Abstract
Scutellaria baicalensis Georgi (SBG) is a traditional Chinese medicine widely used to treat disorders such as hypertension, dysentery and hemorrhaging. Here, we aimed to assess the pharmacological effects of SBG on skin aging and to investigate the underlying mechanisms. Mice with skin aging were established by treatment with D-galactose and ultraviolet-B. SBG (topical application) showed a protective effect on skin aging in mice, as evidenced by less formation of skin wrinkles, higher levels of SOD (superoxide dismutase) and HYP (hydroxyproline) as well as a lower level of MDA (malondialdehyde). In the meantime, skin MMP-1 and p53 expression were lower, epidermis was thinner and collagen amount was higher in SBG-treated mice. Anti-skin aging effects of SBG were also confirmed in NIH3T3 and HaCaT cells, as well as in mouse primary dermal fibroblasts and human primary epidermal keratinocytes. Furthermore, we found that loss of Rev-erbα (a known repressor of Bmal1) up-regulated skin BMAL1 (a clock component and a known anti-aging factor) and ameliorated skin aging in mice. Moreover, SBG dose-dependently increased the expression of BMAL1 in the skin of aged mice and in senescent NIT3H3 cells. In addition, based on a combination of Gal4 chimeric, luciferase reporter and expression assays, SBG was identified as an antagonist of REV-ERBα and thus an inducer of BMAL1 expression. In conclusion, SBG antagonizes REV-ERBα to up-regulate BMAL1 and to protect against skin aging in mice.
Introduction
Scutellaria baicalensis Georgi (SBG, also known as Huangqin in Chinese), a traditional Chinese medicine, possesses various pharmacological effects such as anti-inflammatory, antiviral, anticancer, anti-oxidant and antibacterial activities. SBG is widely used to treat diarrhea, hypertension, dysentery and hemorrhaging (Liao et al., 2021). Many types of chemicals are found in SBG, including flavones, phenylethanoids, amino acids, sterols and essential oils (Zhao et al., 2016). Of note, flavones (e.g., baicalin, baicalein, wogonin and oroxylin A) are thought to be a major class of active ingredients of SBG as they show the health-promoting effects (such as anti-inflammation, antivirus, anticancer, anti-oxidation and anti-bacteria) typically observed for SBG (; Li et al., 2004). It is interesting to note that SBG has great potential to manage the skin diseases caused by sunlight irradiation (). The underlying mechanisms may involve scavenging of free radicals and attenuation of lipid oxidation (). However, it remains unknown whether SBG can protect against skin aging.
Skin aging is classified into intrinsic (chronological) and extrinsic aging, and the latter is also referred to as premature skin aging or photoaging (). Intrinsic aging is an unpreventable spontaneous process, whereas extrinsic aging caused by exogenous factors (e.g., ultraviolet/UV light, cigarette smoking and pollution) is preventable (Fisher et al., 2002; Bernhard et al., 2007). UV radiation is a major cause of photoaging, and can be divided into three bands [i.e., UVA (315–400 nm), UVB (280–315 nm) and UVC (100–280 nm)]. Of note, UVB is the predominant form that causes injuries to living organisms (Slominski et al., 2018a; ). UV radiation not only induces skin pathology, but also exert systemic effects, including activation of hypothalamic-pituitary-adrenal axis, opioidogenic effects, and immunosuppression. Thus, UV radiation has therapeutic applications in management of various diseases such as addiction, autoimmune and mood disorders (Slominski et al., 2018a). Although skin aging is regarded as a cosmetic problem, it can result in disfigurement and skin diseases (such as skin cancers) and has profound psychological consequences (Watson et al., 2016; Narayanan et al., 2010). There are two major classes of agents for management of skin aging, namely, antioxidants and cell regulators. However, these medications (e.g., retinoid) are concerned with the lack of effectiveness and/or adverse effects (Krutmann et al., 2021; Mukherjee et al., 2006). Therefore, it is of value to search for more effective and safer therapeutic agents.
BMAL1 (Brain and muscle ARNT-like protein 1) is a transcription factor and a core component of circadian clock system, which generates and maintains circadian rhythms in most aspects of physiology and behaviors (; Hogenesch et al., 1998; ). Bmal1 and other clock genes work cooperatively to drive circadian gene expression using a negative feedback mechanism (; ). BMAL1 forms a heterodimer with CLOCK (circadian locomotor output cycles kaput) to activate the transcription of Pers (periods) and Crys (cryptochromes) as well as many other clock-controlled genes (CCGs) (Langmesser et al., 2008). Once reaching a critical level, PER and CRY proteins in turn inhibit the activity of the BMAL1/CLOCK dimer, bringing down the levels of CCGs (). As PER and CRY proteins are reduced due to degradation, a new cycle of BMAL1/CLOCK-driven transcription can begin (). In addition to regulating circadian rhythms, BMAL1 plays a role in the development and progression of many types of diseases such as cancers (Jung et al., 2013), obesity (Hemmeryckx et al., 2011), and neurodegenerative disorders (Vieira et al., 2020). Notably, Bmal1 is also involved in aging (Khapre et al., 2011). Bmal1-deficient mice have reduced lifespan and are prone to premature aging (exemplified by sarcopenia, cataracts, reduced subcutaneous fat, decreased organ size and impaired hair growth) (Kondratov et al., 2006). Bmal1 regulates aging via modulation of the expression of major antioxidant enzymes including SOD, peroxiredoxines and glutathione peroxidase (Kondratov et al., 2009).
REV-ERBα (also known as NR1D1, nuclear receptor subfamily one group D member 1) is a nuclear receptor that participates in regulation of circadian rhythms via inhibiting BMAL1 expression (Yin and Lazar, 2005). REV-ERBα functions as a transcriptional repressor that inhibits the transcription of target genes (e.g., Bmal1) by binding to a response element (called RevRE) in the promoters and recruiting the corepressors nuclear corepressor one and histone deacetylase 3 (Liu et al., 2008; Yin et al., 2010). REV-ERBα has been also implicated in regulation of a variety of diseases including inflammatory diseases (e.g., fulminant hepatitis, pulmonary inflammation, and colitis) (Wang et al., 2020), metabolic disorders () and cancers (Wang et al., 2015). SR8278 (a synthetic compound) is identified as an antagonist of REV-ERBα and widely used to probe the function of REV-ERBα (Kojetin et al., 2011; Pardee et al., 2011). Notably, we recently found that REV-ERBα restrains Propionibacterium acnes-induced skin inflammation through inhibiting the NF-κB/NLRP3 axis to protect against acne vulgaris (Li et al., 2022). However, it remains elusive whether and how REV-ERBα regulates skin aging.
