Abstract
Introduction:
Fatty liver is a common metabolic disease in dairy cows during early postpartum period, which is characterized by excessive hepatic triacylglycerol (TAG) accumulation. However, the mechanisms of bile acid (BA) metabolism in dairy cows experiencing fatty liver remain poorly elucidated. The farnesoid X receptor (FXR) plays a critical role in the regulation of BA homeostasis. Consequently, the aim of this study was to investigate the effect of FXR-mediated BA metabolism following stimulation with high concentrations of free fatty acids (FFA).
Methods:
In vivo, liver tissue from healthy control cows (n = 6; with hepatic TAG < 1%) and fatty liver cows (n = 6; with hepatic TAG > 2%) were used to evaluate the factors related to BA metabolism. In vitro, hepatocytes isolated from three healthy female calves were exposed to either 1.2 mM FFAs or kept as controls to simulate metabolic distress. Subsequently, hepatocytes were treated with either 5 µM of the FXR activator GW4064 or 5 µM of the FXR inhibitor (Z)-guggulsterone with or without the addition of 1.2 mM FFAs.
Results:
Our findings indicate that both in vivo and in vitro exposure to FFAs was associated with increased mRNA and protein abundance of bile acid synthesis-related factors (CYP7A1, CYP8B1) and mRNA expression of CYP7B1. Conversely, the expression of BA synthesis-related factors (FXR, CYP27A1) and BA transporters (ABCC2, ABCB11) were diminished in fatty liver cows compared to controls. Furthermore, compared to the control group, fatty acid synthesis-related factors (SREBF1, ACC1, FASN), a mitochondrial dysfunction marker (VDAC1), and oxidative stress indicators (ROS, H2O2) were upregulated in the FFA group. Additionally, cholesterol synthesis-related genes (SREBF2, HMGCR) were lower in the FFA group compared to the control group. Notably, compared to the FFA group, the GW4064 + FFA group showed reduced expression of CYP7A1, CYP8B1, CYP27A1, CYP7B1, SREBF1, ACC1, FASN, and VDAC1, along with decreased TAG, ROS, and H2O2 in hepatocytes. Conversely, the expression of FXR, SREBF2, HMGCR, ABCC2, and ABCB11 was higher in the GW4064 + FFA group compared to the FFA group. Furthermore, the application of the FXR inhibitor (Z)-guggulsterone yielded results that were contrary those observed with GW4064.
Discussion:
Overall, our data suggest that FXR activation by GW4064 effectively attenuated high FFA-induced BA and lipid accumulation in calf hepatocytes, which ultimately alleviated hepatocyte oxidative damage.
1 Introduction
Fatty liver is a common metabolic disease in high-yielding dairy cows (1, 2). During the transition period, dairy cows experience a state of negative energy balance (NEB) due to reduced dry matter intake and increased energy requirements to maintain lactation (3). NEB leads to fat mobilization, resulting in elevated circulating free fatty acid (FFA) levels, which in turn causes hepatic triacylglycerol (TAG) accumulation and fatty liver development (4, 5). Severe fatty liver reduces the production performance of dairy cows and is often accompanied by other diseases (6, 7). Therefore, it is particularly important to identify effective therapeutic targets for fatty liver.
Hepatic steatosis in dairy cows is primarily attributed to dysregulation of fatty acid oxidation, TAG synthesis, and export from very low-density lipoprotein (VLDL) (8). As the main pathway of endogenous TAG transport in the liver, the synthesis and secretion of VLDL depend on the availability of cholesterol and TAG (9). In high-yielding dairy cows, a significant reduction in liver cholesterol concentrations during early lactation is part of the typical physiological changes associated with fatty liver (9, 10).
Bile acid (BA) is synthesized from cholesterol in the liver, secreted into bile as the main solute, and plays a role in promoting lipid absorption in the intestine (11, 12). Cholesterol is converted to BA via two main routes: the classical pathway, catalyzed by cholesterol 7α-hydroxylase (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) (13), yielding cholic acid (CA), and the alternative pathway, catalyzed by sterol-27α-hydroxylase (CYP27A1) and CYP7B1, producing chenodeoxycholic acid (CDCA) (14). BA homeostasis is tightly regulated by various factors, including BA receptors, transporters, and proteins involved in enterohepatic circulation (15–17). However, the regulatory mechanisms of BA homeostasis in the liver of dairy cows with fatty liver remain unknown.
Farnesoid X receptor (FXR) is a key receptor regulating BA homeostasis in vivo, and it is highly expressed in the liver and intestine (18). As a key regulator of BA synthesis, metabolism, and transport, FXR plays a significant role in cholestatic liver diseases in humans (19). FXR-mediated activation of small heterodimer partner (SHP) represses CYP7A1 expression, thereby inhibiting BA synthesis and uptake. It also represses the expression of sterol regulatory element binding transcription factor 1 (SREBF1) (20, 21). In mice, deficiency of FXR results in increased liver steatosis (22). However, it remains unclear how FXR regulates BA and lipid synthesis in the liver of dairy cows, particularly during NEB. Therefore, this investigation aims to elucidate the role of FXR in BA and lipid metabolism in calf primary hepatocytes.
2 Materials and methods
2.1 Animal ethics
The animal use protocol complied with the guidelines set forth by the Ethics Committee for the Use and Care of Animals, Heilongjiang Bayi Agricultural University (approval No. SMKXJSXY2022003).
2.2 Liver tissue collection
All cows with a similar number of lactations (range = 2 to 4) and days in milk (DIM; range = 8 to 12) were screened for this study from a commercial dairy farm (Heilongjiang Province, China). Liver biopsies were collected as described previously (9). Liver TAG was analyzed using an enzymatic assay kit (Applygen Technologies, Inc., Beijing, China) in accordance with the manufacturer’s instructions.
