be constructed to ensure proper annealing.

PCR specifications for all the regions were as follows for a 50 μl solution reaction: 35.7 μl molecular grade H2O, 4 μl BSA (20 mg/ml), 1 μl of forward primer and 1 μl reverse primer at a 10 μM concentration, 2 μl of DNA, 5 μl of Buffer, 0.3 μl of TAQ DNA Polymerase (5 units per μl) and 1 μl dNTPs (10 mM). Cycling included initial denaturation at 95°C for 3 min followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 57°C for 1 min, and elongation at 72°C for 2 min and then a final elongation of 72°C for 10 min.

In the United States laboratory crude PCR products were sent to Eurofins (Luxembourg) to be purified and directly sequenced in the forward and reverse directions using the primers above. Samples in China were sent to Sangon Biotech (Shanghai, China) for sequencing in both the forward and reverse direction.

Phylogenetic Analyses

To show the potential of the primers and their ability to anneal to a variety of species in different genera, phylogenetic trees were constructed with a general focus on common powdery mildew complexes. A concatenated, GAPDH-CAM-GS-ITS-LSU-RPB2, tree was generated to show their potential to improve higher level support. In the concatenated tree, sequences from different specimens of Salmonomyces acalyphae were spliced together. Large gaps up to ∼20 bps were manually deleted in the ITS and GAPDH alignments prior to analyses. The regions evaluated were mined from the full genomes of Blumeria graminis (Assembly accession: GCA_905067625.1), Phyllactinia moricola (GCA 019455665), Pleochaeta shiraiana (GCA 019455505), Podosphaera cerasi (GCA 018398735), Podosphaera leucotricha (GCA 013170925), and Podosphaera xanthii (GCA 010015925 and GCA 014884795) to be included in some of the analyses. The full genome of Arachnopeziza araneosa (GCA_00398855) was chosen as an outgroup taxon based on the analyses by for the concatenated and single loci trees. An ITS + LSU tree was constructed using all the sequences obtained for comparative purposes. Sequences were aligned and edited using MUSCLE in MEGA11:Molecular Evolutionary Genetics Analysis version 11 (). A GTR + G + I evolutionary model was used for phylogenetic analyses as it is the most inclusive model of evolution and includes all other evolutionary models (). A fixed parameter-rich model (such as GTR + G + I) can be used in lieu of running a test to select the most suitable evolutionary model ().

For all the trees the phylogeny was inferred using Bayesian analysis using a Yule tree prior () and a strict molecular clock, in the program BEAST version 1.10.4 (). A single MCMC chain of 106 steps was run, with a burn-in of 10%. Posterior probabilities were calculated from the remaining 9,000 sampled trees. A maximum clade credibility tree was produced using TreeAnnotator version 1.10.4 (part of the BEAST package). Stationarity was confirmed by running the analysis multiple times, which revealed convergence between runs. The resulting tree was visualized using FigTree version 1.3.1 (Rambaut, 2009)3. A maximum likelihood analysis was accomplished using raxmlGUI () under the default settings with a GTR + G + I evolutionary model. Bootstrap analyses were conducted using 1,000 replications ().

Results

Primer Construction and Sequencing

Eight primers were successfully constructed and applied to 11 out of the 19 powdery mildew genera (Table 2). For the GAPDH region we sequenced an herbarium specimen that was 83 years old (1938: FH00112205). We were unable to sequence the specimen from 1938 using the other regions likely due to the size of the amplicons. For the GS, RPB2, and CAM regions multiple specimens were sequenced that were up to 3 years old. In total 55 sequences were generated from the ITS/LSU loci and 310 sequences were generated from non-rDNA loci: 74 from CAM, 134 from the GAPDH, 52 from GS, and 50 from RPB2. Of these 310 sequences, 154 (43 from GAPDH, 38 from CAM, 44 from RPB2, and 29 from GS) were used for phylogenetic analysis and deposited in GenBank. In the course of the study, the GAPDH primers were found to anneal to other fungi. In particular, multiple Ampelomyces sequences were generated that aligned with both GCA 018398575 and GCA 010094095. We deposited 3 GAPDH sequences from Ampelomyces spp. in GenBank that could potentially assist future researchers evaluating GAPDH of Ampelomyces spp.