In the present study, we aimed to assess the pharmacological effects of SBG on skin aging and to investigate the underlying mechanisms. Anti-skin aging effects of SBG were evaluated using mouse and cell models of aging (induced by D-galactose and/or ultraviolet-B). Skin aging was assessed by analyzing SOD, HYP, MDA, ROS and MMP-1/p53 and by measuring epidermal thickness and collagen content. The role of REV-ERBα/BMAL1 in regulating skin aging was assessed using gene knockout mice. Antagonism of REV-ERBα was determined using Gal4 chimeric assay. We for the first time demonstrated that SBG antagonizes REV-ERBα to up-regulate BMAL1 (a skin aging-inhibiting factor) and to protect against skin aging in mice.
Materials and methods
Materials
SBG was purchased from Biopurify Phytochemicals (Chengdu, China). D-galactose (D-gal) was purchased from Aladdin (Shanghai, China). Vitamin C was obtained from Yuanye Biotechnology (Shanghai, China). Biochemical kits for SOD, MDA, ROS and HYP were purchased from Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China). Staining kit for senescence-associated-β-galactosidase (SA-β-gal) was obtained from Beyotime Biotechnology (Shanghai, China). Antibodies against GAPDH, MMP-1, p53, BMAL1, REV-ERBɑ, BHMT and NLRP3 were purchased from Abcam (Cambridge, United Kingdom).
Preparation of SBG extract
SBG was extracted for 90 min by refluxing in 80% ethanol (3:20, w/v), and filtered with filter paper. The filtrate was concentrated and freeze-dried. The dry residue (SBG extract) was stored at -20°C. The extraction yield was 23.3%, and the main active ingredients of SBG are shown in Supplementary Table S1. For animal experiments, SBG extract was mixed with a homemade cream containing stearic acid, triethanolamine, and propylene glycol.
Animals
C57BL/6 mice (10 weeks old) weighing 18–22 g were obtained from HFK Bioscience (Beijing, China). Rev-erbɑ−/− mice (on a C57BL/6 background) have been established and validated in our laboratory (Wang et al., 2018). All mice were maintained on a 12 h light/12 h dark cycle, with free access to food and water. Mice were individually placed in the cages to prevent offensive behaviors from other mice, that may cause injuries to the skin. Mice from the same litter (with hair growth in the anagen phase) were used for experiments. Note that we used male mice to assess the therapeutic effect of SBG on skin aging, without considering factors such as hormone-induced wrinkling of skin. Protocols for animal experiments were approved by the Institutional Animal Care and Use Committee of Guangzhou University of Chinese Medicine (Appr. Date: 2021–05-17; IACUC Issue No: ZYD-2021–112).
LC-MS/MS analysis
The main active constituents (i.e., wogonoside, baicalein, baicalin and wogonin) in SBG extract were quantified using a Shimadzu LCMS-8045 triple quadrupole liquid chromatograph mass spectrometer (LC-MS) equipped with Shimadzu-Nexera XR high-performance liquid chromatography (HPLC). The mobile phases consisted of acetonitrile (A) and water (B). Flow rate was set at 0.3 ml/min. Gradient elution program was 40% B (0–1 min), 40–10% B (1–3 min), 10% B (3–4 min) and 10–40% B (4–5 min). Mass spectrometer was operated at positive ion scan mode. The mass transition ion pairs and contents of main active constituents are provided in Supplementary Table S1
Mouse model of skin aging and drug treatment
To induce skin aging, mice were injected subcutaneously with 250 mg/kg D-gal daily in the back neck and irradiated on the back daily with 120 mJ/cm2 UVB for 6 weeks as previously described (Zhang et al., 2020). The source of radiation was a narrow band UVB bulb (Philips model PL-9 9W/01/2P) emitting photons with wavelengths between 306 and 316 nm, with a peak at 312 nm. The distance from the UVB lamp (KN-4003BL, Kernel Medical Equipment, Xuzhou, China) to the mouse back was 25 cm. Control mice were injected subcutaneously with vehicle (saline). To assess the effects of SBG on skin aging, SBG extract (25, 100 or 400 mg/kg), vitamin C (40 mg/kg) or vehicle was applied topically (once daily after UVB exposure) on the skin of mouse models for 4 weeks from the third week. Mice were sacrificed to collect skin samples, followed by qPCR, Western blotting and biochemical analyses (SOD, MDA and HYP).
Isolation of mouse primary dermal fibroblasts
Mouse primary dermal fibroblasts were isolated from newborn mice as previously described (Terao et al., 2014). The newborn mice were sacrificed by rapid cervical dislocation. Trunk skin was peeled off and incubated with 4 mg/ml dispase overnight at 4 °C. On the next day, the dermis was separated from the epidermis using forceps, and incubated with 0.25% trypsin for 10 min. After filtration, cells were centrifuged at 200 g for 10 min, resuspended in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and incubated at 37°C and 5% CO2.
Cell culture and treatment
NIH3T3, HaCaT and Primary adult human epidermal keratinocytes (HEKa) cells were obtained from the American Type Culture Collection (Rockville, MD). NIH3T3, HaCaT and HEKa were maintained in DMEM supplemented with 10% FBS, 100 U/ml penicillin and 100 mg/ml streptomycin. To induce NIH3T3 cell senescence, 8 g/L D-gal was added to the culture medium for 96 h. To induce cell senescence of HaCaT, mouse primary dermal fibroblasts and HEKa, cells were subjected to UVB irradiation (100 mJ/cm2) with a thin layer of PBS (phosphate-buffered saline) using a UVB lamp (KN-4003BL, Kernel Medical Equipment, Xuzhou, China). Cells were then treated with SBG or vehicle. On next day, cells were collected for qPCR and Western blotting.
Gal4 co-transfection assay
Gal4 co-transfectionthe assay was performed as previously described (Zhang et al., 2018). In brief, HEK293 cells were co-transfected with pGal4-Rev-erbα-LBD plasmid (200 ng), pGL-4.35-Luc reporter (100 ng, a Gal4-reponsive luciferase reporter) and pRL-TK vector (10 ng) using jetPRIME (Polyplus Transfection, Illkirch, France). On next day, cells were treated with SBG or SR8278 or vehicle. 24 h later, luciferase activities were measured using the Dual-Luciferase Reporter Assay system and GloMax 20/20 luminometer (Promega Madison, WI).
Luciferase reporter assays
Luciferase reporter assays were performed as previously described (). In brief, NIH3T3 cells were cultured in DMEM medium (containing 10% FBS, 1% penicillin-streptomycin) and transfected with 250 ng of Bmal1 luciferase reporter plasmid and 50 ng of pRL-TK using jetPRIME (Polyplus Transfection, Illkirch, France). On next day, SBG or SR8278 or vehicle was added to the culture medium for 24 h. Cells were harvested and lysed with passive lysis buffer. Luciferase activities were detected using the Dual-Luciferase Reporter Assay system and GloMax 20/20 luminometer (Promega, Madison, WI).
H&E and masson staining
Skin samples were fixed in 10% formalin, embedded in paraffin, and cut to 4 μm-thick sections. The sections were subjected to H&E (hematoxylin and eosin) and Masson staining. The images were captured using an optical microscope (Olympus, Tokyo, Japan).