Cows with liver TAG content (expressed as the ratio of triglyceride weight to wet liver weight) below 1% were classified as healthy controls, and those with liver TAG content greater than 2% were classified as having fatty liver (1). Subsequently, six dairy cows with fatty liver and six healthy control cows were selected for subsequent experiments.
2.3 Isolation and culture of primary calf hepatocytes
In the present study, a total of three healthy newborn female Holstein calves (body weight: 42–53 kg; 1 d old) were purchased from a cow dairy farm (Daqing, Heilongjiang Province, China) and housed in a temperature-controlled environment.
Primary calf hepatocytes were isolated using a modified two-step collagenase perfusion method as described previously (9). Briefly, the caudate liver lobe was surgically resected from the liver. Blood was removed from the surface of the caudate lobe by rinsing with perfusion solution A (140 mM NaCl, 6.7 mM KCl, 10 mM HEPES, 2.5 mM glucose, and 0.5 mM EDTA, pH 7.4; 37 °C, 50 mL/min for 10–15 min).
Then, perfusion solution B (140 mM NaCl, 6.7 mM KCl, 30 mM HEPES, 2.5 mM glucose, and 5 mM CaCl2, pH 7.4; 37 °C, 50 mL/min for 5 min) was used to perfuse the caudate lobe until the liquid became clear. Subsequently, the liver was perfused with digestive fluid (0.1 g of collagenase IV dissolved in 0.5 L of perfusion solution B, pH 7.4; 20 mL/min for 15 min) to dissociate the liver tissue structure until the liquid became turbid.
Digestion was terminated with precooled (4 °C) fetal calf serum (FBS, Hyclone Laboratories, UT, USA). The liver was cut into small pieces, and the hepatic parenchyma was filtered sequentially through 100-mesh (150 μm) and 200-mesh (75 μm) cell sieves.
The obtained hepatocytes were washed twice with RPMI-1640 basal medium (Hyclone Laboratories, UT, USA) and centrifuged for 5 min at 500 × g at 4 °C. Primary hepatocytes (1 × 106 cells/mL) were seeded into a 6-well tissue culture plate (2 mL per well) in adherent medium (RPMI-1640 basal medium supplemented with 10% FBS, 10−6 mM of insulin, 10−6 mM of dexamethasone, 10 μg/mL of vitamin C) and incubated for 4 h at 37 °C in 5% CO2.
The growth medium was then replaced every 24 h (RPMI-1640 basal medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin).
2.4 FFA, GW4064, and (Z)-guggulsterone preparation
The concentration of free fatty acids (FFA) used in this study was selected according to hematological criteria of dairy cows with fatty liver (23, 24).
Briefly, to prepare the FFA stock, individual fatty acids were diluted in potassium hydroxide solution (0.1 M) and dissolved at 60 °C (including c9-18:1, 18:2, 16:0, 18:0, and c9-16:1 at 43.5, 4.9, 31.9, 14.4, and 5.3% of total fatty acids, respectively). Subsequently, the pH of the FFA solution was adjusted to 7.6 with hydrochloric acid (1 M).
The final concentration of the stock solution was 60 mM. After FFA preparation, the stock solution was aliquoted and stored at −20 °C until use.
GW4064 (HY-50108; Med Chem Express Co., Ltd., NJ, USA) was dissolved in dimethyl sulfoxide (DMSO) to achieve a final concentration of 5 mM. Similarly, (Z)-guggulsterone (HY-110066; MedChemExpress Co., Ltd., NJ, USA) was dissolved in dimethyl sulfoxide (DMSO) to a final concentration of 10 mM.
2.5 Activation and inhibition of FXR
Before the addition of FXR activator GW4064, hepatocytes were cultured in 6-well plates (1 × 106 cells/mL, 2 mL per well) in growth medium for 44 h and starved for 12 h in serum-free RPMI-1640 basal medium.
Subsequently, the hepatocytes (n = 9 replicates per group) were divided into four groups: control, FFA, GW4064, and GW4064 + 1.2 mM free fatty acids (GW4064 + FFA).
In the control and FFA groups, the hepatocytes were maintained in RPMI-1640 basal medium containing 2% BSA and treated with or without 1.2 mM FFAs for 12 h. In the GW4064 and GW4064 + FFA groups, 5 μM of FXR activator GW4064 was used for 12 h before incubation with or without FFAs.
To gain better insights into the role of FXR in dairy cows with fatty liver in vitro, hepatocytes were treated with the FXR inhibitor (Z)-guggulsterone at a concentration of 5 μM for 12 h before incubation with or without 1.2 mM FFAs. The cells (n = 9 replicates per group) were divided into four groups: control, FFA, (Z)-guggulsterone, and (Z)-guggulsterone + FFA.
2.6 mRNA extraction and RT-qPCR
Total mRNA was extracted from hepatocytes (n = 9 replicates per group) using TRIzol (Invitrogen Corporation, Carlsbad, CA, USA) following the manufacturer’s protocol. Total RNA (1 μg) was transcribed into cDNA using Reverse Transcriptase M-MLV (RNase H–) (RR047A, TaKaRa Biotechnology Co., Ltd., Japan) following the manufacturer’s protocol.
The mRNA abundance was determined using FastStart Universal SYBR Green Master (ROX) (04913914001, Roche, Norwalk, CT, USA) with the Bio-Rad iCycler iQ™ Real-Time PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA, USA).
