Abstract
Background: Liver fibrosis is a complex inflammatory and fibrogenic process, and the progression of fibrosis leads to cirrhosis. The only therapeutic approaches are the removal of injurious stimuli and liver transplantation. Therefore, the development of anti-fibrotic therapies is desired. Palmitoylethanolamide (PEA) is an endogenous fatty acid amide belonging to the N-acylethanolamines family and contained in foods such as egg yolks and peanuts. PEA has therapeutic anti-inflammatory, analgesic, and neuroprotective effects. However, the effects and roles of PEA in liver fibrosis remain unknown. Here we investigated the therapeutic effects of PEA in rats with liver fibrosis.
Methods: We conducted in vitro experiments to investigate the effects of PEA on the activation of hepatic stellate cells (HSCs, LX-2). Liver fibrosis was induced by an intraperitoneal injection of 1.5 mL/kg of 50% carbon tetrachloride twice a week for 4 weeks. Beginning at 3 weeks, PEA (20 mg/kg) was intraperitoneally injected thrice a week for 2 weeks. Then rats were sacrificed and we performed histological and quantitative reverse-transcription polymerase chain reaction analyses.
Results: The expression of α-smooth muscle actin (SMA) induced by transforming growth factor (TGF)-β1 in HSCs was significantly downregulated by PEA. PEA treatment inhibited the TGF-β1-induced phosphorylation of SMAD2 in a dose-dependent manner, and upregulated the expression of SMAD7. The reporter gene assay demonstrated that PEA downregulated the transcriptional activity of the SMAD complex upregulated by TGF-β1. Administration of PEA significantly reduced the fibrotic area, deposition of type I collagen, and activation of HSCs and Kupffer cells in rats with liver fibrosis.
Conclusion: Activation of HSCs was significantly decreased by PEA through suppression of the TGF-β1/SMAD signaling pathway. Administration of PEA produced significant improvement in a rat model of liver fibrosis, possibly by inhibiting the activation of HSCs and Kupffer cells. PEA may be a potential new treatment for liver fibrosis.
Introduction
Liver fibrosis is a complex inflammatory and fibrogenic process that results from chronic liver injury (). It is characterized by the excessive deposition of extracellular matrix proteins including collagen, and by activation of HSCs and Kupffer cells (; ; ). HSCs, once activated, are responsible for liver fibrosis (). A significant increase in TGF-β expression is observed in the activated HSCs (). TGF-β family members (TGF-β1, -β2, and -β3) are induced and activated in a variety of fibrotic diseases (; ). The progression of liver fibrosis leads to cirrhosis, a condition characterized by distortion of the normal liver architecture, the formation of septae/nodules, portal hypertension, and eventually tumor formation (; ). The only therapeutic approaches are removal of the injurious stimuli and liver transplantation, which is limited by organ shortages, high associated expenses, and the need for lifelong immunosuppressive medications (; ). Therefore, development of anti-fibrotic therapies is a major area of unmet clinical need.
Palmitoylethanolamide is an endogenous fatty acid amide belonging to the N-acylethanolamines (NAEs) family, and contained in foods such as egg yolks, peanuts, and soy seeds (; ; ). PEA is synthesized “on-demand” during a variety of inflammatory disease states and produces marked protective properties for inflammatory responses and pruritus (; ). Furthermore, PEA has therapeutic analgesic and neuroprotective effects, acting at different molecular targets such as tumor necrosis factor (TNF)-α, vascular endothelial growth factor (VEGF), and intercellular adhesion molecules (ICAM)-1 (; ; ; ). PEA reduces lung inflammation in mice with pulmonary fibrosis (), and is able to modulate activation of one or more members of the PPAR family of nuclear receptors and/or a cannabinoid CB2-like receptor (). In addition, PPARα is required for the anti-inflammatory actions of PEA (), and presence of PPARα mRNA in HSCs () and suppressive effect of PPARα agonist Wy-14,643 on liver fibrosis () have been reported. However, the effects and roles of PEA in liver fibrosis remain unknown. The aim of this study was to examine the effects of PEA on liver fibrosis in rats and to investigate its underlying mechanisms.
Materials and Methods
Reagents
Palmitoylethanolamide, MK886, a PPARα antagonist, and GW6471, a PPARα antagonist, were purchased from Cayman Chemical (Ann Arbor, MI, United States). PEA was dissolved in dimethyl sulfoxide (Wako Pure Chemical Industries, Osaka, Japan) for the in vitro experiments, and dissolved in a vehicle composed of Tween 80 (Kanto Chemical, Tokyo, Japan), dimethyl sulfoxide, and phosphate-buffered saline (PBS, Life Technologies, Carlsbad, CA, United States) (1:0.5:18.5 by volume) for the in vivo experiments.
