Abstract
Paracetamol, or acetaminophen (AAP), is the most commonly used analgesic during pregnancy and early life. While therapeutic doses of AAP are considered harmless during these periods, recent findings in both humans and rodents suggest a link between developmental exposure to AAP and behavioral consequences later in life. The aim of this study is to evaluate the impact of neonatal exposure to clinically relevant doses of AAP on adult spontaneous behavior, habituation, memory, learning, and cognitive flexibility later in life using a mouse model. Markers of oxidative stress, axon outgrowth, and glutamatergic transmission were also investigated in the hippocampus during the first 24 h after exposure. In addition, potential long-term effects on synaptic density in the hippocampus have been investigated. In a home cage setting, mice neonatally exposed to AAP (30 + 30 mg/kg, 4 h apart) on postnatal day 10 displayed altered spontaneous behavior and changed habituation patterns later in life compared to controls. These mice also displayed reduced memory, learning and cognitive flexibility compared to control animals in the Morris water maze. An increase of markers for oxidative stress was observed in the hippocampus 6 h after AAP exposure. As AAP is the first choice treatment for pain and/or fever during pregnancy and early life, these results may be of great importance for risk assessment. Here we show that AAP can have persistent negative effects on brain development and suggest that AAP, despite the relatively low doses, is capable to induce acute oxidative stress in the hippocampus.
1 Introduction
Paracetamol, or acetaminophen (AAP), is administrated to pregnant woman and neonates as an analgesic and antipyretic. This drug has for a long time been the most common analgesic and antipyretic drug during pregnancy, partly due to its alleged safety. In Northen America and in Northern and Western Europe the prevalence of using AAP during pregnancy is ∼50–60% (). To a large extent, the high AAP use during pregnancy is based on its advantages over other painkillers, with the non-steroidal anti-inflamatoric drugs (NSAIDs) having a less favorable risk-benfit profile in pregnant women ().
The safety of developmental exposure to AAP has under the recent years been under scrutiny. Epidemiological evidence suggest that developmental exposure to AAP is associated with adverse neurodevelopmental outcomes later in life. More specifically, these studies suggested that there is an association between prenatal AAP exposure and the neurodevelopmental outcomes such as attention deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD), lower IQ and language delay (; ; ; ; ; ; ; ; ; ). In animal studies, pre and perinatal AAP exposure have shown to affect neurobehavior later in life. There is a critical period during brain development, the brain growth spurt (BGS), which has been shown to be sensitive to AAP exposure (; ; ). Among other things, it has been found in mice that therpeutic doses of AAP (30 + 30 mg/kg, 4 h apart, human equvalent dose (HED: 4.9 mg/kg), exposed for a single day during the BGS, change adult spontaneous behavior and habituation rates in a new home environment (; ). The AAP HED was estimated using the body surface normalization method (). Other studies have shown in rats that continuous fetal and early life exposure to therapeutic doses of AAP (5 or 15 mg/kg, HED: 1.6 or 8.1 mg/kg respectively) change cognitive function, working memory and change neurotransmission in various brain regions (; ; ; ).
Regarding the neurodevelopmental adverse effects of AAP, the major challenge is its unclear mechanism of action. For its therapeutic use, interaction with the endocannabinoid system (indirect and direct) and the cyclooxygenase system, account for most of AAPs therapeutic effect (). However, when it comes to the mechanism that are causing the adverse developmental effects of AAP, at therapeutic doses, many potential mechanisms have been suggested: 1) excess toxic NAPQI formation in the CNS, 2) oxidative stress, inflammation, 3) altered levels of BDNF, 4) effects on endocannabinoid signaling, 5) effects on prostaglandin synthesis, and finally 6) endocrine disruption; for further information read review by Bauer and colleagues ().
Owing to the uncertain mechanism of action of AAP, and the accumulating indications that exposure to this drug may interfere with brain development, it is important to continue the neurotoxicological evaluation of this commonly used painkiller. In a consensus statement from 2020, a group of researchers (consisting of clinicians, epidemiologists and scientists) state their concern about the recent findings regarding the developmental effects of AAP (). This statement is based on the accumulating evidence showing increased risks of some neurodevelopmental, reproductive and urogenital disorders if exposed to AAP during pregnancy. Here, the developmental effects on the hippocampus, following PND 10 exposure to AAP, were evaluated by monitoring the time-dependet alterations on oxidative stress markers during the first 24 h after exposure. In addition, protien levels of Glutamate receptor 1 (GLUR1) and Growth Associated Protein 43 (GAP-43) in the hippocamus is measured 24 h after exposure. Then, an evaluation of adult spontaneous behavior, habituation capability, memory, learning and cognitive flexibility was conducted, together with measurments of synaptic marker synaptophysin (SYP) in both the CA3 region of the hippocamus and in the dentate gyrus. By using a singe-day exposure model, information that is relevant for human exposure to AAP is obtained, since exposure to AAP usually are transient.
2 Materials and Methods
2.1 Animals and Chemicals
Pregnant NMRI mice (from Charles River Laboratory) were purchased from Scanbur, Sollentuna, Sweden and were housed individually in plastic cages in a temperature-controlled (22°C) and light-controlled (12 h light/dark cycle) room with a relative humidity in the range 45–65%. All experimental animals had free access to standardized pellet food (Lactamin, Stockholm, Sweden) and tap water. The pregnant NMRI mice were checked for birth once daily (18.00 h) and day of birth was counted as PND 0. Within 48 h after birth, litter sizes were adjusted to 10–12 pups of both sexes.
AAP (Paracetamol Fresenius Kabi, 10 mg ml−1; Fresenius Kabi AB, Sweden; CAS no. 103-90-2) was purchased from Apoteksbolaget, Uppsala, Sweden, and a stock solution containing 6 mg AAP ml−1 saline (0.9% sodium chloride in water) was made.
2.2 Exposures
Male mice were exposed on PND 10 to either saline vehicle or AAP (30 + 30 mg AAP mg/kg, 4 h apart) with a subcutaneous injection at the scruff.
For the recordings of adult behaviors, male mice at the age of around 4 weeks (after weaning) were separated from their female siblings, which were euthanized, and were kept with their male siblings from each treatment group. Litters contained four to nine animals. When the animals reached 3 months of age they were subjected to spontaneous behavior testing. For biochemical evaluation, male pups, randomly selected from different litters, were administered subcutaneously with either 30 + 30 mg AAP/kg or vehicle on PND 10.
For mechansitical investigations on the neonatal brain, pups were euthanized by decapitation at different time-points during the following 24 h, more specifically following either 2, 6, 12 or 24 h post-dose. Brains were dissected on an ice-cold glass plate and hippocampi were collected and individually snap frozen in liquid nitrogen and then stored at −80°C until assayed.