Measurement of intracellular ROS
Cells were treated with 2′7′-dichlorodihydrofluorescein diacetate (10 μM) at 37°C for 1 h. Fluorescence intensity was determined at excitation (485 nm) and emission (530 nm) wavelengths using a Synergy HT Multi-Mode Microplate Reader (BioTek, Winooski, VT).
MTT assay
MTT assays were performed to determine cell viability as previously described (Kumar et al., 2018). Briefly, cells were incubated with MTT [3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyl tetrazolium bromide, 0.5 mg/ml] for 4 h, and the formazan crystals were dissolved in 100 μl DMSO. The absorbance was determined at 570 nm using a Synergy HT Multi-Mode Microplate Reader (BioTek, Winooski, VT).
SA-β-gal assay
SA-β-gal activity was measured using a SA-β-gal staining kit according to the manufacturer’s instructions (Beyotime, Shanghai, China). Briefly, cells were fixed in a fixing solution for 15 min, washed with PBS and incubated with senescence detection solution at 37°C. On next day, the number of SA-β-gal-positive cells were determined by counting blue-stained cells using an Eclipse ci-L microscope (Nikon, Tokyo, Japan).
Real-time luminescence monitoring
Real-time luminescence monitoring was performed as previously described (Hirota et al., 2008; ). In brief, NIH3T3 cells stably overexpressed with Bmal1-dLuc were seeded into a 35 mm dish and maintained in DMEM containing 10% FBS. On next day, cells were incubated with a recording medium containing 1 μg/ml SBG or vehicle. Luminescence data (counts/s) were collected by using Lumicycle 32 (Actimetrics, Wilmette, IL).
Western blotting
Protein samples were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to PVDF membranes. The membranes were blocked with 5% skim milk, and sequentially incubated with primary and secondary antibodies. Protein bands were visualized by using enhanced chemiluminescence and Omega Lum G imaging system (Aplegen, Pleasanton, CA), and quantified with Fluorchem 5500 software (Fisher Scientific, Fair Lawn, NJ). GAPDH was used as a loading control.
qPCR (quantitative polymerase chain reaction)
RNA was extracted using RNAiso Plus reagent (Takara, Shiga, Japan) and transcribed to cDNA using PrimeScript RT Master Mix (Vazyme, Jiangsu, China). qPCR reactions were performed using the SYBR Premix Ex Taq (Vazyme, Jiangsu, China). Amplification procedures consisted of an initial denaturation at 95°C for 5 min, 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. Mouse Gapdh was used as an internal control. Gene expression was determined using the 2−ΔΔCT method. Primers are provided in Table 1.
TABLE 1
| Gene | Forward (5–3′) | Reverse (5–3′) |
|---|---|---|
| mp53 | GTCACAGCACATGACGGAGG | TCTTCCAGATGCTCGGGATAC |
| mMmp-1 | CTTCTTCTTGTTGAGCTGGACTC | CTGTGGAGGTCACTGTAGACT |
| mBhmt | TTAGAACGCTTAAATGCCGGAG | GATGAAGCTGACGAACTGCCT |
| mNlrp3 | ATTACCCGCCCGAGAAAGG | TCGCAGCAAAGATCCACACAG |
| mRev-erbɑ | TTTTTCGCCGGAGCATCCAA | ATCTCGGCAAGCATCCGTTG |
| mBmal1 | CTCCAGGAGGCAAGAAGATTC | ATAGTCCAGTGGAAGGAATG |
| mGapdh | CAAGGAGTAAGAAACCCTGGA | CGAGTTGGGATAGGGCCTCT |
| hp53 | TTGGCTCTGACTGTACCACCAT | CAGTGTGATGATGGTGAGGATG |
| hMMP-1 | TCGGGGCTTTGATGTACCCT | ACACGCTTTTGGGGTTTGTG |
| hGAPDH | CATGAGAAGTATGACAACAGCCT | TAGTCCTTCCACGATACCAAAGT |
Primers used for qPCR assays.
m, mouse; h, human.
Statistical analysis
Data are presented as means ± SD (standard deviation). Comparisons between two groups were analyzed using Student’s t-test. One-way ANOVA followed by Bonferroni post hoc test was performed to compare means of more than two groups. The level of significance was set at p < 0.05 (*).
Results
SBG protects against skin aging induced by D-gal/UVB in mice
Mice with skin aging were established by treatment with D-gal/UVB as previously described (). As expected, D-gal/UVB-treated mice showed skin aging-like symptoms such as roughness, stiffness, and lack of elasticity (Figure 1A). These mice had lower levels of SOD activity and HYP and a higher level of MDA in the skin as compared to normal mice (Figure 1B). We also observed marked increases in the expression of Mmp-1 and p53 (two genes closely associated with skin aging) in the skin of D-gal/UVB-treated mice (Figure 1C). In addition, the epidermis (D-gal/UVB-exposed region) was thicker in aging mice than in control mice according to H&E staining (Figure 1D). These data indicated successful construction of mice with skin aging.
FIGURE 1
We next assessed the effects of SBG (topical application) on skin aging in mice. Like vitamin C (a known anti-aging agent and used as a positive control), SBG reduced the wrinkle formation in the skin of D-gal/UVB-treated mice (Figure 2A). Further, SBG dose-dependently increased the SOD activity and HYP level, and decreased the MDA level in the skin of aging mice (Figure 2B). Moreover, SBG reduced the mRNAs and proteins of both MMP-1 and p53 in the skin of aging mice in a dose-dependent manner (Figure 2C/D). In addition, compared to vehicle-treated aging mice, SBG-treated mice had thinner D-gal/UVB-exposed epidermis, and a higher amount of collagen (Figure 3A/B). Taken together, these findings clearly indicated a protective effect of SBG on skin aging in mice.
FIGURE 2
FIGURE 3
SBG attenuates D-gal- and UVB-induced cell senescence
We next investigated whether SBG can affect cell senescence using NIH3T3 and HaCaT cells. NIH3T3 cells were exposed to 8 g/L D-gal for 96 h to induce cell senescence as previously described (). As expected, D-gal treatment of NIH3T3 cells resulted in senescence as evidenced by a decrease in cell viability, and elevations in ROS level and MMP-1/p53 expression, as well as an increase in senescence-associated β-galactosidase (SA-β-gal, a senescence-specific marker) activity (Figure 4). We found that SBG dose-dependently increased the cell viability and decreased the ROS level in D-gal-treated NIH3T3 cells (Figure 4A/B). Furthermore, SBG down-regulated the mRNA levels of both Mmp-1 and p53 in a dose-dependent fashion in D-gal-treated cells (Figure 4C). In line with the mRNA changes, MMP-1 and p53 proteins were reduced by SBG in the aged cells (Figure 4D). Moreover, SBG-treated senescent cells had a lower activity of SA-β-gal (Figure 4E).
FIGURE 4
We additionally examined the effects of SBG on senescene of HaCaT, mouse primary dermal fibroblasts and HEKa cells induced by UVB. SBG increased the cell viability and decreased the ROS level and MMP-1/p53 expression in the senescent cells (Figures 5, 6). These similar effects were also observed for vitamin C (Figures 5, 6). Altogether, these findings supported that SBG had a protective effect on skin aging.