The qRT-PCR reaction system consisted of 10 μL of FastStart Universal SYBR Green Master, 2 μL of cDNA, 1 μM of each primer, and 6 μL of RNase-free distilled H2O to achieve a final volume of 20 μL.
Evaluated target genes were SREBF1, fatty acid synthase (FASN), acetyl-CoA carboxylase 1 (ACC1), sterol regulatory element-binding protein 2 (SREBF2), 3-hydroxy-3-methyl-glutaryl coenzyme A reductase (HMGCR), CYP7A1, CYP7B1, CYP8B1, cholesterol 27α-hydroxylase (CYP27A1), multidrug resistance-associated protein 2 (ABCC2), bile salt export pump (ABCB11), and FXR.
Relative mRNA abundance was normalized to the geometric mean of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB). GAPDH and ACTB maintained stable expression under the conditions of FFA, GW4064, and (Z)-guggulsterone, as analyzed by BestKeeper (25).
Target gene mRNA abundance was calculated using the 2–ΔΔCT method. Gene primers are shown in Table 1.
Table 1
| Gene | Primers (5′–3′) |
|---|---|
| SREBF2 | Forward: GACTGATGCCAAGATGCACA Reverse: CCCTTCAGGAGTTTGCTCTT |
| HMGCR | Forward: ACCCATGAGCGAGGTGTATC Reverse: TAGTGCTGGCCACAAGACAG |
| CYP7A1 | Forward: GCCCGTGCTAGACAGTATCATCAAG Reverse: CGTCCTGGAGGTGCAAAGTGAAG |
| CYP7B1 | Forward: TGCTTTCACCTGGCTGCTGTTAC Reverse: GGAGGCGGATTTGTTACCACTGAG |
| CYP27A1 | Forward: ACACGACATCCAACACGCTGAC Reverse: CACCACACCCACCACTTCCTTATG |
| CYP8B1 | Forward: GCAGAGGAAGCTAGACTTTGTGGAG Reverse: GCTTGGTGCTGGCTGAGTGTATC |
| FXR | Forward: TGCCTTTGTAAGCCTCAGTTTCACC Reverse: TCCTTTCCTCACCACCCACTTCC |
| ABCB11 | Forward: GGCACTGGACAATGAGAGCGAAG Reverse: GATAGGCGATGAGCGACAGAGATG |
| ABCC2 | Forward: CTGTGTCAGGCTTGTCTGTTATCCG Reverse: TTCTGGTTGGTGTCAATCGCTGTC |
| FASN | Forward: ACAGCCTCTTCCTGTTTGACG Reverse: CTCTGCACGATCAGCTCGAC |
| ACC1 | Forward: GCTGAATATCCTCACGGAGCT Reverse: CGACGTTTCGGACAAGATGAGT |
| SREBF1 | Forward: GCAGCCCATTCATCAGCCAGACC Reverse: CGACACCACCAGCATCAACCACG |
| ACTB | Forward: GCTAACAGTCCGCCTAGAAGCA Reverse: GTCATCACCATCGGCAATGAG |
| GAPDH | Forward: GTCTTCACTACCATGGAGAAGG Reverse: TCATGGATGACCTTGGCCAG |
Sequences of primers used for real-time PCR amplification.
2.7 Protein extraction and Western blotting
Total protein from hepatocytes (n = 9 replicates per group) was lysed using RIPA buffer (Beyotime Biotechnology, Jiangsu, China) with protease inhibitors. The supernatant was aspirated, and protein concentration was measured using the BCA protein assay kit (Beyotime, China).
Aliquots of total protein (30 μg/lane) were subjected to 8% sodium dodecyl sulfate–polyacrylamide gel electrophoresis, and protein was transferred onto a 0.45-μm polyvinylidene difluoride membrane (Millipore Corp., Billerica, MA, USA).
Then, the membrane was saturated with 5% non-fat milk and incubated with primary antibodies against SREBF1 (1:1,000, NB100–2215; Novus Biologicals, Littleton, CO, USA), FASN (1:1,000, C2065; Cell Signaling, Danvers, MA, USA), ACC1 (1:2,000, Abcam, ab45174, Cambridge, MA, USA), SREBF2 (1:500, ab30682 Abcam, Cambridge, MA, USA), HMGCR (1:1,000, A1633, ABclonal, China), CYP7A1 (1:1,000, A10615, ABclonal, China), CYP8B1(1:1,000, K109819P, Solarbio, China), CYP27A1(1:1,000, A1982, ABclonal, China), FXR (1:5,000, 25,055-1-AP, proterntech, China), VDAC1 (1:1,000, ab15895, Abcam, Cambridge, MA, USA), and β-actin (1:1,000, sc-47778; Santa Cruz Biotechnology, CA, USA) overnight at 4 °C.
The membrane was then washed with TBST and incubated with HRP-conjugated anti-rabbit or anti-mouse antibody (1:5,000; Beyotime Biotechnology, Beijing, China) for 40 min at room temperature.
The immune response signal was observed using a ProteinSimple imager (ProteinSimple, San Jose, CA, USA) with an enhanced chemiluminescence solution (Beyotime Biotechnology, China).
Band intensity analyses of immunoblots were carried out using Image Lab software (Bio-Rad Laboratories Inc., Hercules, CA, USA).
Based on the stable expression of β-actin in Western blot assays as a loading control under FFAs, GW4064, and (Z)-guggulsterone conditions, target protein abundance was normalized to β-actin abundance.
2.8 Detection of TAG content and H2O2 content
The content of TAG in liver tissue and primary hepatocytes was determined using an enzymatic assay kit (Applygen Technologies, Inc., Beijing, China) in accordance with the manufacturer’s instructions.
The TAG content in liver tissue was expressed as the ratio of triglyceride weight to wet liver weight.