For mechansitical investigations on the adult brain, adult male mice were anesthetized by intraperitoneal injection of 0.01 mg/g body weight sodium Pentobarbital (Apoteket Farmaci, Sweden) and the tissues were fixed by transcardiac perfusion with 4% formaldehyde (Histolab, Sweden). The brains were then dissected out and were stored in 4% formaldehyde overnight before they were frozen in CryMold and stored at −80°C until sectioning.
2.3 Behavior Assessment
2.3.1 Spontaneous Behavior and Habituation Rates in a New Home Cage in 3-month Old Mnice
Mice exposed to AAP (30 + 30 mg/kg, 4 h apart; n = 9) and control mice (vehicle; n = 9) were tested for spontaneous locomotor activity in a new home cage. For this, the Panlab Infrared (IR) Actimeter was used. The system is composed by a 2-dimensional (X and Y-axes) square frame. Each frame counts with 16 × 16 infrared beams for subject detection, where activity from four cages were analyzed simultaneously. Spontaneous behavior in a novel home environment measures the integration of sensory input into motor output and tests the animals’ ability to integrate new information with information previously attained, hence the mice ability to habituate. Habituation is a non-associative form of learning and is considered cognitive function (; ; ). The ability to habituate to a new environment is here defined as a decrease in distance travelled (mm) over time. The concept of using a decrease in activity, when introduced to a new home cage, has been explained in more details elsewhere (; ). In breif, the test was conducted when mice reached 3 months of age and observations took place between 08:00 and 12:00 h, under the same light and temperature conditions in which the animals were housed. Four individuals were randomly chosen from three to four different litters from each exposure group. Control mice reached base-line activity after 90 min of habituation. In each 90 min observation session, recordings of the distance travelled were then sub-devided into three equally long time spells, and subsequently statistically evaluated.
2.3.2 Memory, Learning and Re-learing Abilities Using the Morris Water Maze in 4-month Old Mice
Mice exposed to AAP (30 + 30 mg/kg, 4 h apart; n = 12) and control mice (vehicle; n = 10) were tested in a swim maze at 4 month of age. These animals were randomly chosen from three to four different litters. The animals were tested in a swim maze of the Morris water maze (MWM) type (), as previously described ().
In breif, a circular container with a diameter of 103 cm was filled with water to a depth of 15 cm from the brim (water temperature 21°C). External visual cues were positioned on the north, south, east and west walls; the relative positions of the observer and the Morris maze pool were the same throughout the course of the swim maze test. In the middle of the northwest quadrant a metal mesh platform with a diameter of 12 cm was submerged 1 cm below the water surface. The behavioural test was performed on five consecutive days to test the mouse’s spatial learning ability to locate the platform on the first 4 days (five trials/day). On the fifth day, the platform was re-located to the northeast quadrant and the mice were tested for their re-learning ability (five trials), otherwise the procedure was identical. During the first 4 days of aquisituion, the latancy to find the platform was used to assess spatial learning performance. Following re-location of the platform, the latency to find the platform’s new position was used to assess cognitive flexibility.
Each mouse was placed on the platform for 20 s and then released, head toward the wall of the container, in different squadrants on a rotating schedule (southwest → southeast → northeast → southwest), starting as follows: southwest quadrant on day 1; southeast squadrant on day 2; northeast squadrant on day 3; southwest sqadrant on day 4. The mice had 30 s to locate the submerged platform, and between each trial the mouse rested on the platform for 20 s. The time taken to reach the platform was measured by the observer.
2.4 Biochemical and Molecular Assessment
2.4.1 Hippocampal Oxidative Stress Using Quantitative Real-Time PCR 2, 6, 12 and 25 h After Exposure
Relative expression levels of mRNAs were measured by quantitative real-time PCR. Hippocampus was homogenized in PureZOL isolation agent (BioRad, Stockholm, Sweden). The total RNA was isolated using Aurum Total RNA extraction columns (Bio-Rad, Stockholm, Sweden) and treated with DNAse to remove possible genomic DNA contamination, according to the manufacturer’s instructions and stored at −80°C. Reverse transcription to cDNA was done using iSCRIPT (BioRad, Stockholm, Sweden). Gene transcription of Nuclear factor (erythroid-derived 2)-like 2 (Nrf2; encoded by Nfe2l2 gene) and Kelch-like ECH-associated protein 1 (Keap1) was normalized against transcription of housekeeping genes Phosphoglycerate kinase 1 (Pkg-1) and Glyceraldehyde 3-phosphate dehydrogenase (Gapdh). All primer sequences area shown in Table 1. The efficiency of each primer pair was determined from a standard curve with pooled cDNA. Annealing temperature was 62°C. Gene transcription analyses of the genes of interest were analyzed with the 2−ΔCt method. Each sample was run as a duplicate. To ensure the amplification of a single product, a melt curve for each qPCR reaction was performed (melt curve ranging from 55°C to 95°C).
TABLE 1
| Target name | Accession No. | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|---|
| Gapdh | NM_008084.3 | GGGCTCCCTAGGCCCCTCCTCTTAT | CACCCCAGCAAGGACACTGAGCAAG |
| Pgk-1 | NM_008828.3 | CTCCGCTTTCATGTAGAGGAAG | GACATCTCCTAGTTTGGACAGTG |
| Nrf2 | NM_010902.4 | GCCCACATTCCCAAACAAGAT | CCAGAGAGCTATTGAGGGACTG |
| Keap1 | NM_016679.4 | TGCCCCTGTGGTCAAAGTG | GGTTCGGTTACCGTCCTGC |
Gene-Specific Primer Sequences Used for qPCR.
2.4.2 Hippocampal Levels of GAP-43 and GLUR1 Using Western Blot 24 h After Exposure
A phosphatase and protease inhibitor tablet (A32959, ThermoScintific) was dissolved into 10 ml ice cold 1xPBS solution and it was used with a ratio of 1 ml/100 mg tissue for each sample. Glass beads were then added to the samples with a ratio of 1:1. A bullet blender was then used for sample homogenization. In order to eliminate the cell membranes, −80°C freeze and thaw cycles were executed twice. The homogenate was centrifuged for a duration of 5 min at 5,000 rpm at 4 c and stored at −20°C.
The protein concentration in the samples were then determined with BCA technique. Standard solutions (BSA) and a working reagent (BCA) were prepared. Duplicates of 10 ul/sample and 10 ul/standard solution were added in wells in a microplate. Afterwards, the working reagent was added to each well. The sample incubated at 37°C for 20 min. The absorbance was measured at 562 nm.