FIGURE 5
FIGURE 6
Loss of Rev-erbα up-regulates skin BMAL1 and ameliorates skin aging in mice
Deficiency of Bmal1 has been previously shown to promote premature aging in mice, identifying Bmal1 as a key regulator of aging (Kondratov et al., 2006). Bmal1 regulates aging via modulation of the expression of antioxidant enzymes including SOD, peroxiredoxines and glutathione peroxidase (Kondratov et al., 2009). Bmal1 is a target gene of REV-ERBα, which functions as a transcriptional repressor (). Loss of Rev-erbα leads to up-regulation of BMAL1 (). Thus, we hypothesized that Rev-erbα may promote skin aging considering that Bmal1 has a protective role. To test this hypothesis, we generated and tested a mouse line with deletion of Rev-erbα gene (Rev-erbα−/− mice). Rev-erbα−/− mice were validated by qPCR, and showed the absence of wild-type Rev-erbα transcript in the skin (Figure 7A). As expected, BMAL1 mRNA and protein were up-regulated in the skin of Rev-erbα−/− mice (Figure 7B). Rev-erbα−/− and control mice were subjected to induction of skin aging by D-gal/UVB. We found that loss of Rev-erbα ameliorated skin aging as evidenced by less formation of skin wrinkles, higher levels of SOD and HYP as well as a lower level of MDA (Figure 7C/D). In the meantime, skin MMP-1 and p53 expression were lower, epidermis was thinner and collagen amount was higher in Rev-erbα−/− mice (Figures 7E–G). Taken together, Rev-erbα ablation up-regulated skin BMAL1 and ameliorated skin aging in mice. Our findings supported a critical role of REV-ERBα/BMAL1 in regulation of skin aging.
FIGURE 7
SBG up-regulates the clock gene Bmal1 in mouse and cell models of aging
Because Bmal1 and its upstream regulator Rev-erbα are involved in skin aging, we wondered whether Bmal1 has a role in protection of skin aging by SBG. We found that SBG dose-dependently increased the BMAL1 mRNA and protein in the skin of D-gal/UVB-treated mice (Figure 8A/B). Likewise, SBG led to increases in the mRNA and protein of BMAL1 in D-gal-treated NIT3H3 cells (Figure 8C/D). Therefore, the protective effects of SBG on skin aging can be attributed to enhanced BMAL1 expression.
FIGURE 8
SBG antagonizes REV-ERBα to induce BMAL1 expression
Bmal1 expression is directly regulated by REV-ERBα, a nuclear receptor whose activity can be modified by small molecules (Kojetin and Burris, 2014). We next tested whether SBG modulates Bmal1 expression via REV-ERBα. We first assessed the activity of SBG in HEK293 cells expressing a chimeric receptor (i.e., the DNA-binding domain of Gal4 is fused to the LBD of Rev-erbα) and a Gal4-responsive luciferase reporter (Figure 9A). SBG dose-dependently inhibited the repressor activities of REV-ERBα in the Gal4 chimeric assay (Figure 9A), suggesting SBG as a REV-ERBα antagonist. Furthermore, like SR8278, SBG dose-dependently enhanced the promoter activity of Bmal1 (−2000/+100 bp) in a luciferase reporter assay (Figure 9B). Moreover, SBG increased the mRNA and protein expression of BHMT and NLRP3 (i.e., two known targets of REV-ERBα) in addition to BMAL1 in NIH3T3 cells in a dose-dependent fashion (Figure 9C/D). In addition, SBG increased the circadian amplitude of Bmal1 gene according to cell-based circadian assay with NIH3T3 cells expressing Bmal1-dLuc reporter (Figure 9E). Taken together, these findings indicated that SBG antagonized REV-ERBα to induce BMAL1 expression.
FIGURE 9
Discussion
In this study, we have identified SBG as a novel anti-skin aging agent. Compared with synthetic agents such as retinoid (Mukherjee et al., 2006), SBG is more advantageous in practical applications because it is a herbal medicine without safety concern. More importantly, we have uncovered that SBG protects against skin aging in mice by antagonizing REV-ERBα and increasing skin expression of BMAL1, an aging-inhibiting factor (Figure 10). The evidence for antagonism of REV-ERBα by SBG is strong. First, SBG dose-dependently inhibited the repressor activities of REV-ERBα in the Gal4 chimeric assay. Second, like SR8278 (a known REV-ERBα antagonist), SBG dose-dependently enhanced the promoter activity of Bmal1 in a luciferase reporter assay. Third, SBG increased the expression of BMAL1, BHMT and NLRP3 (three known targets of REV-ERBα and repressed by REV-ERBα) in NIH3T3 cells. Fourth, SBG increased the circadian amplitude of Bmal1 gene according to circadian assays with NIH3T3 cells expressing Bmal1-dLuc reporter (Figure 9). It is noteworthy that herbal extract instead of purified active compounds was used in current study. This will affect reproducibility because different sources of SBG and slight changes in extraction can lead to different composition of active compounds.
FIGURE 10
Our finding that REV-ERBα/BMAL1 (as core clock components) regulate skin aging supports the notion that skin pathophysiology is under the control of circadian clock. In fact, circadian clock has been implicated in regulation of several other types of skin diseases such as skin cancer, infections and sunburn (). Because among clock components BMAL1 has a direct effect on skin aging, it likely acts to connect this skin disorder to circadian clock. Supporting this, Bmal1 was markedly down-regulated in the skin of aged mice (Figure 8). We have identified REV-ERBα as a potential target for prevention and treatment of skin aging. Compared with other targets such as BMAL1, REV-ERBα is more advantageous because it is a ligand-responsive receptor whose activity can be modified by small molecules. We found that SBG is a novel REV-ERBα antagonist. However, it remains unknown which constituents in this herbal medicine are responsible for the antagonistic action. We reasoned that baicalein (a known active constituent) may have a contribution as it can induce the expression of Bmal1, a direct target of REV-ERBα, and shows a protective effect on skin damage (Nomura et al., 2018).
This study has unraveled that SBG promotes BMAL1 expression to protect against skin aging in mice. BMAL1 functions as an anti-aging factor by up-regulating major antioxidant enzymes such as SOD, peroxiredoxines and glutathione peroxidase (Kondratov et al., 2009; Töbelmann and Dittmar, 2021). It is noteworthy that there is a possibility that other mechanisms are also involved in the protection of skin aging by SBG considering that herbal medicines usually contain hundreds of chemical constituents. The potential mechanisms include inactivation of MAPK/AP-1 and NF-κB signaling pathways, activation of TGF-β/Smad pathway, and modulation of cyclooxygenase (COX), hypoxia-Inducible factor (HIF)-1 and inducible nitric oxide synthase (iNOS) (; ; ). However, whether these mechanisms have a contribution to the SBG effect on skin aging awaits further investigations.