For primary hepatocytes, the cells were also used to determine protein concentration via the BCA protein assay kit (Beyotime Biotechnology, China) to normalize TAG content.
2.9 Lipid droplet fluorescence detection
Approximately 5,000 cells per well were seeded into a 12-well culture plate. A 1-mL cell suspension was added to each well and treated with or without GW4064 or (Z)-guggulsterone and then incubated with or without 1.2 mM FFA.
Subsequently, the cells were washed twice with PBS and fixed for 30 min with 4% paraformaldehyde. After washing with PBS three times, BODIPY 493/503 (Invitrogen Corporation, Carlsbad, CA, USA) dye was added for 30 min in the dark.
Cells were washed twice with PBS and incubated with Hoechst 33342 dye (Beyotime Biotechnology, China) for 8 min before fluorescence microscopy (IX73, Olympus, Tokyo, Japan).
2.10 ROS detection
Reactive oxygen species (ROS) levels were determined using an assay kit (S0033S, Beyotime). A total of 1 × 105 cells were incubated with 10 μM carboxy-2′,7′-dichloro-dihydro-fluorescein diacetate probe in PBS for 15 min at 37 °C.
Fluorescence was measured at 488 nm (excitation) and 525 nm (emission) using a Beckman CytoFLEX flow cytometer (Beckman Coulter).
2.11 Statistical analysis
All data were analyzed using SPSS 22.0 (SPSS Inc., Chicago, IL, USA) or Prism 7 statistical software. The results are reported as mean ± standard error of the mean.
Data obtained regarding liver tissue were compared using a two-tailed unpaired Student’s t-test. Data from calf hepatocyte treatment comparisons were assessed by one-way ANOVA, and multiplicity for each experiment was adjusted with the Bonferroni procedure to control for type I error rate at 0.05.
3 Results
3.1 Bile acid metabolism-related factors in healthy or fatty liver cows
The TAG content in fatty liver cows was greater compared to healthy control cows (p < 0.01; Figure 1A).
Figure 1
Relative mRNA and protein abundance of BA metabolism-related factors CYP27A1 and FXR and mRNA abundance of ABCC2 and ABCB11 were lower in fatty liver cows compared to healthy controls.
In contrast, mRNA and protein abundance of CYP8B1 and CYP7A1 and mRNA abundance of CYP7B1 were greater in fatty liver cows compared to healthy controls (p < 0.05; Figures 1B,C).
3.2 Effects of FXR activation and inhibition on bile acid metabolism
Compared to the control, relative mRNA and protein abundance of CYP8B1 and CYP7A1, and mRNA abundance of CYP7B1, were greater in response to 1.2 mM FFA treatment. Conversely, mRNA and protein abundance of CYP27A1 and FXR and mRNA abundance of ABCC2 and ABCB11 were lower (p < 0.05; Figures 2, 3).
Figure 2
Figure 3
As expected, the FXR activator GW4064 led to lower mRNA and protein abundance of CYP27A1, CYP8B1, and CYP7A1 and mRNA abundance of CYP7B1 compared to the controls (p < 0.05; Figures 2A–I).
However, the mRNA and protein abundance of FXR and the mRNA abundance of ABCC2 and ABCB11 were greater in cells treated with GW4064 than controls (p < 0.01; Figures 2D, 2J–L).
Compared to the control, hepatocytes treated with the FXR inhibitor (Z)-guggulsterone had greater mRNA and protein abundance of CYP27A1, CYP8B1, and CYP7A1, and greater mRNA abundances of CYP7B1 (p < 0.05; Figures 3A–I).
In contrast, mRNA and protein abundance of FXR and mRNA abundance of ABCC2 and ABCB11 were lower in cells treated with the (Z)-guggulsterone compared to controls (p < 0.05; Figures 3D, 3J–L).
Compared to the FFA group, mRNA and protein abundance of CYP27A1, CYP8B1, and CYP7A1 and the mRNA abundance of CYP7B1, were lower in cells from the GW4064 + FFA group (p < 0.05; Figures 2A–I).
In contrast, mRNA abundance of ABCC2 and ABCB11 and mRNA and protein abundance of FXR were greater in cells with GW4064 + FFA compared to the FFA group (p < 0.05; Figures 2D, 2J–L).
Compared to the FFA group, mRNA and protein abundance of CYP27A1, CYP8B1, and CYP7A1 and mRNA abundance of CYP7B1 were greater in cells from the (Z)-guggulsterone + FFA group (p < 0.05; Figures 3A–I), while mRNA abundance of ABCC2, ABCB11, and mRNA and protein abundance of FXR in cells with (Z)-guggulsterone + FFA were lower than those in the FFA group (p < 0.05; Figures 3D, 3J–L).
3.3 Effects of FXR activation and inhibition on lipid synthesis
Compared to the control, the concentration of TAG and accumulation of lipid droplets were greater in hepatocytes challenged with FFA (Figures 4A,B).
Figure 4
However, hepatocytes treated with GW4064 had lower TAG concentration than the control (p < 0.05; Figure 4A).
TAG concentration in hepatocytes in the GW4064 + FFA group was lower than that in the FFA group (p < 0.01; Figure 4A).
Compared to the control, mRNA and protein abundance of SREBF1, ACC1, and FASN were greater in response to 1.2 mM FFA treatment (p < 0.05; Figures 4C–I).
Compared to the FFA group, mRNA and protein abundance of SREBF1, ACC1, and FASN were lower in cells with GW4064 + FFA (p < 0.05, Figures 4D–I).
Compared to the control, hepatocyte TAG concentration in the (Z)-guggulsterone group was increased.