Phylogenetic Analyses

Amplicons for the specimens obtained were deposited in GenBank (Table 1). Sequences from the GAPDH, GS, CAM, and RPB2 regions were evaluated individually and in a concatenated tree that included ITS + LSU sequences. A separate ITS + LSU tree from the sequences obtained in this study is presented in Supplementary Figure 1. Six phylogenetic trees were constructed and presented (Figures 16). For the majority of these regions, no additional sequences were available on GenBank and could not be evaluated for phylogenetic purposes. A maximum clade credibility tree was constructed using Bayesian analyses from the single loci and combined sequences. Posterior probabilities > 90 are displayed followed by bootstrap values greater than 70% for the maximum likelihood (ML) analyses conducted. The representative maximum clade credibility tree is illustrated in Figure 1.

FIGURE 1

FIGURE 2

FIGURE 3

FIGURE 4

FIGURE 5

FIGURE 6

. Taxa names are followed by host taxa, collection locality and GenBank numbers.

The phylogenetic analyses revealed that the different regions have great potential for splitting up the ITS + LSU complexes and increasing the backbone support of the powdery mildews. In the ITS + LSU tree (Supplementary Figure 1) there is no support seen within the E. aquilegiae or G. ambrosiae clade whereas support is seen within the E. aquilegiae clade in the concatenated (Figure 1) and RPB2 tree (Figure 2) and the G. ambrosiae clade in the GAPDH tree (Figure 6). There is also much better higher level support throughout the concatenated tree than in the ITS + LSU tree alone (Supplementary Figure 1). For example, in the concatenated tree (Figure 1), there is high support that E. convolvuli and E. vaccinii form a clade yet no support for this grouping in the ITS + LSU tree. Additionally, in the ITS + LSU, unlike the concatenated tree, there is no support for the placement of Blumeria and the Phyllactinia-Leveillula clade.

Discussion

The evaluation of protein-coding genes for phylogenetic analyses has largely been understudied in the powdery mildews. Relying solely on rDNA in analyses has led to the recognition of species complexes that group morphologically dissimilar taxa that are genetically similar in ITS and LSU profiles. In the present study, we designed primers for four protein coding genes. We have shown that these genes have potential for refining taxonomic/phylogenetic studies of the powdery mildews. Additionally, the divergent nature of these genes shows their potential in phylogenetic/taxonomic studies.

Secondary Barcodes

In recent years the ITS region has come under scrutiny due to its potential for intragenomic variation and its inability to differentiate cryptic species (; ; ; ). Studies are finding that the ITS and adjacent LSU regions are unable to identify a large percentage of species, emphasizing the importance of secondary markers for certain fungal lineages (; ). Secondary barcodes can be important for understanding the species and evolutionary relationships in the Kingdom Fungi and in particular, the Ascomycota (; ; ; ; ). Recently, secondary markers including TEF1α, TOP1, and PGK have been established for species identification in fungi (; ).

There have been two powdery mildew phylogenetic/taxonomic publications that evaluated secondary barcodes to resolve complexes. used five genes (ITS, LSU, IGS, TUB2, and CHS1) to increase resolution in the Golovinomyces ambrosiae complex. Using solely GAPDH (Figure 6) we were able to delimit taxa of this complex, consistent with . used four genes (ITS, CHS1, and fragments of two unnamed orthologous genes) to split the Blumeria graminis complex into eight separate species. One limitation of is that using unnamed orthologous genes and their associated primers can be difficult to apply broadly to other powdery mildew taxa.

In the present research we have shown that the genes evaluated have the potential to resolve multiple powdery mildew complexes. For example, the E. aquilegiae complex forms well supported groups in the concatenated tree, as well as in some of the single loci (RpB2, RPB2, and GAPDH) trees (Figures 1, 2, 4, 5). Additionally, groups, such as the Podosphaera xanthii complex, will likely be able to be clarified by taking a multi-locus approach on a range of hosts from throughout the world. GAPDH is especially promising for the P. xanthii complex where in phylogenetic analysis two separate groups formed (Figure 5). The divergent nature of some of these sequences of species with close ITS affinity, provides evidence that the ITS could not be accounting for evolutionary relationships within the powdery mildews. GAPDH is phylogenetically informative for cryptic species (; ) in other fungal systems and should be applied broadly to the powdery mildews. We suggest that GAPDH be used in conjunction with ITS for species identification due to the high variation between GAPDH sequences and the GAPDH primers ability to anneal to herbarium specimens.