Western blot was used to analyze the proteins of interest: GAP43 and GLUR1. The western blot procedure was done two times for each marker, the first time with three different protein concentration for optimization, and then a second time was performed on the most optimal protein concentration. For sample protein separation, the supernatants were used in three different concentration (undiluted, 1:5 diluted and 1:10 diluted) for optimization or the most optimal concentration. A sample buffer was prepared, containing beta-mercaptoethanol (Sigma-Aldrich) and laemmli sample buffer (Bio-Rad). This was mixed with the supernatants with 1:1 ratio and incubated at 97°C for 8 min. The samples were then cooled at room-temperature. These and a prestained protein ladder (ThermoScintific) were loaded on the wells of a Mini-PROTEAN (R) TGX Stain-Free ™ 6–16 gel (456–8,106, Bio-Rad). Then the electrophoresis was running at 120 V for 1 h. For total protein measurment, the gel was removed and imaged using a Gel DocTM imager (Bio-Rad). The proteins in the gel were transferred to a Trans-Blot TurboTM Mini PVDF membrane (1,704,156 BioRad) using a Trans Blot ® TurboTM (BioRad). Then the membrane was incubated on strong agitation at RT for 1 h in a blocking buffer consist of TweenⓇ 20 (Sigma-Aldrich) 1xTBS buffer pH 8 (0.1 M TrizmaⓇbase (Sigma-Aldrich) 1.5 M NaCl (Sigma-Aldrich) and dH2O) and 5% Blotting Grade Blocker nonfat dry milk (BioRad). Primary antibody for the protein of interest was diluted in the blocking buffer and used for membrane overnight incubation at 4°C with gentle agitation. The experiment was continued the next day with membrane rinsing followed by a washing step in 1xTTBS 3 × 10 min with strong agitation. Afterwards a HRP-conjugated secondary antibody was diluted 1:10,000 with the blocking buffer and used for 1 h membrane incubation with gentle agitation at RT. A 1:1 mixture of Luminol/enhancer and peroxidase buffer solution (Immuno star HRP BioRad) was prepared and used for membrane incubation at RT for 3 min without agitation. Membrane imaging was performed using a CCD camera (Chemidoc MP BioRad and image Lab 5.5 system) for chemiluminescence.
2.4.3 Hippocampal Synaptic Density Using Immunohistochemisry in 4-month-Old Mice
In this experiment, the frozen brains were cut in coronal sections (10 μm) using a CryoStar™ NX70 Cryostat (Thermo Scientific™) at −20 ± 1°C, thaw-mounted on SuperFrost® Plus slides (Menzel-Gläser, Germany) and stored at −20°C until examination by an immunohistochemical method.
Sections from the hippocampus region (bregma −1.94) were boiled in 0.01 M citric acid for 5 min. After boiling, the sections were marked by “Pap pen” and then washed 3 × 5 min in phosphate-buffered saline (PBS). The sections were then covered by primary antibodies diluted in Supermix (200 ml TBS, 0.5 g gelatin, 1 ml Triton X-100) and placed in a humidity chamber at 4°C overnight. The optimal concentration for synapotophysin (SYP) primary antibody was identified (1:100) through optimization. The next day the sections were washed 3 × 10 min in PBS and were incubated for 2 hours at room temperature in a humidity chamber in the dark with secondary antibody diluted in Supermix. The secondary antibodies used were anti-mouse diluted in 1:400 Supermix. The sections were then washed 3 × 5 min in PBS and each section was then mounted with 50 μL of ProLong Gold antifade reagent with DAPI and kept in the fridge until microscope analysis. The quality of the sections and autofluorescence was controlled to make sure and identify that it was the antibody that gave the signal.
Images for SYP were taken using a Zeiss AxioImager M2 (Zeiss, Germany) at the BioVis platform, Uppsala University. Fluorescent signals were collected at 488 nM for SYP with an fixed exposure time of 2.62 s. Immunofluorescence intensity per area unit (A.U.) was blindly quantified using ImageJ. For each individual five to six measurements were used to establish a mean value. The mean value for each individual was then considered the statistical unit.
2.5 Statistical Analysis
Normality of residuals and homogeneity of variances were checked using QQ-plots and homoscedasticity-plots, respectively; if needed, data were log-transformed to meet the assumptions of parametric statistics. In the analysis of behavior, a 2-way RM ANOVA was used to investigate if there was 1) an effect of the within-subject factor (i.e., time), 2) an effect of the between-subject factor (i.e., treatment), and 3) if there was interaction-effect between the within-subjects factor and between-subjects factor (i.e., treatment × time) on the dependent variable. In the analysis of MWM data, the total time over the five consecutive trails/day was compared between conditions. Following ANOVAs, Šidák’s multiple comparisons test was used. When two means were compared, a student’s t-test was used. Effect sizes for ANOVAs and t-tests were calculated for using partial eta-squared (ηp2;https://effect-size-calculator.herokuapp.com/#form4) and Cohen’s d (d;https://www.socscistatistics.com/effectsize/default3.aspx), respectively. Graphical illustrations, normality testing and analyses of equal variances were made in GraphPad Prism version 8.0.2 and version 5.01 (GraphPad software Inc., CA, United States).
3 Results
There were no signs of toxic symptoms in any of the mice during the experiments. Body weights were measured on PND 10 and at sacrifice (for both mice euthanized within the first 24 h after exposures and mice raised until adulthood). There were no significant effects of exposures on body weights in either neonates (p > 0.05) nor in mice raised to adulthood (p > 0.05).
3.1 Spontaneous Behavior in a New Home Cage
A significant interaction between treatment and time was shown on the dependent variable distance, F (2, 32) = 3.575, p = 0.04, ηp2 = 0.18 (Figure 1A). Post-hoc analyses using Šidák’s multiple comparisons test revealed a significant difference between control mice and AAP exposed mice during the last 30 min of behavior recordings (p = 0.01) (Figure 1A).
FIGURE 1
3.2 Memory, Learning and Cognitive Flexibility in the Morris Water Maze
A significant interaction between treatment and time was indicated on the latency to find the submerged platform, F (3, 60) = 3.552, p = 0.020, ηp2 = 0.15. Post-hoc analyses using Šidák’s multiple comparisons test revealed a significant difference between control mice and AAP exposed mice on both day 3 (p = 0.037) and 4 (p < 0.0001) (Figure 1B). An independent t-test indicated that mice neonatally exposed to AAP used significantly more time to find the re-located platform compared to control mice on day 5, t (20) = 2.96, p = 0.0078, d = 1.6 (Figure 1C).
3.3 Hippocampal Oxidative Stress
A significant increase in the Nrf2/Keap1 transcriptional ratio was shown 6 h after exposure to AAP (30 + 30 mg/kg, 4 h apart), t (10) = 3, p = 0,0050, d = 0.21, in the hippocampus (Figure 2). No effects were observed on Nrf2/Keap1 transcriptional ratio 2, 12 or 24 h after exposure.