Cell Culture
LX-2 cells, immortalized human HSCs, were purchased from Merck Millipore (Billerica, MA, United States). In all experiments, the cells were subjected to no more than 15 cell passages. The cells were cultured in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, Waltham, MA, United States) containing 2% fetal bovine serum (Moregate Biotech, Bulimba, QLD, Australia), 100 U/mL of penicillin, and 100 μg/mL of streptomycin (Wako Pure Chemical Industries), and maintained at 37°C in a humidified atmosphere of 5% CO2. The medium was changed every other day. Human embryonic kidney cells (HEK293, provided by the RIKEN BioResource Center, Tsukuba, Japan) or their derivatives, which were stably transfected with the human Toll-like receptor (TLR) 4a, MD2, and CD14 genes (293/hTLR4A-MD2-CD14; InvivoGen, San Diego, CA, United States), were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 100 U/mL of penicillin, and 100 μg/mL of streptomycin. 293/hTLR4A-MD2-CD14 cells were activated by lipopolysaccharide (LPS; Sigma-Aldrich, St. Louis, MO, United States) treatment.
Western Blot Analysis
To investigate the phosphorylation of SMAD2 and expression of α-SMA, LX-2 cells were plated into six-well plates (2 × 105 cells/well, Corning, Corning, NY, United States) and cultured. The next day, the culture medium was changed to a medium containing PEA or dimethyl sulfoxide, and the cells were incubated for an additional 30 min or 1 h. Then cells were treated with 2.0 ng/mL of TGF-β1 (PeproTech, Rocky Hill, NJ, United States) for 30 min, 24 h, and 72 h, and washed with ice-cold PBS. Cell lysates were prepared using a radio-immunoprecipitation assay (RIPA) buffer containing 50 mM Tris-HCl (pH8.0), 150 mM NaCl, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) sodium dodecyl sulfate (SDS), 1.0% (w/v) NP-40 substitute, and Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology, Beverly, MA, United States). Equal amounts of cellular protein extracts were diluted in a 4 × Laemmli sample buffer (Bio-Rad, Hercules, CA, United States). The samples were heated at 95°C for 5 min and then subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE, Bio-Rad). The separate proteins were transferred to Immobilon-P polyvinylidene difluoride (PVDF) membranes (Merck Millipore), which were subsequently incubated in tris buffered saline with 0.05% Tween 20 (Wako Pure Chemical Industries) consisting of a 5% PhosphoBLOCKER blocking reagent (Cell Biolabs, San Diego, CA, United States) at room temperature for 60 min. The membranes were probed with primary antibodies for phospho-SMAD2 (1:2000; Cell Signaling Technology), SMAD2/3 (1:2000; Cell Signaling Technology), α-SMA (1:1000; Abcam, Cambridge, United Kingdom) and bound antibodies were detected with peroxidase AffiniPure Goat Anti-Mouse IgG (H + L) (1:10,000; Jackson ImmunoResearch, West Grove, PA, United States) or peroxidase AffiniPure Goat Anti-Rabbit IgG (H + L) (1:10,000; Jackson ImmunoResearch), and visualized and photographed using ECL Prime detection reagent (GE Healthcare, Chicago, IL, United States). The blots were analyzed using ImageQuant LAS-4000 (Fujifilm, Tokyo, Japan).
Plasmids
cDNAs of TGF-β receptor 1 (TGFβR-1) and SMAD2 were obtained by RT-PCR and the resulting fragments were cloned into pCI-neo-HA(c) and pCMV-3 × FLAG. Active mutants of TGFβR-1 (T204D) () and SMAD2-2D (S465D/S467D) () were consecutively generated using a PCR-based method.
Transient Transfection and Reporter Gene Assay
LX-2 cells and HEK293 cells were plated into 24-well plates (Corning) containing 500 μL of culture medium (4.0 × 104 cells/well and 1.25 × 105 cells/well, respectively). After incubation for 24 h at 37°C, cells were transfected with 25 ng of luciferase plasmid DNA with 25 ng of Renilla pGL4.74(hRluc/TK) vector (Promega, Madison, WI, United States) as an internal control, and 500 ng of plasmid DNA containing three copies of a SMAD binding element that drove the transcription of the luciferase reporter gene [pGL4.48(luc2P/SBE/Hygro), Promega], using Lipofectamine® LTX (Life Technologies). After 24 h of incubation at 37°C, the cells were treated with 1.0 ng/mL of TGF-β1 for 3 h; a reporter gene assay was performed using the Dual Luciferase Reporter Assay System (Promega). Luminescence intensity was measured using a GloMax®-Multi Detection System (Promega) according to manufacturer’s instructions. Transcription activity was normalized according to the Renilla luciferase activity. These experiments were performed in triplicate.
Immunofluorescent Staining
LX-2 cells were plated into a eight-well coverglass chamber (Asahi Glass, Tokyo, Japan), and pretreated with PEA for 1 h. Then, the cells were incubated with 2.0 ng/mL of TGF-β1 for 24 h. After incubation, the cells were washed with PBS, and then fixed in 100% methanol (Wako Pure Chemical Industries) for 15 min at 4°C. The cells were blocked with 2% human serum albumin (The Chemo-Sero-Therapeutic Research Institute, Kumamoto, Japan) in PBS for 1 h at 4°C. A primary antibody against α-SMA (1:250; Abcam) was incubated for 2 h at 4°C, and then the cells were incubated with a fluorescein-labeled secondary antibody (1:2000; Cell Signaling Technology) for 1 h. Samples were imaged using a fluorescence microscopy (Olympus, Tokyo, Japan). Fluorescent intensities were analyzed using ImageJ (NIH, Bethesda, MD, United States). At least 10 cells were included in the analysis for each condition.