TAG concentration in the (Z)-guggulsterone + FFA group was greater compared to the FFA group (p < 0.05; Figures 5A,B). Compared to the FFA group, (Z)-guggulsterone + FFA led to greater mRNA and protein abundance of SREBF1, ACC1, and FASN (p < 0.05, Figures 5C–I).
Figure 5
3.4 Effects of FXR activation and inhibition on cholesterol synthesis
Compared to the control, mRNA and protein abundance of SREBF2 and HMGCR were lower in the 1.2 mM FFA group (p < 0.05; Figure 6).
Figure 6
Interestingly, the FXR activator GW4064 led to greater mRNA and protein abundance of SREBF2 and HMGCR than the control (p < 0.05; Figures 6A–E).
However, hepatocytes treated with (Z)-guggulsterone had lower mRNA and protein abundance of SREBF2 and HMGCR than control (p < 0.01; Figures 6F–I).
Compared to the FFA group, mRNA and protein abundance of SREBF2 and HMGCR were greater in the GW4064 + FFA group (p < 0.05, Figures 6A–E).
In contrast, mRNA and protein abundance of SREBF2 and HMGCR in hepatocytes treated with (Z)-guggulsterone + FFA were lower than those in the FFA group (p < 0.05, Figures 6F–I).
3.5 Effects of FXR activation and inhibition on hepatocyte injury
Compared to the control group, the protein abundance of VDAC1 was greater in response to 1.2 mM FFA treatment.
However, GW4064 led to lower protein abundance of VDAC1 compared to the control group (p < 0.01; Figure 7B).
Figure 7
In contrast, the (Z)-guggulsterone group had greater protein abundance of VDAC1 than the control (p < 0.01; Figure 8B).
Figure 8
Compared to the FFA group, GW4064 + FFA led to lower protein abundance of VDAC1 (p < 0.01, Figure 7B). In contrast, (Z)-guggulsterone + FFA led to greater protein abundance of VDAC1 compared to the FFA group (p < 0.01; Figure 8B).
Compared to the control, ROS and H2O2 content in hepatocytes were greater in response to 1.2 mM FFA treatment (p < 0.01; Figures 7, 8).
However, ROS and H2O2 content in GW4064 were lower compared to the control (p < 0.05; Figures 7D,E).
However, ROS and H2O2 content in the (Z)-guggulsterone groups were greater compared to the control (p < 0.01; Figures 8D,E).
In addition, compared to the FFA group, ROS and H2O2 content were lower in hepatocytes with GW4064 + FFA (p < 0.01; Figures 7D,E), whereas ROS and H2O2 content were greater in hepatocytes with (Z)-guggulsterone + FFA (p < 0.05; Figures 8D,E).
4 Discussion
Peripartal dairy cows experience severe NEB, resulting in elevated circulating FFA levels that exceed the liver’s capacity for lipid oxidation and secretion. This can result in fatty liver due to the accumulation of TAG (8).
Previous research indicates a functional crosstalk between the BA-dependent FXR pathway and intrahepatic TAG metabolism. In human studies, reduced protein levels of FXR in nonalcoholic steatohepatitis (NASH) patients compared to non-alcoholic fatty liver disease (NAFLD) patients suggest a protective role for FXR in the progression of NAFLD to non-alcoholic steatohepatitis (NASH) (26).
Our investigation revealed that exogenous FFA challenge decreased FXR expression in calf hepatocytes. Notably, the FXR activator GW4064 reduced TAG accumulation induced by high FFA levels in these cells.
In addition, this study demonstrated that activated FXR inhibited the expression of lipid synthesis-related factors SREBF1, ACC1, and FASN in calf hepatocytes. In hypertriglyceridemic mouse models, BA administration downregulated SREBF1 and consequently reduced plasma TAG levels (27).
Activation of FXR has been shown to inhibit SREBF1-mediated lipogenesis through the FXR–SHP pathway (27). Moreover, previous studies have shown that FXR activation reduces FFA levels in both wild-type and diabetic db/db mice (28).
Consistent with these findings, our study demonstrated that the inhibition of FXR by (Z)-guggulsterone increased the protein and mRNA abundance of SREBF1, as well as TAG content in calf hepatocytes.
Therefore, activating FXR can attenuate high FFA-induced TAG levels and lipid droplet accumulation by upregulating FXR expression and inhibiting SREBF1-mediated hepatic lipogenesis.
FXR exerts feedback inhibition on BA synthesis via two primary mechanisms. First, FXR-mediated activation of SHP represses CYP7A1 expression, thereby inhibiting BA synthesis and uptake. Second, BA activates intestinal FXR–FGF15/19 signaling, which subsequently suppresses hepatic CYP7A1 expression and induces SHP expression in hepatocytes, leading to the inhibition of CYP8B1 and CYP7A1 gene transcription (29).
Related studies have shown that systemic disruption of the FXR gene has been linked to aberrant cholesterol and lipid homeostasis and is associated with impaired BA transport and reduced expression of ABCB11 (30). Deficiencies in ABCB11 are a significant cause of cholestasis, resulting in hepatotoxicity, inflammation, and oxidative stress within hepatocytes (13, 31).
Our study found that hepatocytes treated with the FXR activator GW4064 exhibited reduced CYP7A1 expression and increased ABCB11 expression.
Impaired bile secretion can lead to cholestasis, causing the accumulation of bile salts and other toxic substances within hepatocytes. This study found that the expression of BA synthesis-related genes (CYP7A1, CYP8B1, CYP27A1, CYP7B1) was downregulated, and BA transporter genes (ABCC2, ABCB11) were upregulated after the activation of FXR by GW4064.