FIGURE 2
3.4 Hippocampal Levels of GAP-43 and GLUR1
No effects were observed on neither GAP-43, t (8) = 1.78, p = 0.11, nor GLUR1, t (9) = 0.97, p = 0.36, levels in the hippocampus using Western blot (Figure 3). However, a large effect size was observed for GAP-43, d = 1.13, and a medium effect size was observed for GLUR1, d = 0.6.
FIGURE 3
3.5 Hippocampal Synaptic Density
Immunohistochemical evaluation did not reveal any differences in synaptophysin levels of the CA3 region, t (6) = 0.24, p = 0.8217, d = 0.17, nor in the dentate gyrus region t (6) = 0.20, p = 0.85, d = 0.14, between AAP exposed animals and controls (Figures 4A,B, respectively).
FIGURE 4
4 Discussion
This study reports of developmentally induced neurotoxic effects following exposure to relevant doses of AAP in mice. Mice neonatally exposed to AAP displayed impaired habituation capability, reduced memory and learning ability, and decreased cognitive flexibility in adulthood. These behavioral effects were observed in the adult mice following a single day exposure. These effects could potentially depend on increased hippocampal oxidative stress, as indicated by the observed increase in Nrf2/Keap1 transcriptional ratio 6 h after exposure.
We administered AAP (30 + 30 mg/kg, 4 h apart) into ten-day-old mice pups. This dose, which is corresponding to a clinically relevant dose in humans (HED: 4.9 mg/kg), has previously been demonstrated to lead to adverse behavioral effects in adulthood (; ; ). The recommended dose of AAP in newborns and toddlers is 7.5–15 mg kg−1 up to four times a day (). Ten-day-old mice, in terms of key developmental processes, are comparable to the time around birth in humans (; ).
The spontaneous behavior test, when mice are introduced to a new home cage, explores the animal’s ability to habituate to a new environment. The mice have to integrate a sensory input into motor output, but as the stimulus (e.g., the new environment) becomes more familiar, the response (explorative activity; here as distance travelled) gradually decreases. Control animals reached base-line activity following 90 min in the new home cage. Mice that neonatally were exposed to AAP displayed an increased activity during the last 30 min of recording compared to these controls. Habituation is considered a non-associative form of learning, hence is considered a cognitive function (; ; ). Previous findings following developmental exposure to AAP in rodents have also indicated both a hypo-responsiveness to a new environment and effects on memory and learning (; ; ). In line with this observation, it has been shown that ASD patients display hypo-responsiveness to novel stimuli (; ). The timing of AAP exposure during the BGS also seems to be of essence for the neurotoxicity in mice. In a study from 2017 (), AAP exposure during neurodevelopmental time points corresponding to late pregnancy/early life and the beginning of the third trimester in humans altered adult habituation and spontaneous behavior in mice. On the other hand, in the same study exposure during a time point corresponding to a two-year-old child did not affect adult behaviors in mice. It has already been pointed out that AAP exposure late in pregnancy seem to be closely related to adverse outcomes later in life in humans ().
To further investigate effects on memory, learning and cognition, the MWM was used. During the 4-day acquisition period, control animals reduced the time needed to locate the submerged platform. This test showed that mice exposed to AAP on PND 10 displayed a significant increase in latency to reach the platform compared to control animals during day 3 and 4 of the acquisition phase. As this indicates an impact on memory and learning, it also confirms previous findings that have shown that AAP exposure during brain development affects cognition (; ; ). To assess cognitive flexibility in AAP-treated mice, a cognitive process that to our knowledge has not yet been explored in experimental animals following AAP administration, the platform in the MWM was re-located to a new quadrant. The latency to find the new position was measured over five trials (on day 5). Mice that neonatally received AAP displayed an increased latency to find the re-located platform compared to controls, thus indicating decreased ability re-learn a new task previously learned. It therefore seem that neonatal exposure to AAP affects both learning in a constant environment and adapting flexibly to a changing one.
As there are several suggestions to possible mechanisms of action in the developmental effects observed following exposure to AAP (), more studies to investigate each and one of these suggestions are needed. Furthermore, there is no reason to see all of these hypothetical developmental neurotoxic mechanisms as very independent mechanisms, as many of these may depend on one another. AAP interacts with the endocannabinoid system through one of its active metabolites (). It has been shown that AAPs interaction with the CB1R is essential in its analgesic properties (). There is also a known interaction between endocannabinoid system and the neurotrophic factor BDNF and its receptor TRKB (; ). As our research group have observed altered transcript levels of Trkb following PND 10 exposure to both AAP () and THC (), together with the facts that both these drugs/pharmaceuticals interact with the endocannabinoid system, we emphasize the need to thorough investigate the endocannabinoid-mediated effects of AAP on brain development. This endocannabinoid system is known to be involved during brain development and expressed in most part of the brain (; ; ; ). Interestingly, concomitant activation of the endocannabinoid system has been shown to increase sensitivity to AAP during brain development in mice (). On a neuronal level, the endocannabinoid receptors are expressed, and act in a modulatory fashion, in most signaling system: serotonergic, dopaminergic, cholinergic (; ; ; ; ; ). The endocannabinoid system have been shown to be involved in the development of ASD (; ; ). There is also an association between a polymorphism in the endocannabinoid-degrading enzyme FAAH with ADHD (). By affecting the endocannabinoid system there is a risk that other transmitter systems also may be affected and be one possible reason for the variety of observed effect on neurodevelopment already observed following AAP (; ; ; ). In line with our proposed hypothesis of a CB1R/BDNF/TRKB mediated developmental neurotoxicity, BNDF have been associated with ADHD in humans (). Effects on BDNF have also been found after developmental exposure to AAP in rodents (; ). In humans, dysregulation of BDNF has been found to be involved in ASD and ADHD (; ). Furthermore, single-nucleotide variants of BDNF have been found to be associated with increased risk of ADHD (; ). AAP also affects the cyclooxygenase (COX) system. However, an interaction as such seem less likely in developmental neurotoxicity observed following PND 10 exposure to AAP since PND 10 exposure to ibuprofen (with a known interaction with the COX system) did not alter adult spontaneous behavior and habituation capabilities ().