Animals
This study was carried out in accordance with the recommendations of the Animal Care Unit and Use Committees of Hokkaido University. The protocol was approved by the Animal Care Unit and Use Committees of Hokkaido University. Six-week-old male Sprague-Dawley rats were procured from Japan SLC (Hamamatsu, Japan), and three rats were housed per cage in a temperature-controlled room (24°C) on a 12-h/12-h light/dark cycle. All rats had ad libitum access to standard chow and water.
Induction of Liver Fibrosis and PEA Treatment
Liver fibrosis was induced by an intraperitoneal injection of 1.5 mL/kg of 50% carbon tetrachloride (CCl4, Wako Pure Chemical Industries) in olive oil twice a week for 4 weeks (Figure 1). The control group rats were injected with olive oil alone. PEA (20 mg/kg) was injected intraperitoneally thrice a week after 2 weeks of CCl4 treatment. The dose of PEA was based on a previously reported study ().
FIGURE 1
Histological Examination
The rats were sacrificed after 4 weeks of CCl4 treatment. The left lobe of the liver was removed, fixed in 40 g/L of formaldehyde saline, embedded in paraffin, and cut into 5-μm sections. Tissue sections were stained with Hematoxylin and Eosin (H&E) and Masson’s trichrome. We photographed 10 random fields on a section from each rat, and calculated the blue-stained area from the entire liver cross-sectional area (%, ×100) with a digital image analyzer (WinROOF; Mitani, Co., Fukui, Japan).
Immunohistochemical Examination
The tissue sections were stained with anti-rat type I collagen antibody (1:100,000; LSL, Tokyo, Japan) for 60 min at room temperature. To assess HSC activation, the tissue sections were stained with anti-rat α-SMA antibody (1:800, Thermo Fisher Scientific) for 30 min at room temperature. To assess the infiltration of Kupffer cells, the tissue sections were stained with anti-rat CD68 monoclonal antibody (1:50; AbD Serotec, Kidlington, United Kingdom) for 40 min at room temperature. We photographed 10 random fields on a section from each rat, and measured the stained areas from the entire liver cross-sectional area using a digital image analyzer (WinROOF).
RNA Isolation and Quantitative RT-PCR
Total RNA of cultured cells or the rat liver was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany), and 1 μg of the total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent Kit (Takara Bio, Kusatsu, Japan). PCR was performed using a 25-μL reaction mixture that contained 1 μL of cDNA and 12.5 μL Platinum SYBR Green PCR Mix (Life Technologies). β-actin messenger RNA that was amplified from the same samples served as an internal control. After initial denaturation at 95°C for 2 min, we used a two-step cycle procedure (denaturation at 95°C for 15 s, annealing and extension at 60°C for 1 min) for 40 cycles in a 7700 Sequence Detector (Applied Biosystems, Foster City, CA, United States). Gene expression levels were determined using the comparative threshold cycle (ΔΔCt) method with β-actin used as an endogenous control. Data were analyzed with Sequences Detection Systems software (Applied Biosystems). Primer sequences are shown in Table 1.
Table 1
| human TNF-α F | CAGCCTCTTCTCCTTCCTGA |
| human TNF-α R | GCCAGAGGGCTGATTAGAGA |
| human α-SMA F | CCGACCGAATGCAGAAGGA |
| human α-SMA R | ACAGAGTATTTGCGCTCCGAA |
| human collagen1a1 F | GCTCCTCTTAGGGGCCACT |
| human collagen1a1 R | CCACGTCTCACCATTGGGG |
| human SMAD7 F | TCCTGCTGTGCAAAGTGTTC |
| human SMAD7 R | TTGTTGTCCGAATTGAGCTG |
| human β-actin F | CCAACCGCGAGAAGATGA |
| human β-actin R | CCAGAGGCGTACAGGGATAG |
| rat α-SMA F | GACACCAGGGAGTGATGGTT |
| rat α-SMA R | GTTAGCAAGGTCGGATGCTC |
| rat collagen1a1 F | GATGGCTGCACGAGTCACAC |
| rat collagen1a1 R | ATTGGGATGGAGGGAGTTTA |
| rat TGF-β F | CTGCTGACCCCCACTGATAC |
| rat TGF-β R | AGCCCTGTATTCCGTCTCCT |
| rat TNF-α F | GGCTCCCTCTCATCAGTTCCA |
| rat TNF-α R | CGCTTGGTGGTTTGCTACGA |
| rat TIMP1 F | GACCACCTTATACCAGCGTT |
| rat TIMP1 R | GTCACTCTCCAGTTTGCAAG |
| rat MMP9 F | TTATTGTGAGCATCCCTAGGG |
| rat MMP9 R | AGTGTCCGAGGAAGATACTTG |
| rat PPARα F | AATCCACGAAGCCTACCTGA |
| rat PPARα R | GTCTTCTCAGCCATGCACAA |
| rat CD68 F | TCACAAAAAGGCTGCCACTCTT |
| rat CD68 R | TCGTAGGGCTTGCTGTGCTT |
| rat MCP-1 F | CTGTCTCAGCCAGATGCAGTTAA |
| rat MCP-1 R | AGCCGACTCATTGGGATCAT |
| rat LBP F | AACATCCGGCTGAACACCAAG |
| rat LBP R | CAAGGACAGATTCCCAGGACTGA |
| rat β-actin F | AAGATGACCCAGATCATGTT |
| rat β-actin R | TTAATGTCACGCACGATTTC |
Primer sequences.