Mouse models of skin aging were established in current study by treatment with D-gal/UVB as previously described (Jiayi et al., 2019; Zhang et al., 2020; ). Chronic injection of D-gal, a reducing sugar, results in oxidative stress including reductions of antioxidant enzymes, inflammation and apoptosis, mimicking a natural aging process (Shen et al., 2002; Shan et al., 2009; ). UVB is the most harmful constituent of UV radiation. Chronic UVB exposure can cause excessive ROS production, abnormal elastin deposition, and impairment of collagen fibers (Starcher et al., 1999; Heck et al., 2003; Lee et al., 2021). D-gal and UVB co-treatment induces a large-scale burst of free radicals, leading to the oxidative damage in the skin and skin aging-like symptoms such as wrinkling, sagging, dryness, and erythema (Zhang et al., 2020). This animal model has been widely used to elucidate cellular and molecular changes that may have a causal role in skin aging, and to screen anti-aging drugs (Jiayi et al., 2019; Zhang et al., 2020; ).
Anti-aging effects of SBG were assessed here by measuring SOD activity, MDA/HYP levels, and MMP-1/p53 expression. SOD is a major free radical scavenger in the body, and functions to remove superoxide anions (Li et al., 2020; Park et al., 2008). MDA is a final product of oxidation, and its content can directly reflect the level of lipid peroxidation (; Zhang et al., 2014). SOD activity and MDA level can be used as indicators of the level of organism aging which is associated with oxidative stress and ROS production (Yi et al., 2019). HYP is the most abundant amino acid in collagen, and its level indirectly reflects the total collagen content (Li and Wu, 2018; Li et al., 2016). MMP-1 is a collagenase that plays an important role in degradation of dermal collagen during skin aging (Sapna et al., 2014). Thus, HYP and MMP-1 can be used as markers of skin aging process. P53 is a tumor suppressor gene that induces cell senescence by promoting the expression of growth suppressive genes (; Luo et al., 2004), and is also regarded as a marker of skin aging. In fact, measurements of SOD activity, MDA/HYP levels, and MMP-1/p53 expression have been widely performed to assess aging and to screen anti-aging agents (Jiayi et al., 2019; Park et al., 2008; Hwang et al., 2012).
An important part of the skin response to stress is its ability for melatonin synthesis and subsequent metabolism (Slominski et al., 2017; Slominski et al., 2018b). Melatonin is indispensable for physiological skin functions and has a protective role against photoaging (Skobowiat, et al., 2018; ). However, whether SBG affects skin melatonin remains unknown. Like vitamin C, vitamin D exerts a variety of antiaging and photoprotective effects on the skin (; Slominski et al., 2020). However, whether the anti-skin aging effect of SBG is comparable to that of vitamin D was unaddressed. It is noteworthy that UV radiation not only induces skin pathology, but also exert systemic effects, including activation of hypothalamic-pituitary-adrenal axis, opioidogenic effects, and immunosuppression. Thus, UV radiation has therapeutic applications in management of various diseases such as addiction, autoimmune and mood disorders (Slominski et al., 2018a).
In summary, SBG displays a pharmacological effect on skin aging based on mouse and cell models of aging. Mechanistically, SBG protects against skin aging in mice by antagonizing REV-ERBα and increasing skin expression of BMAL1, an aging-inhibiting factor.
Abbreviation
Bmal1, brain and muscle ARNT-like one; CCGs, clock-controlled genes; Clock, circadian locomotor output cycles kaput; Crys, cryptochromes; D-gal, D-galactose; HYP, hydroxyproline; MDA, malondialdehyde; NR1D1, nuclear receptor subfamily one group D member one; Pers, periods; qPCR, quantitative polymerase chain reaction; ROS, reactive oxygen species; SA-β-gal, senescence-associated-β-galactosidase; SBG, Scutellaria baicalensis Georgi; SOD, superoxide dismutase; UV, ultraviolet
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.
Ethics statement
The animal study was reviewed and approved by Institutional Animal Care and Use Committee of Guangzhou University of Chinese Medicine
Author contributions
BW, DD, and GS designed the study; GS, YD, YL, WZ, ZW performed experiments; GS, YD, and YL and XZ collected and analyzed data; BW, DD, GS, and YL wrote the manuscript. All data were generated in-house, and no paper mill was used. All authors agree to be accountable for all aspects of work ensuring integrity and accuracy.
Funding
This work was supported by the National Natural Science Foundation of China (No. 81722049 & 82003839) and Natural Science Foundation of Guangdong Province (No. 2019A1515110892 & 2021A1515012189).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fphar.2022.991917/full#supplementary-material
Abbreviations:
Bmal1, brain and muscle ARNT–like one; CCGs, clock–controlled genes; Clock, circadian locomotor output cycles kaput; Crys, cryptochromes; D–gal, D–galactose; HYP, hydroxyproline; MDA, malondialdehyde; NR1D1, nuclear receptor subfamily one group D member one; Pers, periods; qPCR, quantitative polymerase chain reaction; ROS, reactive oxygen species; SA–β–gal, senescence–associated–β–galactosidase; SBG, Scutellaria baicalensis Georgi; SOD, superoxide dismutase; UV, ultraviolet.
References
1
BernhardD.MoserC.BackovicA.WickG. (2007). Cigarette smoke–anaging accelerator?Exp. Gerontol.42 (3), 160–165. 10.1016/j.exger.2006.09.016
2
BochevaG.SlominskiR. M.JanjetovicZ.KimT. K.BöhmM.SteinbrinkK.et al (2022). Protective role of melatonin and its metabolites in skin aging. Int. J. Mol. Sci.23 (3), 1238. 10.3390/ijms23031238
3
BochevaG.SlominskiR. M.SlominskiA. T. (2019). Neuroendocrine aspects of skin aging. Int. J. Mol. Sci.20 (11), 2798. 10.3390/ijms20112798
4
BochevaG.SlominskiR. M.SlominskiA. T. (2021). The impact of vitamin D on skin aging. Int. J. Mol. Sci.22 (16), 9097. 10.3390/ijms22169097
5
BögerR. (2014). [Circadian clocks and energy metabolism].Dtsch. Med. Wochenschr.139 (24), 1320. 10.1055/s-0034-1370115
6
BondJ.HaughtonM.BlaydesJ.GireV.Wynford-ThomasD.WyllieF. (1996). Evidence that transcriptional activation by p53 plays a direct role in the induction of cellular senescence. Oncogene13 (10), 2097–2104.