The FXR inhibitor (Z)-guggulsterone induced the converse effects. Consistently, previous studies have shown increased hepatic BA accumulation in dairy cows with fatty liver (32).
Therefore, the reduction of hepatic BA accumulation by activating hepatic FXR prevents the further development of fatty liver disease caused by intrahepatic cholestasis.
Hepatic cholesterol homeostasis is intricately linked to a cascade of enzymatic reactions involved in BA biotransformation. FXR promotes the expression of the scavenger receptor class B type I (SR-B1), which mediates hepatic uptake of cholesteryl esters from high-density lipoprotein (HDL), thereby contributing to reduced plasma HDL levels (14, 33).
Our findings indicate that high FFA levels lead to a decrease in the expression of SREBF2, which in turn reduces cholesterol synthesis (9). Actually, cholesterol stimulates CYP7A1 transcription, and as the rate-limiting enzyme in cholesterol conversion to bile acids, reduced CYP7A1 expression results in elevated intracellular cholesterol levels (34).
Consistently, FXR activator GW4064 led to an upregulated expression of HMGCR and SREBF2. Our previous studies have indicated that cholesterol availability can promote VLDL excretion and reduce lipid accumulation and oxidative stress in hepatocytes challenged with high concentrations of fatty acids (9).
Therefore, the activated FXR was suggested to reduce CYP7A1-induced hepatocytes to synthesize primary bile acids from cholesterol, while promoting cholesterol-induced VLDL excretion in hepatocytes challenged with high concentrations of fatty acids. Furthermore, FXR activation has demonstrated protective effects against cellular oxidative stress and mitochondrial damage (35). Moreover, a previous study on BA profiles in periparturient dairy cows indicated that serum concentrations of CA, CDCA, glycocholic acid (GCA), taurocholic acid, glycochenodeoxycholic acid, deoxycholic acid, lithocholic acid (LCA), and glycodeoxycholic acid were lower in high body condition score (BCS) cows compared with normal BCS cows. Conversely, serum concentrations of β-muricholic acid (β-MCA) were higher in high BCS cows compared with normal BCS cows (36).
Notably, CA, LCA, CDCA, and GCA are natural agonists of FXR, whereas β-MCA acts as an antagonist (37).
Importantly, supplementation with BAs during the transition period has been shown to reduce oxidative stress and inflammation, while potentially enhancing the health and lactation performance of dairy cows (38).
Thus, our data suggest that activation of FXR can reduce the synthesis and excretion of BAs and alleviate the lipid accumulation in hepatocytes caused by a high fatty acid load. Furthermore, supplementation with natural agonists bile salt of FXR, suggest a beneficial effects on fatty liver in dairy cows.
Although calf hepatocytes were widely used to elucidate regulatory mechanisms of hepatic lipid metabolism in adult ruminants (39, 40). Caution should be exercised when attempting to infer regulatory mechanisms from hepatocytes of 1-day-old calves. Because there are clear differences in aspects of lipid metabolism as a function of age (41). Although the present in vitro data suggested that FXR affects BA metabolism, the actual role of FXR in dairy cow hepatic lipid metabolism remains to be determined.
5 Conclusion
A high fatty acid load induces lipid synthesis and BA synthesis, while suppressing cholesterol synthesis and FXR expression in primary calf hepatocytes. The activation of FXR by GW4064 effectively alleviated high FFA-mediated BA and lipid accumulation in calf hepatocytes, ultimately mitigating cellular oxidative stress. Collectively, this study highlights FXR-mediated BA metabolism as a potential therapeutic strategy for reducing FFA-induced lipid accumulation in the liver of dairy cows during the transition period.
Statements
Data availability statement
The original contributions presented in the study are included in the article/supplementary material, and further inquiries can be directed to the corresponding authors.
Ethics statement
The animal studies were approved by Ethics Committee for the Use and Care of Animals, Heilongjiang Bayi Agricultural University (approval No. SMKXJSXY2022003). The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.
Author contributions
BJ: Methodology, Writing – original draft, Writing – review & editing. YT: Methodology, Writing – original draft, Writing – review & editing. CG: Data curation, Writing – original draft, Writing – review & editing. YC: Data curation, Methodology, Writing – review & editing. ZZ: Data curation, Methodology, Writing – review & editing. YS: Data curation, Methodology, Writing – review & editing. CX: Formal analysis, Writing – review & editing. YQ: Conceptualization, Data curation, Funding acquisition, Methodology, Writing – review & editing. WY: Data curation, Funding acquisition, Methodology, Writing – review & editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This research was supported by the National Key R&D Program of China (2023YFD1802100), and Chinese National Natural Science Foundation (U24A20454), and Longjiang Technology Talent “Chunyan” Support Program Youth Team (CYQN24048).
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that Generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1.
BobeGYoungJWBeitzDC. Invited review: pathology, etiology, prevention, and treatment of fatty liver in dairy cows. J Dairy Sci. (2004) 87:3105–24. doi: 10.3168/jds.S0022-0302(04)73446-3
2.
DrackleyJK. Dietary interventions for optimal liver function in high-yielding dairy cows. Annu Rev Anim Biosci. (2025) 14:207–28. doi: 10.1146/annurev-animal-030424-085431,
3.
YangWZhangBXuCZhangHXiaC. Effects of ketosis in dairy cows on blood biochemical parameters, Milk yield and composition, and digestive capacity. J Vet Res. (2019) 63:555–60. doi: 10.2478/jvetres-2019-0059,
4.
ZhangBYangWWangSLiuRLoorJJDongZet al. Lipid accumulation and injury in primary calf hepatocytes challenged with different long-chain fatty acids. Front Vet Sci. (2020) 7:547047. doi: 10.3389/fvets.2020.547047,
5.