F, forward; R, reverse.
Statistical Analysis
Data are expressed as mean ± standard deviation (SD). Parameters among the groups were compared by one-way ANOVA, followed by Tukey’s test. The difference was considered significant at p < 0.05. All analyses were performed using the GraphPad Prism, version 7 (GraphPad software, San Diego, CA, United States).
Results
PEA Suppresses LPS-Induced Inflammatory Reaction and TGF-β1-Induced Activation of HSCs in Vitro
We first investigated the anti-inflammatory effect of PEA in 293/hTLR4A-MD2-CD14 cells. Treatment with LPS significantly upregulated the expression of TNF-α, and PEA significantly and dose-dependently decreased the expression of TNF-α (Figure 2A). We next examined whether PEA suppresses TGF-β1-induced activation of LX-2 cells. Treatment with TGF-β1 significantly upregulated the expression of α-SMA, and PEA significantly downregulated the expression of α-SMA in a dose-dependent manner (Figure 2B). Similarly, Western blotting and immunofluorescent staining demonstrated that PEA decreased the protein levels of α-SMA that were induced by TGF-β1 (Figures 2C,D, respectively). Furthermore, treatment with TGF-β1 significantly increased the expression of collagen1a1 (COL1A1) in LX-2 cells, and PEA significantly decreased the expression of COL1A1 (Figure 2E). However, the inhibitory effect of PEA on activation of LX-2 cells were not canceled by PPARα antagonist MK886 and GW6471 (Figures 2F,G, respectively). These results suggest that PEA suppresses LPS-induced inflammatory reaction and TGF-β1-induced fibrogenic reaction. In addition, the mechanisms of the inhibitory effect on HSC activation are independent of PPARα.
FIGURE 2
PEA Suppresses Phosphorylation of SMAD2 and Upregulates SMAD7
We next investigated whether PEA affects the TGF-β/SMAD pathway. Western blotting demonstrated that TGF-β1 treatment induced the phosphorylation of SMAD2, and PEA treatment inhibited the TGF-β1-induced phosphorylation of SMAD2 in a dose-dependent manner (Figure 3A). In addition, treatment with TGF-β1 significantly increased the expression of SMAD7, an inhibitor of the SMAD pathway, and PEA treatment further increased the expression of SMAD7 (Figure 3B). The reporter gene assay demonstrated that TGF-β1 markedly upregulated the transcription activity of the SMAD complex, and it was significantly downregulated by PEA (Figure 3C). Overexpression of TGFβR-1 (T204D), a constitutively active form of TGFβR-1, significantly upregulated the transcription activity of the SMAD complex, but PEA did not suppress luciferase activity (Figure 3D). Furthermore, overexpression of SMAD2-2D (S465D/S467D), a constitutively active form of SMAD2, also significantly elevated the transcription activity of the SMAD complex, but PEA did not suppress the luciferase activity (Figure 3E). These results suggest that PEA suppresses an early step of TGF-β/SMAD pathway in LX-2 cells.
FIGURE 3
PEA Suppresses Liver Fibrosis in Rats
We investigated the effects of PEA on liver fibrosis in rats. In H&E staining, the thick fibrotic septa and pseudolobular formation were more extensive in the CCl4 group compared to the PEA group (Figure 4A). Masson’s trichrome staining demonstrated that fiber accumulation induced by CCl4 was significantly attenuated by administration of PEA for 2 weeks (Figure 4B). Consistent with this finding, the upregulated expression of type I collagen by CCl4 treatment was also attenuated by PEA administration (Figure 4C). The expression of α-SMA, a marker for HSC activation, was significantly increased in the CCl4 group; however, PEA administration significantly suppressed this increase (Figure 4D). The expression of CD68, a marker for Kupffer cells, was significantly increased in the CCl4 group; however, PEA administration decreased the infiltration of CD68-positive Kupffer cells (Figure 4E).
FIGURE 4
Effects of PEA Administration on Gene Expressions in the Liver
We next examined the expression of fibrosis-related genes in the liver. CCl4 treatment significantly increased the expression of α-Sma, collagen1a1 (Col1a1), Tgf-β, and tissue inhibitor of metalloproteinases (Timp)-1 (Figures 5A–C,E, respectively), and the expression of α-Sma, Col1a1 and Tgf-β were significantly decreased by administration of PEA (Figures 5A–C). The expression of Cd68 was significantly increased by CCl4; however, PEA significantly decreased the expression of Cd68 (Figure 5H). The expressions of monocyte chemoattractant protein (Mcp)-1 and Lbp tended to decrease following administration of PEA (Figures 5I,J, respectively). The expressions of matrix metalloproteinase (Mmp)-9, Tnf-α and Pparα were not affected by CCl4 treatment and PEA administration (Figures 5D,F,G, respectively).