The antioxidant response element (ARE) are involved in trascription of numerous genes involved in detoxification and cytoprotection (). The trascription factor NRF2 drives the ARE-mediated trascription of cytoprotective elements (). Under homeostasis, cytocolic NRF2 is inactivaded by forming a complex with KEAP1 (); however, during oxidative stess the aforementioned complex is disrupted and NRF2 is translocated into the nucleus to bind ARE, in turn leading to expression of serveral cytoprotective proteins. An increase in cytoprotective elements, as indicated by an increase in the Nrf2/Keap1 trascriptional ratio, was showed following PND 10 AAP exposure in the hippocampus 6 h after exposure. This suggests that relevant doses of AAP is causing oxidative damage to the developing mouse brain, which, in part, could be one of the underlying reasons for the behavioral manifestations observed herein. Interetingly, an increase of these cytoprotective elements has already been observed following PND 10 exposure to THC (50 mg/kg) 24 h after exposure (). In line with these observations, high doses of AAP has been shown to increase ROS formation leading to mitochondrial dysfunction (). High doses of AAP seem to induce transcript levels of oxidative stress response genes in mice brains (). Oxidative stress and inflammatory responses have been implicated in the etiology of ADHD and ASD, as indicated by differential expression of pro-inflammatory cytokines (; ). Interestingly, therapeutic doses of AAP seemed to activate oxidative stress-related gene responses, similar to those observed following higher doses, in humans ().
Synaptic organisation is crusial during brain development. For example, GAP-43 is vital for axonal growth and is constantly used as a biomarker for axonal outgrowth. The expression of GAP-43 is reaching a peak during brain development, indicating its fundamental role during brain development (). Thus, effects on axonal outgrowth during brain development may result in different synapse density later in life. For this reason, the neonatal mice were examined for GAP-43 24 h after AAP exposure and adult animals were examined for the presynaptic marker SYP in both CA3 and dentate gyrus. We show here that neither neonatal levels of GAP-43 nor SYP levels in the adult animal have been affected after early AAP exposure. An investigation of hippocampal GLUR1 was also conducted 24 h after exposure. GLUR1 is known as the most expressed subunit of alfa-amino-3-hydroxy-5-methyl-4 isoxazolepropionic acid (AMPA) receptor (). AMPA receptor is essential for synaptic plasticity (). Since synaptic plasticity of excitatory synapse is considered to be crucial for the brain, in particular, for memory and learning processes, possible effects on GLUR1 followin neonatal AAP exposure could give insights into AAPs effect on memory and learning. However, no effect on GLUR1 protein levels was observed herein.
As previously mentioned, other experimental studies that investigated the effect of AAP on rodent brain development have shown the effect on many neurotransmitter systems (; ; ; ). However, the clinical relevance has been questioned as the exposure occurred continuously for several weeks and therefore would not be clinically representative to human exposures (); the brain development of rats and mice is more compressed compared to humans, thus weeks of exposure in rodents will correspond to unrealistic exposures in humans. Our exposure model therefore provides toxicological data relevant to humans and that are highly warranted, as AAP remain the first line treatment for pain and fever during pregnancy and early life.
The long term neurodevelopmental effects of AAP have been studied in an increasing amount of epidemiological studies, where AAP exposure during pregnancy have shown associations with ADHD, ASD, lower IQ and language delay (). These associations have been found in different populations: the Norwegian Mother and Child Cohort Study (MoBA) (; ), the Danish National Birth Cohort (DNBC) (; ; ; ), the Auckland Birthweight Collaborative Cohort (), the Spanish Infancia y Medio Ambiente (INMA project) (), the Avon Longitudinal Study of Parents and Children (ALSPAC) () and the Swedish Environmental Longitudinal, Mother and child, Asthma and allergy (SELMA) (). The fact that these associations have emerged from a whole range of different populations strengthens the connection between AAP exposure and its negative effects on brain development. There is however a need to confirm these associations with mechanistic data. In the consensus statement by Bauer and colleagues (), authorities such as the EMA and the FDA are urged to review all available literature, both epidemiological and non-clinical. The results presented in this article can contribute to a further understanding of AAP’s developmental neurotoxic potential and will hopefully be able to be part of making a more accurate risk/benefit assessment of its usage during pregnancy. In summary, this study have shown that clinically relevant doses of AAP affect adult memory, learning and cognitive flexibility in mice, possibly by inducing oxidative damege in the hippocampus. These results are important as AAP is the only recomennded painkiller during pregnancy and that the adverse effects were induced following only a single day exposure, thereby may be representative to a human exposure setting. We also suggest that AAP, despite the relatively low doses, appears to induce oxidative stress in the hippocampus. However, furhter insight in the mechansim resposible for these effects are highly warranted.
Statements
Data availability statement
The raw data supporting the conclusion of this article will be made available by the authors, without undue reservation.
Ethics statement
The animal study was reviewed and approved by the Experiments were conducted in accordance with the Directive of European Parliament and of the Council of 22 September 2010 (2010/63/EU), after approval from the local ethical committee (Uppsala University and Agricultural Research Council).
Author contributions
GP, conceptualization and design of the work; acquisition, analysis, interpretation of data; writing the original draft; editing of intellectual content. KH, interpretation of data, work on Western blot and immunohistochemistry. YM, work on qPCR and interpretation of these data, AY, work on immunohistochemistry and interpretation of these data. MH, work on Western blot and interpretation of these data. SB, study design; work on animal behavior and interpretation of these data. RF, editing of intellectual content; resources and funding acquisition.
Funding
This work was supported and funded by the Department of Environmental Toxicology and the Department of Molecular Neuropharmacology, both at Uppsala University, Sweden.