KongFLeiLCaiLLiJZhaoCLiuMet al. Hypoxia-inducible factor 2alpha mediates nonesterified fatty acids and hypoxia-induced lipid accumulation in bovine hepatocytes. J Dairy Sci. (2025) 108:4062–78. doi: 10.3168/jds.2024-25839
6.
KatohN. Relevance of apolipoproteins in the development of fatty liver and fatty liver-related peripartum diseases in dairy cows. J Vet Med Sci. (2002) 64:293–307. doi: 10.1292/jvms.64.293,
7.
MartensH. Invited review: increasing milk yield and negative energy balance: a gordian knot for dairy cows?Animals. (2023) 13:3097. doi: 10.3390/ani13193097,
8.
YangWWangSLoorJJLopesMGZhaoYMaXet al. Role of diacylglycerol O-acyltransferase (Dgat) isoforms in bovine hepatic fatty acid metabolism. J Dairy Sci. (2022) 105:3588–600. doi: 10.3168/jds.2021-21140,
9.
YangWWangSZhaoYJiangQLoorJJTianYet al. Regulation of cholesterol metabolism during high fatty acid-induced lipid deposition in calf hepatocytes. J Dairy Sci. (2023) 106:5835–52. doi: 10.3168/jds.2022-23136,
10.
KesslerECGrossJJBruckmaierRMAlbrechtC. Cholesterol metabolism, transport, and hepatic regulation in dairy cows during transition and early lactation. J Dairy Sci. (2014) 97:5481–90. doi: 10.3168/jds.2014-7926,
11.
MonteMJFabregaLRomeroMRTempranoAGKaplowitzNGarcia-RuizCet al. Bile acids in liver and gastrointestinal cancer. Semin Cancer Biol. (2025) 116:45–58. doi: 10.1016/j.semcancer.2025.09.002
12.
JiaWLiYCheungKCPZhengX. Bile acid signaling in the regulation of whole body metabolic and immunological homeostasis. Sci China Life Sci. (2024) 67:865–78. doi: 10.1007/s11427-023-2353-0,
13.
FuchsCDTraunerM. Role of bile acids and their receptors in gastrointestinal and hepatic pathophysiology. Nat Rev Gastroenterol Hepatol. (2022) 19:432–50. doi: 10.1038/s41575-021-00566-7,
14.
FuchsCDSimbrunnerBBaumgartnerMCampbellCReibergerTTraunerM. Bile acid metabolism and signalling in liver disease. J Hepatol. (2025) 82:134–53. doi: 10.1016/j.jhep.2024.09.032
15.
CaiJRimalBJiangCChiangJYLPattersonAD. Bile acid metabolism and signaling, the microbiota, and metabolic disease. Pharmacol Ther. (2022) 237:108238. doi: 10.1016/j.pharmthera.2022.108238,
16.
JiaWXieGJiaW. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat Rev Gastroenterol Hepatol. (2018) 15:111–28. doi: 10.1038/nrgastro.2017.119,
17.
Di CiaulaAGarrutiGLunardi BaccettoRMolina-MolinaEBonfrateLWangDQet al. Bile acid physiology. Ann Hepatol (2017) 16(Suppl.: s3-105.):s4–s14. doi: 10.5604/01.3001.0010.5493
18.
JiangLZhangHXiaoDWeiHChenY. Farnesoid X receptor (Fxr): structures and ligands. Comput Struct Biotechnol J. (2021) 19:2148–59. doi: 10.1016/j.csbj.2021.04.029,
19.
ChiangJYLFerrellJM. Discovery of Farnesoid X receptor and its role in bile acid metabolism. Mol Cell Endocrinol. (2022) 548:111618. doi: 10.1016/j.mce.2022.111618,
20.
CliffordBLSedgemanLRWilliamsKJMorandPChengAJarrettKEet al. Fxr activation protects against nafld via bile-acid-dependent reductions in lipid absorption. Cell Metab. (2021) 33:e4:1671–84. doi: 10.1016/j.cmet.2021.06.012
21.
LiuCCaiTChengYBaiJLiMGuBet al. Postbiotics prepared using Lactobacillus reuteri ameliorates ethanol-induced liver injury by regulating the Fxr/Shp/Srebp-1c axis. Mol Nutr Food Res. (2024) 68:e2300927. doi: 10.1002/mnfr.202300927,
22.
PrawittJAbdelkarimMStroeveJHPopescuIDuezHVelagapudiVRet al. Farnesoid X receptor deficiency improves glucose homeostasis in mouse models of obesity. Diabetes. (2011) 60:1861–71. doi: 10.2337/db11-0030,
23.
RukkwamsukTGeelenMJKruipTAWensingT. Interrelation of fatty acid composition in adipose tissue, serum, and liver of dairy cows during the development of fatty liver postpartum. J Dairy Sci. (2000) 83:52–9. doi: 10.3168/jds.S0022-0302(00)74854-5
24.
WangSJiangQLoorJJGaoCYangMTianYet al. Role of Sortilin 1 (Sort1) on fatty acid-mediated cholesterol metabolism in primary calf hepatocytes. J Dairy Sci. (2022) 105:7773–86. doi: 10.3168/jds.2022-22108,
25.
PfafflMWTichopadAPrgometCNeuviansTP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: Bestkeeper--excel-based tool using pair-wise correlations. Biotechnol Lett. (2004) 26:509–15. doi: 10.1023/b:bile.0000019559.84305.47
26.