7
BrownJ. P. (1980). A review of the genetic effects of naturally occurring flavonoids, anthraquinones and related compounds. Mutat. Res.75 (3), 243–277. 10.1016/0165-1110(80)90029-9
8
BungerM. K.WilsbacherL. D.MoranS. M.ClendeninC.RadcliffeL. A.HogeneschJ. B.et al (2000). Mop3 is an essential component of the master circadian pacemaker in mammals. Cell103 (7), 1009–1017. 10.1016/s0092-8674(00)00205-1
9
BurrisT. P. (2008). Nuclear hormone receptors for heme: REV-ERBalpha and REV-ERBbeta are ligand-regulated components of the mammalian clock. Mol. Endocrinol.22 (7), 1509–1520. 10.1210/me.2007-0519
10
CaoC.XiaoZ.TongH.LiuY.WuY.GeC. (2022). Oral intake of chicken bone collagen peptides anti-skin aging in mice by regulating collagen degradation and synthesis, inhibiting inflammation and activating lysosomes. Nutrients14 (8), 1622. 10.3390/nu14081622
11
ChenM.ZhouC.XuH.ZhangT.WuB. (2020). Chronopharmacological targeting of Rev-erbα by puerarin alleviates hyperhomocysteinemia in mice. Biomed. Pharmacother. = Biomedecine Pharmacother.125, 109936. 10.1016/j.biopha.2020.109936
12
ChenP.ChenF.ZhouB. (2018). Antioxidative, anti-inflammatory and anti-apoptotic effects of ellagic acid in liver and brain of rats treated by D-galactose. Sci. Rep.8 (1), 1465. 10.1038/s41598-018-19732-0
13
ChenR.SchirmerA.LeeY.LeeH.KumarV.YooS. H.et al (2009). Rhythmic PER abundance defines a critical nodal point for negative feedback within the circadian clock mechanism. Mol. Cell36 (3), 417–430. 10.1016/j.molcel.2009.10.012
14
ChiY. S.KimH. P. (2005). Suppression of cyclooxygenase-2 expression of skin fibroblasts by wogonin, a plant flavone from Scutellaria radix. Prostagl. Leukot. Essent. Fat. Acids72 (1), 59–66. 10.1016/j.plefa.2004.04.009
15
CrumbleyC.BurrisT. P. (2011). Direct regulation of CLOCK expression by REV-ERB. PloS one6 (3), e17290. 10.1371/journal.pone.0017290
16
DelezieJ.DumontS.DardenteH.OudartH.Gréchez-CassiauA.KlosenP.et al (2012). The nuclear receptor REV-ERBα is required for the daily balance of carbohydrate and lipid metabolism. FASEB26 (8), 3321–3335. 10.1096/fj.12-208751
17
Domaszewska-SzostekA.Puzianowska-KuźnickaM.KuryłowiczA. (2021). Flavonoids in skin senescence prevention and treatment. Int. J. Mol. Sci.22 (13), 6814. 10.3390/ijms22136814
18
du PréB. C.DierickxP.CrnkoS.DoevendansP. A.VosM. A.GeijsenN.et al (2017). Neonatal rat cardiomyocytes as an in vitro model for circadian rhythms in the heart. J. Mol. Cell. Cardiol.112, 58–63. 10.1016/j.yjmcc.2017.08.009
19
DuanJ.GreenbergE. N.KarriS. S.AndersenB. (2021). The circadian clock and diseases of the skin. FEBS Lett.595 (19), 2413–2436. 10.1002/1873-3468.14192
20
DuongH. A.RoblesM. S.KnuttiD.WeitzC. J. (2011). A molecular mechanism for circadian clock negative feedback. Science332 (6036), 1436–1439. 10.1126/science.1196766
21
FisherG. J.KangS.VaraniJ.Bata-CsorgoZ.WanY.DattaS.et al (2002). Mechanisms of photo aging and chronological skin aging. Arch. Dermatol.138 (11), 1462–1470. 10.1001/archderm.138.11.1462
22
FrommeyerT. C.GilbertM. M.BrittainG. V.WuT.NguyenT. Q.RohanC. A.et al (2022). UVB-induced microvesicle particle release and its effects on the cutaneous microenvironment. Front. Immunol.13, 880850. 10.3389/fimmu.2022.880850
23
GabrielskaJ.OszmiańskiJ.ZyłkaR.KomorowskaM. (1997). Antioxidant activity of flavones from Scutellaria baicalensis in lecithin liposomes. Z. fur Naturforsch. C52 (11-12), 817–823. 10.1515/znc-1997-11-1215
24
GaoB.LiK.WeiY. Y.ZhangJ.LiJ.ZhangL.et al (2014). Zinc finger protein 637 protects cells against oxidative stress-induced premature senescence by mTERT-mediated telomerase activity and telomere maintenance. Cell Death Dis.5 (7), e1334. 10.1038/cddis.2014.298
25
GekakisN.StaknisD.NguyenH. B.DavisF. C.WilsbacherL. D.KingD. P.et al (1998). Role of the CLOCK protein in the mammalian circadian mechanism. Science280 (5369), 1564–1569. 10.1126/science.280.5369.1564
26
GilP.FariñasF.CasadoA.López-FernándezE. (2002). Malondialdehyde: A possible marker of ageing.Gerontology48 (4), 209–214. 10.1159/000058352
27
GuY.HanJ.JiangC.ZhangY. (2020). Biomarkers, oxidative stress and autophagy in skin aging. Ageing Res. Rev.59, 101036. 10.1016/j.arr.2020.101036
28
HeckD. E.VetranoA. M.MarianoT. M.LaskinJ. D. (2003). UVB light stimulates production of reactive oxygen species: Unexpected role for catalase. J. Biol. Chem.278 (25), 22432–22436. 10.1074/jbc.C300048200
29
HemmeryckxB.HimmelreichU.HoylaertsM. F.LijnenH. R. (2011). Impact of clock gene Bmal1 deficiency on nutritionally induced obesity in mice. Obes. (Silver Spring, Md.)19 (3), 659–661. 10.1038/oby.2010.266
30
HirotaT.LewisW. G.LiuA. C.LeeJ. W.SchultzP. G.KayS. A. (2008). A chemical biology approach reveals period shortening of the mammalian circadian clock by specific inhibition of GSK-3beta. Proc. Natl. Acad. Sci. U. S. A.105 (52), 20746–20751. 10.1073/pnas.0811410106
31
HogeneschJ. B.GuY. Z.JainS.BradfieldC. A. (1998). The basic-helix-loop-helix-PAS orphan MOP3 forms transcriptionally active complexes with circadian and hypoxia factors. Proc. Natl. Acad. Sci. U. S. A.95 (10), 5474–5479. 10.1073/pnas.95.10.5474
32
HwangI. S.KimJ. E.ChoiS. I.LeeH. R.LeeY. J.JangM. J.et al (2012). UV radiation-induced skin aging in hairless mice is effectively prevented by oral intake of sea buckthorn (Hippophae rhamnoides L.) fruit blend for 6 weeks through MMP suppression and increase of SOD activity. Int. J. Mol. Med.30 (2), 392–400. 10.3892/ijmm.2012.1011
33
JiayiM. A.YanG. U. O.JuanY. E.WenyuM. A. (2019). Protective effect of lycium ruthenicum procyanidin on mice skin aging model. Chin. General Pract.22 (15), 1851.