FIGURE 5
Discussion
In this study, we investigated the anti-fibrotic effects of PEA in vitro and in vivo. We found that (i) PEA suppressed LPS-induced inflammatory reaction in vitro, (ii) PEA suppressed TGF-β1-induced activation of cultured HSCs, and (iii) PEA administration ameliorated liver fibrosis in rats.
The therapeutic effects of PEA were previously reported in small animals with intestinal radiation injuries (), uveitis (), and cortical spreading depression (). Proposed targets for PEA actions included a number of receptors, namely, cannabinoid receptors (), transient receptor potential vanilloid type-1 (TRPV1) ion channels (), the orphan G protein-coupled receptor 55 (GPR55) (), and PPARα (). PPARα is one of the main pharmacological targets of PEA action (). On the other hand, PPARα is prominently expressed in hepatocytes (), and PPARα ligands exert antifibrotic effects in rats with thioacetamide-induced liver cirrhosis (). Furthermore, PPARα agonists contrast inflammation and fibrosis in experimental models of steatohepatitis (). However, in the present study, PEA-induced inactivation of LX-2 cells was not canceled by PPARα antagonists, suggesting that PEA attenuates activation of HSCs, independent of PPARα. Furthermore, demonstrated that PEA attenuates the degree of inflammation while preserving the blood–retinal barrier in rats with experimental diabetic retinopathy. This study revealed that PEA treatment reduces VEGF levels of the retina tissues in diabetic rats, and suggested that PEA may directly inhibit VEGF or may affect VEGF expression through TNF-α via its effects on VEGFR-2.
The molecular mechanisms of HSC activation were recently investigated (; ). TGF-β1 is known to be the most potent pro-fibrogenic cytokine in HSCs’ activation (). We demonstrated that PEA inhibited the TGFβ-1-induced expression of fibrogenic genes, such as α-SMA and COL1A1 in LX-2 cells. TGF-β regulates numerous cell signaling pathways (), and the TGF-β/SMAD signaling pathway is one of the key fibrogenic and inflammatory pathways in the liver (). It is well-known that TGF-β activates downstream mediators SMAD2 and SMAD3, and the TGF-β/SMAD pathway is negatively regulated by SMAD7 (). Our in vitro study demonstrated that PEA inhibited phosphorylation of SMAD2 and upregulated SMAD7 in LX-2 cells. In addition, PEA suppressed transcription activity of the SMAD complex, and expression of their downstream target genes and proteins. TGF-β1 binds TGFβR-2 with high affinity, which then recruits the lower-affinity TGFβR-1 (). This induces the assembly of a complex that includes these receptors (). Within the complex, TGFβR-2 subunits phosphorylate TGFβR-1 (). Activated TGFβR-1 kinases recruit and phosphorylate SMAD proteins for signal transduction. Our in vitro study demonstrated that PEA did not suppress the transcription activity of the SMAD complex in HEK293 cells with overexpression of TGFβR-1 (T204D). Therefore, PEA may have suppressed the early steps of the TGF-β1/SMAD signaling pathway by interacting with TGFβR, or at the cell membrane.
In the present study, CCl4 was used to induce liver fibrosis. Liver fibrosis can be induced by one of the following approaches: (1) Chemical compounds and toxins. These agents cause direct injury to hepatocytes and trigger secondary inflammatory reaction in the liver, which in turn activate HSCs and result in fibrosis. Commonly used chemical agents include CCl4, thioacetamide, dimethyl nitrosamine, dioxin, sodium arsenate, and ethanol; (2) Special diet, such as choline-deficient, L-amino acid-defined, methionine-deficient diet, and high-fat diet; (3) Physical methods. Bile duct ligation creates obstruction of the extrahepatic bile duct; (4) Fibrosis induced by immune reaction; (5) Genetic modification (). Among above methods, bile duct ligation and CCl4 are well-validated models for fibrosis progression and resolution (). Therefore, we chose CCl4 to induce liver fibrosis in rats. This chemical changes the membrane permeability in liver mitochondria and plasm in various animals, and forms highly toxic free radicals, probably mediated by cytochrome p450 2E1 (). Its repeated and prolonged treatment (≥4 weeks) causes severe liver disease, such as fibrosis and cirrhosis (). In liver fibrosis, the accumulation of extracellular matrix is a hallmark feature, and the activation of HSCs is a precursor of this phenomenon. In the normal liver, HSCs are quiescent and not fibrogenic (); however, the cells are activated by inflammatory processes of liver injury, such as the production of toxic cytokines and the recruitment of inflammatory cells (). In the present study, we measured liver weight/body weight, and it was significantly increased by CCl4, and PEA treatment tended decrease the liver weight/body weight. The reason for this may be that it was the early stage of fibrosis with administration of CCl4 for 4 weeks (data are shown in Supplementary Materials). However, PEA administration suppressed CCl4-induced collagen deposition and activation of HSCs. In addition, PEA administration inhibited the expression of TGF-β in the liver. During liver injury, activated Kupffer cells secrete a large number of proinflammatory and fibrogenic mediators, which can drive HSC activation () and are main targets of LPS, through TLR4 (). In the present study, PEA suppressed activation of 293/hTLR4A-MD2-CD14 cells, and inhibited the infiltration of Kupffer cells in rats with CCl4-induced liver injury. It has been reported that PEA has anti-inflammatory effect (), and PEA can attenuate LPS-induced inflammatory responses in the murine macrophage cell line RAW264.7 (). Our in vitro experiment demonstrated that PEA has the anti-inflammatory effect in 293/hTLR4A-MD2-CD14 through LPS/TLR4 signal. Furthermore, macrophages are key-immune cells in the inflammatory process of liver fibrosis (), and responsible for liver cirrhosis induced by CCl4 (). For other representative immune cells, it has been reported that neutrophils did not infiltrate in CCl4-induced liver fibrosis model (). Therefore, we evaluated the expression of CD68 in our in vivo experiment, and PEA would attenuate liver fibrosis by inhibiting activation of HSCs as well as Kupffer cells.