Acknowledgments
We would like to thank Per Eriksson and Henrik Viberg for their important work on different periods of increased vulnerability during brain development and all the important discussions that led to this study. Without their work and without these discussions, this study would not have been done.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/ftox.2022.867748/full#supplementary-material
References
1
AhmadalipourA.Mehdizadeh FanidL.ZeinalzadehN.AlizadehM.VaeziH.Hassanpour AydinlouZ.et al (2020). The First Evidence of an Association between a Polymorphism in the Endocannabinoid-Degrading Enzyme FAAH (FAAH Rs2295633) with Attention Deficit Hyperactivity Disorder. Genomics112 (2), 1330–1334. 10.1016/j.ygeno.2019.07.024
2
AndersonB. J.AllegaertK. (2009). Intravenous Neonatal Paracetamol Dosing: the Magic of 10 Days. Paediatric Anaesth.19 (4), 289–295. 10.1111/j.1460-9592.2008.02680.x
3
Avella-GarciaC. B.JulvezJ.FortunyJ.RebordosaC.García-EstebanR.GalánI. R.et al (2016). Acetaminophen Use in Pregnancy and Neurodevelopment: Attention Function and Autism Spectrum Symptoms. Int. J. Epidemiol.45 (6), dyw115–1996. 10.1093/ije/dyw115
4
AzadS. C.KurzJ.MarsicanoG.LutzB.ZieglgänsbergerW.RammesG. (2008). Activation of CB1 Specifically Located on GABAergic Interneurons Inhibits LTD in the Lateral Amygdala. Learn. Mem.15 (3), 143–152. 10.1101/lm.741908
5
BauerA. Z.KriebelD.HerbertM. R.BornehagC.-G.SwanS. H. (2018). Prenatal Paracetamol Exposure and Child Neurodevelopment: A Review. Horm. Behav.101, 125–147. 10.1016/j.yhbeh.2018.01.003
6
BauerA. Z.SwanS. H.KriebelD.LiewZ.TaylorH. S.BornehagC.-G.et al (2021). Paracetamol use during Pregnancy - a Call for Precautionary Action. Nat. Rev. Endocrinol.17 (12), 757–766. 10.1038/s41574-021-00553-7
7
BerghuisP.DobszayM. B.WangX.SpanoS.LeddaF.SousaK. M.et al (2005). Endocannabinoids Regulate Interneuron Migration and Morphogenesis by Transactivating the TrkB Receptor. Proc. Natl. Acad. Sci. U.S.A.102 (52), 19115–19120. 10.1073/pnas.0509494102
8
BerghuisP.RajnicekA. M.MorozovY. M.RossR. A.MulderJ.UrbánG. M.et al (2007). Hardwiring the Brain: Endocannabinoids Shape Neuronal Connectivity. Science316 (5828), 1212–1216. 10.1126/science.1137406
9
BertoliniA.FerrariA.OttaniA.GuerzoniS.TacchiR.LeoneS. (2006). Paracetamol: New Vistas of an Old Drug. CNS Drug Rev.12 (3-4), 250–275. 10.1111/j.1527-3458.2006.00250.x
10
Blecharz-KlinK.Joniec-MaciejakI.JawnaK.PyrzanowskaJ.PiechalA.WawerA.et al (2015a). Developmental Exposure to Paracetamol Causes Biochemical Alterations in Medulla Oblongata. Environ. Toxicol. Pharmacol.40 (2), 369–374. 10.1016/j.etap.2015.07.001
11
Blecharz‐KlinK.Joniec‐MaciejakI.JawnaK.PyrzanowskaJ.PiechalA.WawerA.et al (2015b). Effect of Prenatal and Early Life Paracetamol Exposure on the Level of Neurotransmitters in Rats-Focus on the Spinal Cord. Int. J. Dev. Neurosci.47, 133–139. 10.1016/j.ijdevneu.2015.09.002
12
Blecharz-KlinK.PiechalA.Jawna-ZboińskaK.PyrzanowskaJ.WawerA.Joniec-MaciejakI.et al (2017). Paracetamol − Effect of Early Exposure on Neurotransmission, Spatial Memory and Motor Performance in Rats. Behav. Brain Res.323, 162–171. 10.1016/j.bbr.2017.01.051
13
Blecharz-KlinK.WawerA.Jawna-ZboińskaK.PyrzanowskaJ.PiechalA.Mirowska-GuzelD.et al (2018). Early Paracetamol Exposure Decreases Brain-Derived Neurotrophic Factor (BDNF) in Striatum and Affects Social Behaviour and Exploration in Rats. Pharmacol. Biochem. Behav.168, 25–32. 10.1016/j.pbb.2018.03.004
14
BornehagC.-G.ReichenbergA.HallerbackM. U.WikstromS.KochH. M.JonssonB. A.et al (2018). Prenatal Exposure to Acetaminophen and Children's Language Development at 30 Months. Eur. Psychiatr.51, 98–103. 10.1016/j.eurpsy.2017.10.007
15
BrandlistuenR. E.YstromE.NulmanI.KorenG.NordengH. (2013). Prenatal Paracetamol Exposure and Child Neurodevelopment: a Sibling-Controlled Cohort Study. Int. J. Epidemiol.42 (6), 1702–1713. 10.1093/ije/dyt183
16
BrigidaA.SchultzS.CasconeM.AntonucciN.SiniscalcoD. (2017). Endocannabinod Signal Dysregulation in Autism Spectrum Disorders: A Correlation Link between Inflammatory State and Neuro-Immune Alterations. Int. J. Mol. Sci.18 (7), 1425. 10.3390/ijms18071425
17
BrynV.HalvorsenB.UelandT.IsaksenJ.KolkovaK.RavnK.et al (2015). Brain Derived Neurotrophic Factor (BDNF) and Autism Spectrum Disorders (ASD) in Childhood. Eur. J. Paediatric Neurol.19 (4), 411–414. 10.1016/j.ejpn.2015.03.005
18
BurdanF.StarosławskaE.SzumiłoJ. (2012). Prenatal Tolerability of Acetaminophen and Other Over-the-counter Non-selective Cyclooxygenase Inhibitors. Pharmacol. Rep.64 (3), 521–527. 10.1016/s1734-1140(12)70847-2
19
D’SouzaD. C.PittmanB.PerryE.SimenA. (2009). Preliminary Evidence of Cannabinoid Effects on Brain-Derived Neurotrophic Factor (BDNF) Levels in Humans. Psychopharmacology202 (4), 569–578. 10.1007/s00213-008-1333-2
20
da SilvaM. H.da RosaE. J. F.de CarvalhoN. R.DobrachinskiF.da RochaJ. B. T.MaurizJ. L.et al (2012). Acute Brain Damage Induced by Acetaminophen in Mice: Effect of Diphenyl Diselenide on Oxidative Stress and Mitochondrial Dysfunction. Neurotox Res.21 (3), 334–344. 10.1007/s12640-011-9288-1
21
DaenenE. W.Van der HeydenJ. A.KruseC. G.WolterinkG.Van ReeJ. M. (2001). Adaptation and Habituation to an Open Field and Responses to Various Stressful Events in Animals with Neonatal Lesions in the Amygdala or Ventral hippocampus. Brain Res.918 (1–2), 153–165. 10.1016/S0006-8993(01)02987-0
22
DarkC.Homman-LudiyeJ.Bryson-RichardsonR. J. (2018). The Role of ADHD Associated Genes in Neurodevelopment. Develop. Biol.438 (2), 69–83. 10.1016/j.ydbio.2018.03.023
23
DobbingJ.SandsJ. (1979). Comparative Aspects of the Brain Growth Spurt. Early Hum. Develop.3 (1), 79–83. 10.1016/0378-3782(79)90022-7
24
ErikssonP.BuratovicS.FredrikssonA.StenerlöwB.Sundell-BergmanS. (2016). Neonatal Exposure to Whole Body Ionizing Radiation Induces Adult Neurobehavioural Defects: Critical Period, Dose-Response Effects and Strain and Sex Comparison. Behav. Brain Res.304, 11–19. 10.1016/j.bbr.2016.02.008
25
Fernández-RuizJ.GómezM.HernándezM.MiguelR. d.RamosJ. A. (2004). Cannabinoids and Gene Expression during Brain Development. Neurotox Res.6 (5), 389–401. 10.1007/bf03033314
26
FöldyC.MalenkaR. C.SüdhofT. C. (2013). Autism-Associated Neuroligin-3 Mutations Commonly Disrupt Tonic Endocannabinoid Signaling. Neuron78 (3), 498–509. 10.1016/j.neuron.2013.02.036
27
FredrikssonA. (1994). MPTP-induced Behavioural Deficits in Mice: Validity and Utility of a Model of Parkinsonism. Uppsala, Sweden: Uppsala University.