34
JungC. H.KimE. M.ParkJ. K.HwangS. G.MoonS. K.KimW. J.et al (2013). Bmal1 suppresses cancer cell invasion by blocking the phosphoinositide 3-kinase-Akt-MMP-2 signaling pathway. Oncol. Rep.29 (6), 2109–2113. 10.3892/or.2013.2381
35
KhapreR. V.KondratovaA. A.SusovaO.KondratovR. V. (2011). Circadian clock protein BMAL1 regulates cellular senescence in vivo. Cell cycleGeorget. Tex.)10 (23), 4162–4169. 10.4161/cc.10.23.18381
36
KojetinD. J.BurrisT. P. (2014). REV-ERB and ROR nuclear receptors as drug targets. Nat. Rev. Drug Discov.13 (3), 197–216. 10.1038/nrd4100
37
KondratovR. V.KondratovaA. A.GorbachevaV. Y.VykhovanetsO. V.AntochM. P. (2006). Early aging and age-related pathologies in mice deficient in BMAL1, the core componentof the circadian clock. Genes Dev.20 (14), 1868–1873. 10.1101/gad.1432206
38
KondratovR. V.VykhovanetsO.KondratovaA. A.AntochM. P. (2009). Antioxidant N-acetyl-L-cysteine ameliorates symptoms of premature aging associated with the deficiency of the circadian protein BMAL1. Aging1 (12), 979–987. 10.18632/aging.100113
39
KojetinD.WangY.KameneckaT. M.BurrisT. P. (2011). Identification of SR8278, asynthetic antagonist of the nuclear hemereceptor REV-ERB. ACS Chem. Biol.6 (2), 131–136. 10.1021/cb1002575
40
KrutmannJ.SchalkaS.WatsonR.WeiL.MoritaA. (2021). Daily photo protection to prevent photo aging. Photodermatol. Photoimmunol. Photomed.37 (6), 482–489. 10.1111/phpp.12688
41
KumarP.NagarajanA.UchilP. D. (2018). Analysis of cell viability by the MTT assay. Cold Spring Harb. Protoc.2018 (6). 10.1101/pdb.Prot095505
42
LangmesserS.TalloneT.BordonA.RusconiS.AlbrechtU. (2008). Interaction of circadian clock proteins PER2 and CRY with BMAL1 and CLOCK. BMC Mol. Biol.9, 41. 10.1186/1471-2199-9-41
43
LeeJ. J.NgS. C.NiY. T.LiuJ. S.ChenC. J.PadmaV. V.et al (2021). Protective effects of galangin against H2O2/UVB-induced dermal fibroblast collagen degradation via hsa-microRNA-4535-mediated TGFβ/Smad signaling. Aging13 (23), 25342–25364. 10.18632/aging.203750
44
LiC. W.WangQ.LiJ.HuM.ShiS. J.LiZ. W.et al (2016). Silver nanoparticles/chitosan oligosaccharide/poly(vinyl alcohol) nanofiber promotes wound healing by activating TGFβ1/Smad signaling pathway. Int. J. Nanomedicine11, 373–386. 10.2147/IJN.S91975
45
LiF.LinL.HeY.SunG.DongD.WuB. (2022). BMAL1 regulates Propionibacterium acnes-induced skin inflammation via REV-ERBα in mice. Int. J. Biol. Sci.18 (6), 2597–2608. 10.7150/ijbs.71719
46
LiH. B.JiangY.ChenF. (2004). Separation methods used for Scutellaria baicalensis active components. J. Chromatogr. B Anal. Technol. Biomed. Life Sci.812 (1-2), 277–290. 10.1016/j.jchromb.2004.06.045
47
LiP.WuG. (2018). Roles of dietary glycine, proline, and hydroxyproline in collagen synthesis and animal growth. Amino acids50 (1), 29–38. 10.1007/s00726-017-2490-6
48
LiW.WangS.LiJ.WangX.CuiL.ChenJ.et al (2020). Antioxidative enzyme activities in the Rhodeinae sinensis Gunther and Macrobrachium nipponense and multi-endpoint assessment under tonalide exposure. Ecotoxicol. Environ. Saf.199, 110751. 10.1016/j.ecoenv.2020.110751
49
LiaoH.YeJ.GaoL.LiuY. (2021). The main bioactive compounds of Scutellaria baicalensis Georgi. For alleviation of inflammatory cytokines: A comprehensive review. Biomed. Pharmacother. = Biomedecine Pharmacother.133, 110917. 10.1016/j.biopha.2020.110917
50
LiuA. C.TranH. G.ZhangE. E.PriestA. A.WelshD. K.KayS. A. (2008). Redundant function of REV-ERBalpha and beta and non-essential role for Bmal1 cycling in transcriptional regulation of intracellular circadian rhythms. PLoS Genet.4 (2), e1000023. 10.1371/journal.pgen.1000023
51
LuoJ.LiM.TangY.LaszkowskaM.RoederR. G.GuW. (2004). Acetylation of p53 augments its site-specific DNA binding both in vitro and in vivo. Proc. Natl. Acad. Sci. U. S. A.101 (8), 2259–2264. 10.1073/pnas.0308762101
52
MukherjeeS.DateA.PatravaleV.KortingH. C.RoederA.WeindlG. (2006). Retinoids in the treatment of skin aging: An overview of clinical efficacy and safety. Clin. Interv. Aging1 (4), 327–348. 10.2147/ciia.2006.1.4.327
53
NarayananD. L.SaladiR. N.FoxJ. L. (2010). Ultraviolet radiation and skin cancer. Int. J. Dermatol.49 (9), 978–986. 10.1111/j.1365-4632.2010.04474.x
54
NomuraK.HiraiT.NakashimaK. I.InoueM. (2018). “Baicalein regulates FGF21 expression through RORα-mediated transcriptional activity,” in Proceedings for Annual Meeting of The Japanese Pharmacological Society WCP2018 (The 18th World Congress of Basic and Clinical Pharmacology) (Japanese Pharmacological Society), PO2–12.
55
PardeeK.NecakovA. S.KrauseH. (2011). Nuclear receptors: Small molecule sensors that coordinate growth, metabolism and reproduction. Subcell. Biochem.52, 123–153. 10.1007/978-90-481-9069-0_6
56
ParkS. H.ChoD. M.ChoiB. D.ChoiY. J.ChoiJ. H. (2008). Antioxidative effects of skinned mugwort (Artemisia vulgaris L.) extracts on UV-irradiated hairless mouse skin. J. Korean Soc. Food Sci. Nutr.37 (1), 20–26. 10.3746/jkfn.2008.37.1.20
57
SapnaG.GokulS.Bagri-ManjrekarK. (2014). Matrix metalloproteinases and periodontal diseases. Oral Dis.20 (6), 538–550. 10.1111/odi.12159
58
ShanQ.LuJ.ZhengY.LiJ.ZhouZ.HuB.et al (2009). Purple sweet potato color ameliorates cognition deficits and attenuates oxidative damage and inflammation in aging mouse brain induced by d-galactose. J. Biomed. Biotechnol.2009, 564737. 10.1155/2009/564737
59
ShenY. X.XuS. Y.WeiW.SunX. X.YangJ.LiuL. H.et al (2002). Melatonin reduces memory changes and neural oxidative damage in mice treated with D-galactose. J. Pineal Res.32 (3), 173–178. 10.1034/j.1600-079x.2002.1o850.x
60
SkobowiatC.BrożynaA. A.JanjetovicZ.JeayengS.OakA.KimT. K.et al (2018). Melatonin and its derivatives counteract the ultraviolet B radiation-induced damage in human and porcine skin ex vivo. J. Pineal Res.65 (2), e12501. 10.1111/jpi.12501
61
SlominskiA. T.ChaiprasongsukA.JanjetovicZ.KimT. K.StefanJ.SlominskiR. M.et al (2020). Photoprotective properties of vitamin D and lumisterol hydroxyderivatives. Cell biochem. Biophys.78 (2), 165–180. 10.1007/s12013-020-00913-6
62
SlominskiA. T.HardelandR.ZmijewskiM. A.SlominskiR. M.ReiterR. J.PausR. (2018b). Melatonin: A cutaneous perspective on its production, metabolism, and functions. J. Invest. Dermatol.138 (3), 490–499. 10.1016/j.jid.2017.10.025
63
SlominskiA. T.ZmijewskiM. A.PlonkaP. M.SzaflarskiJ. P.PausR. (2018a). How UV light touches the brain and endocrine system through skin, and why. Endocrinology159 (5), 1992–2007. 10.1210/en.2017-03230
64
SlominskiA. T.ZmijewskiM. A.SemakI.KimT. K.JanjetovicZ.SlominskiR. M.et al (2017). Melatonin, mitochondria, and the skin. Cell. Mol. Life Sci.74 (21), 3913–3925. 10.1007/s00018-017-2617-7
65
StarcherB.PierceR.HinekA. (1999). UVB irradiation stimulates deposition of new elastic fibers by modified epithelial cells surrounding the hair follicles and sebaceous glands in mice. J. Invest. Dermatol.112 (4), 450–455. 10.1046/j.1523-1747.1999.00553.x
66
TeraoM.TaniM.ItoiS.YoshimuraT.HamasakiT.MurotaH.et al (2014). 11β-hydroxysteroid dehydrogenase 1 specific inhibitor increased dermal collagen content and promotes fibroblast proliferation. PloS one9 (3), e93051. 10.1371/journal.pone.0093051
67
TöbelmannD.DittmarM. (2021). Diurnal relationship between core clock gene BMAL1, antioxidant SOD1 and oxidative RNA/DNA damage in young and older healthy women. Exp. Gerontol.151, 111422. 10.1016/j.exger.2021.111422
68
VieiraE.MirizioG. G.BarinG. R.de AndradeR. V.NimerN.La SalaL. (2020). Clock genes, inflammation and the immune system-implications for diabetes, obesity and neurodegenerative diseases. Int. J. Mol. Sci.21 (24), 9743. 10.3390/ijms21249743
69
WangS.LiF.LinY.WuB. (2020). Targeting REV-ERBα for therapeutic purposes: Promises and challenges. Theranostics10 (9), 4168–4182. 10.7150/thno.43834
70
WangS.LinY.YuanX.LiF.GuoL.WuB. (2018). REV-ERBα integrates colon clock with experimental colitis through regulation of NF-κB/NLRP3 axis. Nat. Commun.9 (1), 4246–4312. 10.1038/s41467-018-06568-5
71
WangY.KojetinD.BurrisT. P. (2015). Anti-proliferative actions of a synthetic REV-ERBα/β agonist in breast cancer cells. Biochem. Pharmacol.96 (4), 315–322. 10.1016/j.bcp.2015.06.010
72
WatsonM.HolmanD. M.Maguire-EisenM. (2016). Ultraviolet radiation exposure and its impact on skin cancer risk. Semin. Oncol. Nurs.32 (3), 241–254. 10.1016/j.soncn.2016.05.005
73
YiR.ZhangJ.SunP.QianY.ZhaoX. (2019). Protective effects of kuding tea (Ilex kudingcha C. J. Tseng) polyphenols on UVB-induced skin aging in SKH1 hairless mice. Mol. (Basel, Switz.24 (6), 1016. 10.3390/molecules24061016
74
YinL.LazarM. A. (2005). The orphan nuclear receptor Rev-erbalpha recruits the N-CoR/histone deacetylase 3 corepressor to regulate the circadian Bmal1 gene. Mol. Endocrinol.19 (6), 1452–1459. 10.1210/me.2005-0057
75
YinL.WuN.LazarM. A. (2010). Nuclear receptor rev-erbalpha: A heme receptor that coordinates circadian rhythm and metabolism. Nucl. Recept. Signal.8, e001. 10.1621/nrs.08001
76
ZhangS.DongZ.PengZ.LuF. (2014). Anti-aging effect of adipose-derived stem cells in a mouse model of skin aging induced by D-galactose. PloS one9 (5), e97573. 10.1371/journal.pone.0097573
77
ZhangT.ZhaoM.LuD.WangS.YuF.GuoL.et al (2018). REV-ERBα regulates CYP7A1 through repression of liver receptor homolog-1. Drug Metab. Dispos.46 (3), 248–258. 10.1124/dmd.117.078105
78
ZhangZ.ZhuH.ZhengY.ZhangL.WangX.LuoZ.et al (2020). The effects and mechanism of collagen peptide and elastin peptide on skin aging induced by D-galactose combined with ultraviolet radiation. J. Photochem. Photobiol. B210, 111964. 10.1016/j.jphotobiol.2020.111964
79
ZhaoQ.ChenX. Y.MartinC. (2016). Scutellaria baicalensis, the golden herb from the garden of Chinese medicinal plants. Sci. Bull.61 (18), 1391–1398. 10.1007/s11434-016-1136-5
Summary
Keywords
scutellaria baicalensis georgi, skin aging, REV-erbα, BMAL1, photoaging
Citation
Sun G, Dang Y, Lin Y, Zeng W, Wu Z, Zhang X, Dong D and Wu B (2022) Scutellaria baicalensis Georgi regulates REV-ERBα/BMAL1 to protect against skin aging in mice. Front. Pharmacol. 13:991917. doi: 10.3389/fphar.2022.991917
Received
12 July 2022
Accepted
12 September 2022
Published
30 September 2022
Volume
13 - 2022
Edited by
Ahmad Nazrun Shuid, MARA University of Technology, Malaysia
Reviewed by
Andrzej T Slominski, University of Alabama at Birmingham, United States
Siti Norsyafika Kamarudin, Universiti Teknologi MARA, Malaysia
Updates
Copyright
© 2022 Sun, Dang, Lin, Zeng, Wu, Zhang, Dong and Wu.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Dong Dong, dongdong1983jd@163.com; Baojian Wu, bj.wu@hotmail.com
† These authors have contributed equally to this work
This article was submitted to Ethnopharmacology, a section of the journal Frontiers in Pharmacology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.