Conclusion
PEA administration ameliorated fibrogenesis in a rat model of CCl4-induced liver fibrosis, possibly by attenuating the activation of HSCs and Kupffer cells. PEA administration may be a new therapeutic strategy for treating liver fibrosis, and should be investigated in other liver fibrosis models as well as human pathogenesis.
Statements
Data availability statement
The raw data supporting the conclusion of this manuscript will be made available by the authors, without undue reservation.
Author contributions
MO contributed to all experiments, data analysis, and manuscript writing. SO and NS contributed to conception and design, and final approval of the manuscript. HH, KY, QF, OM, and GS contributed to assembly of data and data analysis. All authors have read and approved the manuscript.
Funding
This study was supported by a Grant-in-Aid for Scientific Research (B) from the Japan Society for the Promotion of Science (JSPS, 16H05282).
Acknowledgments
We thank Megumi Kimura, Tomoe Shimazaki, and Akiko Hirano for their technical assistance.
Conflict of interest
GS has received honoraria from Bristol-Myers Squibb, MSD KK, and AbbVie. Naoya Sakamoto has received honoraria and research funding from Gilead Sciences, Bristol-Myers Squibb, MSD KK, Otsuka Pharm, Abbvie, Shionogi, and Takeda. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphar.2018.00709/full#supplementary-material
Abbreviations
- α-SMA
α-smooth muscle actin
- CCl4
carbon tetrachloride; Col1a1, collagen1a1
- HSC
hepatic stellate cell
- LBP
lipopolysaccharide-binding protein
- MMP
matrix metalloproteinase
- PBS
phosphate-buffered saline
- PEA
palmitoylethanolamide
- PPAR
peroxisome proliferator-activated receptor
- RT-PCR
reverse transcription-polymerase chain reaction
- TGF-β
transforming growth factor-β
- TGFβR
transforming growth factor-β receptor
- TIMPs
tissue inhibitor of metalloproteinases
- TNF-α
tumor necrosis factor-α
References
1
AmbrosinoP.SoldovieriM. V.RussoC.TaglialatelaM. (2013). Activation and desensitization of TRPV1 channels in sensory neurons by the PPARα agonist palmitoylethanolamide.Br. J. Pharmacol.1681430–1444. 10.1111/bph.12029
2
BatallerR.BrennerD. A. (2005). Liver fibrosis.J. Clin. Investig.115209–218. 10.1172/jci24282
3
CampanaL.IredaleJ. P. (2017). Regression of liver fibrosis.Semin. Liver Dis.371–10. 10.1055/s-0036-1597816
4
Di PaolaR.ImpellizzeriD.FuscoR.CordaroM.SiracusaR.CrupiR.et al (2016). Ultramicronized palmitoylethanolamide (PEA-um) in the treatment of idiopathic pulmonary fibrosis.Pharmacol. Res.111405–412. 10.1016/j.phrs.2016.07.010
5
DoerksT.CopleyR. R.SchultzJ.PontingC. P.BorkP. (2002). Systematic identification of novel protein domain families associated with nuclear functions.Genome Res.1247–56. 10.1101/gr.203201
6
EspositoE.CuzzocreaS. (2013). Palmitoylethanolamide in homeostatic and traumatic central nervous system injuries.CNS Neurol. Disord. Drug Targets1255–61. 10.2174/1871527311312010010
7
Farquhar-SmithW. P.JaggarS. I.RiceA. S. (2002). Attenuation of nerve growth factor-induced visceral hyperalgesia via cannabinoid CB1 and CB2-like receptors.Pain9711–21. 10.1016/S0304-3959(01)00419-5
8
FriedmanS. L. (2008). Hepatic fibrosis – overview.Toxicology254120–129. 10.1016/j.tox.2008.06.013
9
GovindenR.BhoolaK. D. (2003). Genealogy, expression, and cellular function of transforming growth factor-β.Pharmacol. Ther.98257–265. 10.1016/s0163-7258(03)00035-4
10
GressnerA. M.WeiskirchenR. (2006). Modern pathogenetic concepts of liver fibrosis suggest stellate cells and TGF-β as major players and therapeutic targets.J. Cell Mol. Med.1076–99. 10.1111/j.1582-4934.2006.tb00292.x
11
HanY. P.ZhouL.WangJ.XiongS.GarnerW. L.FrenchS. W.et al (2004). Essential role of matrix metalloproteinases in interleukin-1-induced myofibroblastic activation of hepatic stellate cell in collagen.J. Biol. Chem.2794820–4828. 10.1074/jbc.M310999200
12
HataA.ChenY. G. (2016). TGF-β signaling from receptors to smads.Cold Spring Harb. Perspect. Biol.8:a022061. 10.1101/cshperspect.a022061
13
Hernandez-GeaV.FriedmanS. L. (2011). Pathogenesis of liver fibrosis.Annu. Rev. Pathol.6425–456. 10.1146/annurev-pathol-011110-130246
14
HoareauL.RavananP.GonthierM. P.DelarueP.GoncalvesJ.CesariM.et al (2006). Effect of PEA on LPS inflammatory action in human adipocytes.Cytokine34291–296. 10.1016/j.cyto.2006.06.005
15
HuangY.DengX.LiangJ. (2017). Modulation of hepatic stellate cells and reversibility of hepatic fibrosis.Exp. Cell Res.352420–426. 10.1016/j.yexcr.2017.02.038
16
ImpellizzeriD.AhmadA.BruschettaG.Di PaolaR.CrupiR.PaternitiI.et al (2015). The anti-inflammatory effects of palmitoylethanolamide (PEA) on endotoxin-induced uveitis in rats.Eur. J. Pharmacol.76128–35. 10.1016/j.ejphar.2015.04.025
17
IpE.FarrellG.HallP.RobertsonG.LeclercqI. (2004). Administration of the potent PPARα agonist, Wy-14,643, reverses nutritional fibrosis and steatohepatitis in mice.Hepatology391286–1296. 10.1002/hep.20170
18
KhanR. A.KhanM. R.SahreenS.AhmedM.ShahN. A. (2015). Carbon tetrachloride-induced lipid peroxidation and hyperglycemia in rat: a novel study.Toxicol. Ind. Health31546–553. 10.1177/0748233713475503
19
KilaruA.BlancaflorE. B.VenablesB. J.TripathyS.MysoreK. S.ChapmanK. D. (2007). The N-acylethanolamine-mediated regulatory pathway in plants.Chem. Biodivers.41933–1955. 10.1002/cbdv.200790161
20
LiP.HeK.LiJ.LiuZ.GongJ. (2017). The role of Kupffer cells in hepatic diseases.Mol. Immunol.85222–229. 10.1016/j.molimm.2017.02.018
21
LiuX.HuH.YinJ. Q. (2006). Therapeutic strategies against TGF-β signaling pathway in hepatic fibrosis.Liver Int.268–22. 10.1111/j.1478-3231.2005.01192.x
22
Lo VermeJ.FuJ.AstaritaG.La RanaG.RussoR.CalignanoA.et al (2005). The nuclear receptor peroxisome proliferator-activated receptor-α mediates the anti-inflammatory actions of palmitoylethanolamide.Mol. Pharmacol.6715–19. 10.1124/mol.104.006353
23
LoVermeJ.La RanaG.RussoR.CalignanoA.PiomelliD. (2005). The search for the palmitoylethanolamide receptor.Life Sci.771685–1698. 10.1016/j.lfs.2005.05.012
24
MaciasM. J.Martin-MalpartidaP.MassagueJ. (2015). Structural determinants of Smad function in TGF-β signaling.Trends Biochem. Sci.40296–308. 10.1016/j.tibs.2015.03.012
25
MiyaharaT.SchrumL.RippeR.XiongS.YeeHFJrMotomuraK.et al (2000). Peroxisome proliferator-activated receptors and hepatic stellate cell activation.J. Biol. Chem.27535715–35722. 10.1074/jbc.M006577200
26
MurielP.EscobarY. (2003). Kupffer cells are responsible for liver cirrhosis induced by carbon tetrachloride.J. Appl. Toxicol.23103–108. 10.1002/jat.892
27
PaternitiI.Di PaolaR.CampoloM.SiracusaR.CordaroM.BruschettaG.et al (2015). Palmitoylethanolamide treatment reduces retinal inflammation in streptozotocin-induced diabetic rats.Eur. J. Pharmacol.769313–323. 10.1016/j.ejphar.2015.11.035
28
PertweeR. G. (2007). GPR55: a new member of the cannabinoid receptor clan?Br. J. Pharmacol.152984–986. 10.1038/sj.bjp.0707464
29
ReG.BarberoR.MioloA.Di MarzoV. (2007). Palmitoylethanolamide, endocannabinoids and related cannabimimetic compounds in protection against tissue inflammation and pain: potential use in companion animals.Vet. J.17321–30. 10.1016/j.tvjl.2005.10.003
30
RichterF.KoulenP.KajaS. (2016). N-palmitoylethanolamine prevents the run-down of amplitudes in cortical spreading depression possibly implicating proinflammatory cytokine release.Sci. Rep.6:23481. 10.1038/srep23481
31
RossR. A.BrockieH. C.PertweeR. G. (2000). Inhibition of nitric oxide production in RAW264.7 macrophages by cannabinoids and palmitoylethanolamide.Eur. J. Pharmacol.401121–130. 10.1016/S0014-2999(00)00437-4
32
SenooH.MezakiY.FujiwaraM. (2017). The stellate cell system (vitamin A-storing cell system).Anat. Sci. Int.92387–455. 10.1007/s12565-017-0395-9
33
SouchelnytskyiS.TamakiK.EngstromU.WernstedtC.ten DijkeP.HeldinC. H. (1997). Phosphorylation of Ser465 and Ser467 in the C terminus of Smad2 mediates interaction with Smad4 and is required for transforming growth factor-β signaling.J. Biol. Chem.27228107–28115. 10.1074/jbc.272.44.28107
34
TackeF.ZimmermannH. W. (2014). Macrophage heterogeneity in liver injury and fibrosis.J. Hepatol.601090–1096. 10.1016/j.jhep.2013.12.025
35
ToyamaT.NakamuraH.HaranoY.YamauchiN.MoritaA.KirishimaT.et al (2004). PPARα ligands activate antioxidant enzymes and suppress hepatic fibrosis in rats.Biochem. Biophys. Res. Commun.324697–704. 10.1016/j.bbrc.2004.09.110
36
van DijkF.OlingaP.PoelstraK.BeljaarsL. (2015). Targeted therapies in liver fibrosis: combining the best parts of platelet-derived growth factor BB and interferon gamma.Front. Med.2:72. 10.3389/fmed.2015.00072
37
WangJ.CenP.ChenJ.FanL.LiJ.CaoH.et al (2017). Role of mesenchymal stem cells, their derived factors, and extracellular vesicles in liver failure.Stem Cell Res. Ther.8:137. 10.1186/s13287-017-0576-4
38
WangJ.ZhengJ.KulkarniA.WangW.GargS.PratherP. L.et al (2014). Palmitoylethanolamide regulates development of intestinal radiation injury in a mast cell-dependent manner.Dig. Dis. Sci.592693–2703. 10.1007/s10620-014-3212-5
39
WeissA.AttisanoL. (2013). The TGFbeta superfamily signaling pathway.Wiley Interdiscip. Rev. Dev. Biol.247–63. 10.1002/wdev.86
40
WieserR.WranaJ. L.MassagueJ. (1995). GS domain mutations that constitutively activate T βR-I, the downstream signaling component in the TGF-β receptor complex.EMBO J.142199–2208.
41
XuF.LiuC.ZhouD.ZhangL. (2016). TGF-β/SMAD pathway and its regulation in hepatic fibrosis.J. Histochem. Cytochem.64157–167. 10.1369/0022155415627681
42
XuJ.LiuX.KoyamaY.WangP.LanT.KimI. G.et al (2014). The types of hepatic myofibroblasts contributing to liver fibrosis of different etiologies.Front. Pharmacol.5:167. 10.3389/fphar.2014.00167
43
XuL.HuiA. Y.AlbanisE.ArthurM. J.O’ByrneS. M.BlanerW. S.et al (2005). Human hepatic stellate cell lines, LX-1 and LX-2: new tools for analysis of hepatic fibrosis.Gut54142–151. 10.1136/gut.2004.042127
44
Ying-YingY.LinH. C. (2010). Endocannabinoids and non-endocannabinoid fatty acid amides in cirrhosis.Liver Int.30780–781. 10.1111/j.1478-3231.2010.02244.x
45
YoshidaK.MurataM.YamaguchiT.MatsuzakiK. (2014). TGF-β/Smad signaling during hepatic fibro-carcinogenesis (review).Int. J. Oncol.451363–1371. 10.3892/ijo.2014.2552
46
ZhangC. Y.YuanW. G.HeP.LeiJ. H.WangC. X. (2016). Liver fibrosis and hepatic stellate cells: etiology, pathological hallmarks and therapeutic targets.World J. Gastroenterol.2210512–10522. 10.3748/wjg.v22.i48.10512
47
ZhouW. C.ZhangQ. B.QiaoL. (2014). Pathogenesis of liver cirrhosis.World J. Gastroenterol.207312–7324. 10.3748/wjg.v20.i23.7312
Summary
Keywords
palmitoylethanolamide, carbon tetrachloride, liver fibrosis, hepatic stellate cells (HSCs), transforming growth factor-β, smad
Citation
Ohara M, Ohnishi S, Hosono H, Yamamoto K, Fu Q, Maehara O, Suda G and Sakamoto N (2018) Palmitoylethanolamide Ameliorates Carbon Tetrachloride-Induced Liver Fibrosis in Rats. Front. Pharmacol. 9:709. doi: 10.3389/fphar.2018.00709
Received
31 March 2018
Accepted
12 June 2018
Published
13 July 2018
Volume
9 - 2018
Edited by
Ralf Weiskirchen, RWTH Aachen Universität, Germany
Reviewed by
Ana Cristina Simões E. Silva, Universidade Federal de Minas Gerais, Brazil; Josef Van Helden, Labor Mönchengladbach MVZ Dr. Stein and Kollegen GbR, Germany
Updates
Copyright
© 2018 Ohara, Ohnishi, Hosono, Yamamoto, Fu, Maehara, Suda and Sakamoto.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Shunsuke Ohnishi, sonishi@pop.med.hokudai.ac.jp
This article was submitted to Gastrointestinal and Hepatic Pharmacology, a section of the journal Frontiers in Pharmacology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.