28
GhanemC. I.RudraiahS.BatailleA. M.VigoM. B.GoedkenM. J.ManautouJ. E. (2015). Role of Nuclear Factor-Erythroid 2-related Factor 2 (Nrf2) in the Transcriptional Regulation of Brain ABC Transporters during Acute Acetaminophen (APAP) Intoxication in Mice. Biochem. Pharmacol.94 (3), 203–211. 10.1016/j.bcp.2015.01.013
29
GoinesP. E.CroenL. A.BraunschweigD.YoshidaC. K.GretherJ.HansenR.et al (2011). Increased Midgestational IFN-γ, IL-4 and IL-5 in Women Bearing a Child with Autism: A Case-Control Study. Mol. Autism2 (1), 13. 10.1186/2040-2392-2-13
30
GrovesP. M.ThompsonR. F. (1970). Habituation: a Dual-Process Theory. Psychol. Rev.77 (5), 419–450. 10.1037/h0029810
31
HäringM.MarsicanoG.LutzB.MonoryK. (2007). Identification of the Cannabinoid Receptor Type 1 in Serotonergic Cells of Raphe Nuclei in Mice. Neuroscience146 (3), 1212–1219. 10.1016/j.neuroscience.2007.02.021
32
HarkanyT.GuzmánM.Galve-RoperhI.BerghuisP.DeviL. A.MackieK. (2007). The Emerging Functions of Endocannabinoid Signaling during CNS Development. Trends Pharmacol. Sci.28 (2), 83–92. 10.1016/j.tips.2006.12.004
33
HawiZ.CumminsT. D. R.TongJ.Arcos-BurgosM.ZhaoQ.MatthewsN.et al (2016). Rare DNA Variants in the Brain-Derived Neurotrophic Factor Gene Increase Risk for Attention-Deficit Hyperactivity Disorder: a Next-Generation Sequencing Study. Mol. Psychiatry22, 580–584. 10.1038/mp.2016.117
34
HermannH.MarsicanoG.LutzB. (2002). Coexpression of the Cannabinoid Receptor Type 1 with Dopamine and Serotonin Receptors in Distinct Neuronal Subpopulations of the Adult Mouse Forebrain. Neuroscience109 (3), 451–460. 10.1016/s0306-4522(01)00509-7
35
HögestättE. D.JönssonB. A. G.ErmundA.AnderssonD. A.BjörkH.AlexanderJ. P.et al (2005). Conversion of Acetaminophen to the Bioactive N-Acylphenolamine AM404 via Fatty Acid Amide Hydrolase-dependent Arachidonic Acid Conjugation in the Nervous System. J. Biol. Chem.280 (36), 31405–31412. 10.1074/jbc.M501489200
36
ItohK.ChibaT.TakahashiS.IshiiT.IgarashiK.KatohY.et al (1997). An Nrf2/Small Maf Heterodimer Mediates the Induction of Phase II Detoxifying Enzyme Genes through Antioxidant Response Elements. Biochem. Biophysical Res. Commun.236 (2), 313–322. 10.1006/bbrc.1997.6943
37
ItohK.WakabayashiN.KatohY.IshiiT.O'ConnorT.YamamotoM. (2003). Keap1 Regulates Both Cytoplasmic-Nuclear Shuttling and Degradation of Nrf2 in Response to Electrophiles. Genes Cells8 (4), 379–391. 10.1046/j.1365-2443.2003.00640.x
38
JettenM. J. A.GajS.Ruiz-AracamaA.de KokT. M.van DelftJ. H. M.LommenA.et al (2012). 'Omics Analysis of Low Dose Acetaminophen Intake Demonstrates Novel Response Pathways in Humans. Toxicol. Appl. Pharmacol.259 (3), 320–328. 10.1016/j.taap.2012.01.009
39
JonesK. L.CroenL. A.YoshidaC. K.HeuerL.HansenR.ZerboO.et al (2017). Autism with Intellectual Disability Is Associated with Increased Levels of Maternal Cytokines and Chemokines during Gestation. Mol. Psychiatry22 (2), 273–279. 10.1038/mp.2016.77
40
KanoM.Ohno-ShosakuT.HashimotodaniY.UchigashimaM.WatanabeM. (2009). Endocannabinoid-mediated Control of Synaptic Transmission. Physiol. Rev.89 (1), 309–380. 10.1152/physrev.00019.2008
41
KenslerT. W.WakabayashiN.BiswalS. (2007). Cell Survival Responses to Environmental Stresses via the Keap1-Nrf2-ARE Pathway. Annu. Rev. Pharmacol. Toxicol.47 (1), 89–116. 10.1146/annurev.pharmtox.46.120604.141046
42
KentL.GreenE.HawiZ.KirleyA.DudbridgeF.LoweN.et al (2005). Association of the Paternally Transmitted Copy of Common Valine Allele of the Val66Met Polymorphism of the Brain-Derived Neurotrophic Factor (BDNF) Gene with Susceptibility to ADHD. Mol. Psychiatry10 (10), 939–943. 10.1038/sj.mp.4001696
43
LeeH.-K.KameyamaK.HuganirR. L.BearM. F. (1998). NMDA Induces Long-Term Synaptic Depression and Dephosphorylation of the GluR1 Subunit of AMPA Receptors in hippocampus. Neuron21 (5), 1151–1162. 10.1016/s0896-6273(00)80632-7
44
LiewZ.RitzB.RebordosaC.LeeP.-C.OlsenJ. (2014). Acetaminophen Use during Pregnancy, Behavioral Problems, and Hyperkinetic Disorders. JAMA Pediatr.168 (4), 313–320. 10.1001/jamapediatrics.2013.4914
45
LiewZ.BachC. C.AsarnowR. F.RitzB.OlsenJ. (2016a). Paracetamol Use during Pregnancy and Attention and Executive Function in Offspring at Age 5 Years. Int. J. Epidemiol.45 (6), dyw296–2017. 10.1093/ije/dyw296
46
LiewZ.RitzB.VirkJ.ArahO. A.OlsenJ. (2016b). Prenatal Use of Acetaminophen and Child IQ. Epidemiology27 (6), 912–918. 10.1097/ede.0000000000000540
47
LiewZ.RitzB.VirkJ.OlsenJ. (2016c). Maternal Use of Acetaminophen during Pregnancy and Risk of Autism Spectrum Disorders in Childhood: A Danish National Birth Cohort Study. Autism Res.9 (9), 951–958. 10.1002/aur.1591