Aguilar-OlivosNECarrillo-CordovaDOria-HernandezJSanchez-ValleVPonciano-RodriguezGRamirez-JaramilloMet al. The nuclear receptor Fxr, but not Lxr, up-regulates bile acid transporter expression in non-alcoholic fatty liver disease. Ann Hepatol. (2015) 14:487–93. doi: 10.1016/S1665-2681(19)31170-6,
27.
WatanabeMHoutenSMWangLMoschettaAMangelsdorfDJHeymanRAet al. Bile acids lower triglyceride levels via a pathway involving Fxr, Shp, and Srebp-1c. J Clin Invest. (2004) 113:1408–18. doi: 10.1172/JCI21025,
28.
ZhangYLeeFYBarreraGLeeHValesCGonzalezFJet al. Activation of the nuclear receptor Fxr improves hyperglycemia and hyperlipidemia in diabetic mice. Proc Natl Acad Sci USA. (2006) 103:1006–11. doi: 10.1073/pnas.0506982103,
29.
BechmannLPKocabayogluPSowaJPSydorSBestJSchlattjanMet al. Free fatty acids repress small heterodimer partner (Shp) activation and adiponectin counteracts bile acid-induced liver injury in superobese patients with nonalcoholic steatohepatitis. Hepatology. (2013) 57:1394–406. doi: 10.1002/hep.26225,
30.
WangLLuoQZengSLouYLiXHuMet al. Disordered farnesoid X receptor signaling is associated with liver carcinogenesis in Abcb11-deficient mice. J Pathol. (2021) 255:412–24. doi: 10.1002/path.5780,
31.
RenTPangLDaiWWuSKongJ. Regulatory mechanisms of the bile salt export pump (Bsep/Abcb11) and its role in related diseases. Clin Res Hepatol Gastroenterol. (2021) 45:101641. doi: 10.1016/j.clinre.2021.101641,
32.
DuXLiuMTrevisiEJuLYangYGaoWet al. Expression of hepatic genes involved in bile acid metabolism in dairy cows with fatty liver. J Dairy Sci. (2024) 107:8629–41. doi: 10.3168/jds.2023-24485,
33.
LitvinovDYSavushkinEVDergunovAD. Intracellular and plasma membrane events in cholesterol transport and homeostasis. J Lipids. (2018) 2018:1–22. doi: 10.1155/2018/3965054,
34.
ChenZShaoWLiYZhangXGengYMaXet al. Inhibition of Pcsk9 prevents and alleviates cholesterol gallstones through Pparalpha-mediated Cyp7a1 activation. Metabolism. (2024) 152:155774. doi: 10.1016/j.metabol.2023.155774
35.
LiMHeYZhangWYinYJiangQLoorJJet al. Taraxasterol alleviates fatty acid-induced lipid deposition in calf hepatocytes by decreasing ROS production and endoplasmic reticulum stress. J Anim Sci. (2023) 101:skad015. doi: 10.1093/jas/skad015,
36.
DicksLvon Schuh- GraevenitzKPrehnCSadriHMuraniEHosseini GhaffariMet al. Bile acid profiles and mRNA abundance of bile acid-related genes in adipose tissue of dairy cows with high versus normal body condition. J Dairy Sci. (2024) 107:6288–307. doi: 10.3168/jds.2024-24346,
37.
HuWGongWYangFChengRZhangGGanLet al. Dual Gip and Glp-1 receptor agonist Tirzepatide alleviates hepatic steatosis and modulates gut microbiota and bile acid metabolism in diabetic mice. Int Immunopharmacol. (2025) 147:113937. doi: 10.1016/j.intimp.2024.113937,
38.
FanFXWuFCGuoZYCheHYYangKLSunHZet al. Supplementation with ursodeoxycholic acid and bile salt benefits lactation performance, health, and rumen and fecal microbiota of transition dairy cows. J Dairy Sci. (2025) 108:5982–96. doi: 10.3168/jds.2024-26224
39.
GrauletBGruffatDDurandDBauchartD. Fatty acid metabolism and very low density lipoprotein secretion in liver slices from rats and preruminant calves. J Biochem. (1998) 124:1212–9. doi: 10.1093/oxfordjournals.jbchem.a022240,
40.
LiuMGuJZhaoCLiJKongFDuXet al. Hepatocyte necroptosis is associated with liver damage in dairy cows with ketosis. J Dairy Sci. (2025) 108:8844–58. doi: 10.3168/jds.2025-26349,
41.
HahnOGronkeSStubbsTMFiczGHendrichOKruegerFet al. Dietary restriction protects from age-associated DNA methylation and induces epigenetic reprogramming of lipid metabolism. Genome Biol. (2017) 18:56. doi: 10.1186/s13059-017-1187-128351387,
Summary
Keywords
bile acid, dairy cow, fatty liver, FXR, lipid accumulation
Citation
Jia B, Tian Y, Gao C, Chang Y, Zhang Z, Song Y, Xia C, Qu Y and Yang W (2026) Influence of farnesoid X receptor (FXR) on lipid metabolism in calf hepatocytes exposed to high fatty acid levels. Front. Vet. Sci. 13:1801528. doi: 10.3389/fvets.2026.1801528
Received
01 February 2026
Revised
02 March 2026
Accepted
13 April 2026
Published
30 April 2026
Volume
13 - 2026
Edited by
Ping Liu, Jiangxi Agricultural University, China
Reviewed by
Xiliang Du, Jilin University, China
Larissa Rodrigues, University of São Paulo, Brazil
Updates
Copyright
© 2026 Jia, Tian, Gao, Chang, Zhang, Song, Xia, Qu and Yang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yongli Qu, ylqu007@126.com; Wei Yang, yangwei416@126.com
†These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.