Building a Better Backbone

Higher level support, not observed in previous powdery mildew studies (; ), can be seen in the concatenated tree (Figure 1). Additionally, each region evaluated generally follows the species/genus concepts established for the powdery mildews (Figures 15). The phylogenetic analyses presented using these underexplored loci demonstrate their potential to resolve relationships in major clades and to determine the powdery mildew sister group. The exploration of additional loci will also likely lead to major genus level taxonomic changes. For example, in the RPB2 tree (Figure 2) Arthrocladiella is nested in the Golovinomyces clade. This situation is also seen in the CAM and GS tree where Salmonomyces is nested within the Erysiphe clade (Figures 3, 4). When evaluating “6” gene phylogenies, limitations, including single genes having a comparatively large evolutionary pull, need to be considered before any conclusions are made. For example, in the present manuscript the placement of Blumeria (Figure 2) does not align with previous studies (; ) that placed Blumeria sister to Podosphaera. It is likely that the RPB2 and GS loci are driving the evolution of Blumeria. Additional taxa, genomic regions and above all, full genome sequences need to be acquired and analyzed to solidify the taxonomy and phylogeny of this group.

Conclusion

The presented sequences now located in GenBank can serve as reference sequences to help future researchers determine the genus and species present in their collections. The primers evaluated were able to anneal to a broad range of powdery mildew species in multiple genera (Table 2). Future research can employ these primers to assist in phylogenetic and taxonomic studies of species complexes to elucidate the evolutionary relationships of the species in question. Furthermore, the sequences evaluated revealed limited contamination showing the primers specificity to powdery mildews except for the GAPDH primers which readily annealed to Ampelomyces quisqualis s. lat. (the mycopathogen of powdery mildew). The secondary barcode sequences provided can be further mined to generate species/genus specific primers and to improve success with herbarium specimens. Interspecies variation in virulence and fungicide resistance as well as the host specific nature of powdery mildews emphasizes the importance of species identification for these economically important plant pathogens.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Author contributions

MB designed the experiment, wrote the manuscript, conducted the phylogenetic analysis, designed some of the primers, and sequenced the specimens from the United States. G-XG sequenced the specimens from China and submitted all the sequences to GenBank. LN designed some of the primers. UB helped design the experiment. S-YL helped fund the manuscript and assisted with sequencing the specimens from China. DP helped design the experiment and obtain funding for the analyses. All authors assisted with editing the manuscript.

Funding

We would like to thank the National Natural Science Foundation of China (31970019 and U21A20177), the Daniel E. Stuntz Memorial Foundation, the Puget Sound Mycological Society, and the Sonoma County Mycological Association for funding this research.

Acknowledgments

We would like to thank the curatorial team at FH for helping with the specimens and the staff of the Arnold Arboretum for allowing access to collect fresh specimens. We would also like to thank Daniel Murphy at the Idaho Botanical Garden, Tom G. Potterfield and Elan Alford at the Mt. Cuba Center, Cindy Newlander at the Denver Botanical Garden, Erin Buchholz at the Minnesota Landscape Arboretum, Anna Bower at Lotus land, and Wade Enos at the Atlanta Botanica Garden for helping with specimen collections.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fevo.2022.918908/full#supplementary-material

Supplementary Figure 1

Bayesian maximum clade credibility tree of sequences generated for the current study for the ITS + LSU region.

Footnotes

1.^Liu, L., Bradshaw, M., Braun, U., Götz, M., Khodaparast, S. A., Liu, T.-Z., et al. (2022). Phylogeny and taxonomy of Erysiphe berberidis (s. lat.) revisited. Mycoscience.

2.^https://www.geneious.com

3.^Rambaut, A. (2009). Fig Tree ver. 1.3.1.. Available online at: http://tree.bio.ed.ac.uk/software/figtree

References

Summary

Keywords

erysiphaceae, molecular phylogeny, multi-locus, powdery mildews, species complexes

Citation

Bradshaw MJ, Guan G-X, Nokes L, Braun U, Liu S-Y and Pfister DH (2022) Secondary DNA Barcodes (CAM, GAPDH, GS, and RpB2) to Characterize Species Complexes and Strengthen the Powdery Mildew Phylogeny. Front. Ecol. Evol. 10:918908. doi: 10.3389/fevo.2022.918908

Received

21 April 2022

Accepted

09 May 2022

Published

14 June 2022

Volume

10 - 2022

Edited by

Danny Haelewaters, Ghent University, Belgium

Reviewed by

Arthur Grupe, University of Florida, United States; Ning Zhang, Rutgers, The State University of New Jersey, United States

Updates

Copyright

*Correspondence: Michael J. Bradshaw, Shu-Yan Liu,

This article was submitted to Phylogenetics, Phylogenomics, and Systematics, a section of the journal Frontiers in Ecology and Evolution

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics