Corrigendum: Microbiome of Trichodesmium Colonies from the North Pacific Subtropical Gyre

In the original article, there were two errors. First, an incorrect NCBI accession number was provided. A correction has been made to Methods, Bioinformatic Analyses, Paragraph 4:

“All raw sequences are available from NCBI (accession SRP095769). Assemblies and annotation data are available from IMG/M ER (http://img.jgi.doe.gov/mer; Taxon OIDs 3300009572, 3300009536, and 3300010936).”

Additionally, in the original article, the two primer sets used for nested nifH PCR were listed in the incorrect order and included an incorrect reference. A correction has been made to Methods, Nucleic Acid Extraction, Amplification, and Sequencing, Paragraph 3:

“The nifH gene was amplified using nested degenerate nifH primers (Zehr and McReynolds, 1989; Zani et al., 2000). The first round contained 1X PCR buffer, 0.1U Platinum High Fidelity Taq polymerase (Invitrogen), 200 μmol L⁻¹ dNTPs, 3% BSA, 4 mmol L⁻¹ Mg²⁺, 1 μL DNA or cDNA, and 1 μmol L⁻¹ nifH3 and nifH4 primers (Zani et al., 2000). Reaction conditions were: 94°C for 7 min, followed by 30 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min, and a final 72°C extension for 7 min. The second round of nifH PCR used the same components and thermocycling conditions as the first round, except the DNA extract was replaced with 1 μL of the amplified product generated during the first round PCR reaction, and custom primers were used, consisting of gene-specific sites (nifH1 and nifH2), dual- indexed barcodes, Illumina linkers, and a sequencing primer binding region, similar to those described by Kozich et al. (2013; Table S1). PCR negative controls and filter blank samples were included in PCR reactions.”

Finally, there was a mistake in the legend for Supplementary Table 1 as published. This table listed the incorrect nifH primer names. The correct legend appears below.

Table S1: Dual-index barcoded, forward and reverse nifH primers (5′ -> 3′) used in this study. Sample barcodes are shown in bold. Forward and reverse nifH PCR primers are indicated by nifH1 (TGYGAYCCNAARGCNGA) and nifH2 (ADNGCCATCATYTCNCC; note the misprint of this primer in the original manuscript by Zani et al., 2000). NNNN indicate Illumina linker regions: AATGATACGGCGACCACCGAGATCTACAC (forward) and CAAGCAGAAGACGGCATACGAGAT (reverse). Blue text indicates the binding site for sequencing primers, which were designed to optimize melting temperature during sequencing, as described by Kozich et al. (2013).

The authors apologize for these errors and state that they do not change the scientific conclusions of the article in any way.

Statements

Summary

Keywords

Trichodesmium, marine microbiome, nifH diversity, heterotrophic marine diazotrophs, metagenomics, 16S rRNA, nitrogen fixation

Citation

Gradoville MR, Crump BC, Letelier RM, Church MJ and White AE (2017) Corrigendum: Microbiome of Trichodesmium Colonies from the North Pacific Subtropical Gyre. Front. Microbiol. 8:1780. doi: 10.3389/fmicb.2017.01780

Received

14 August 2017

Accepted

01 September 2017

Published

19 September 2017

Volume

8 - 2017

Edited and reviewed by

Sophie Rabouille, Centre National de la Recherche Scientifique (CNRS), France

Updates

Check for updates

Copyright

© 2017 Gradoville, Crump, Letelier, Church and White.

This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Mary R. Gradoville mgradoville@ucsc.edu

†Present Address: Mary R. Gradoville, Ocean Sciences Department, University of Santa Cruz, Santa Cruz, CA, United States

This article was submitted to Aquatic Microbiology, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.