48
LiuD.-Y.ShenX.-M.YuanF.-F.GuoO.-Y.ZhongY.ChenJ.-G.et al (2015). The Physiology of BDNF and its Relationship with ADHD. Mol. Neurobiol.52 (3), 1467–1476. 10.1007/s12035-014-8956-6
49
LupattelliA.SpigsetO.TwiggM. J.ZagorodnikovaK.MårdbyA. C.MorettiM. E.et al (2014). Medication Use in Pregnancy: a Cross-Sectional, Multinational Web-Based Study. BMJ Open4 (2), e004365. 10.1136/bmjopen-2013-004365
50
MianP.AllegaertK. (2017). Fetal and Neonatal Rats Paracetamol Dosage and the Perinatal Human Setting: Lost in Translation?Pharmacol. Rep.69 (2), 371–372. 10.1016/j.pharep.2016.10.017
51
MorozovY. M.ToriiM.RakicP. (2009). Origin, Early Commitment, Migratory Routes, and Destination of Cannabinoid Type 1 Receptor-Containing Interneurons. Cereb. Cortex19 (1), i78–89. 10.1093/cercor/bhp028
52
MorrisR. G. M.GarrudP.RawlinsJ. N. P.O'KeefeJ. (1982). Place Navigation Impaired in Rats with Hippocampal Lesions. Nature297, 681–683. 10.1038/297681a0
53
MulderJ.AguadoT.KeimpemaE.BarabásK.Ballester RosadoC. J.NguyenL.et al (2008). Endocannabinoid Signaling Controls Pyramidal Cell Specification and Long-Range Axon Patterning. Proc. Natl. Acad. Sci. U.S.A.105 (25), 8760–8765. 10.1073/pnas.0803545105
54
OestreicherA. B.De GraanP. N. E.GispenW. H.VerhaagenJ.SchramaL. H. (1997). B-50, The Growth Associated Protein-43: Modulation of Cell Morphology and Communication in the Nervous System. Progress in Neurobiology53 (6), 627–686. 10.1016/S0301-0082(97)00043-9
55
OropezaV. C.MackieK.Van BockstaeleE. J. (2007). Cannabinoid Receptors Are Localized to Noradrenergic Axon Terminals in the Rat Frontal Cortex. Brain Res.1127 (1), 36–44. 10.1016/j.brainres.2006.09.110
56
OttaniA.LeoneS.SandriniM.FerrariA.BertoliniA. (2006). The Analgesic Activity of Paracetamol Is Prevented by the Blockade of Cannabinoid CB1 Receptors. Eur. J. Pharmacol.531 (1-3), 280–281. 10.1016/j.ejphar.2005.12.015
57
PhilippotG.NybergF.GordhT.FredrikssonA.VibergH. (2016). Short-term Exposure and Long-Term Consequences of Neonatal Exposure to Δ9-tetrahydrocannabinol (THC) and Ibuprofen in Mice. Behav. Brain Res.307, 137–144. 10.1016/j.bbr.2016.04.001
58
PhilippotG.GordhT.FredrikssonA.VibergH. (2017). Adult Neurobehavioral Alterations in Male and Female Mice Following Developmental Exposure to Paracetamol (Acetaminophen): Characterization of a Critical Period. J. Appl. Toxicol.37 (10), 1174–1181. 10.1002/jat.3473
59
PhilippotG.HallgrenS.GordhT.FredrikssonA.FredrikssonR.VibergH. (2018). A Cannabinoid Receptor Type 1 (CB1R) Agonist Enhances the Developmental Neurotoxicity of Acetaminophen (Paracetamol). Toxicol. Sci.166 (1), 203–212. 10.1093/toxsci/kfy199
60
PhilippotG.ForsbergE.TahanC.VibergH.FredrikssonR. (2019). A Single δ9-Tetrahydrocannabinol (THC) Dose during Brain Development Affects Markers of Neurotrophy, Oxidative Stress, and Apoptosis. Front. Pharmacol.10, 1156. 10.3389/fphar.2019.01156
61
Reagan‐ShawS.NihalM.AhmadN. (2008). Dose Translation from Animal to Human Studies Revisited. FASEB J.22 (3), 659–661. 10.1096/fj.07-9574LSF
62
SempleB. D.BlomgrenK.GimlinK.FerrieroD. M.Noble-HaeussleinL. J. (2013). Brain Development in Rodents and Humans: Identifying Benchmarks of Maturation and Vulnerability to Injury across Species. Prog. Neurobiol.106-107, 1–16. 10.1016/j.pneurobio.2013.04.001
63
StergiakouliE.ThaparA.Davey SmithG. (2016). Association of Acetaminophen Use during Pregnancy with Behavioral Problems in Childhood. JAMA Pediatr.170 (10), 964–970. 10.1001/jamapediatrics.2016.1775
64
ThompsonJ. M.WaldieK. E.WallC. R.MurphyR.MitchellE. A. (2014). Associations between Acetaminophen Use during Pregnancy and ADHD Symptoms Measured at Ages 7 and 11 Years. PLoS One9 (9), e108210. 10.1371/journal.pone.0108210
65
van EngelandH.RoelofsJ. W.VerbatenM. N.SlangenJ. L. (1991). Abnormal Electrodermal Reactivity to Novel Visual Stimuli in Autistic Children. Psychiatry Res.38 (1), 27–38. 10.1016/0165-1781(91)90050-y
66
VibergH.FredrikssonA.ErikssonP. (2003). Neonatal Exposure to Polybrominated Diphenyl Ether (PBDE 153) Disrupts Spontaneous Behaviour, Impairs Learning and Memory, and Decreases Hippocampal Cholinergic Receptors in Adult Mice. Toxicol. Appl. Pharmacol.192 (2), 95–106. 10.1016/S0041-008X(03)00217-5
67
VibergH.ErikssonP.GordhT.FredrikssonA. (2014). Paracetamol (Acetaminophen) Administration during Neonatal Brain Development Affects Cognitive Function and Alters its Analgesic and Anxiolytic Response in Adult Male Mice. Toxicol. Sci.138 (1), 139–147. 10.1093/toxsci/kft329
68
VlenterieR.WoodM. E.BrandlistuenR. E.RoeleveldN.van GelderM. M. H. J.NordengH. (2016). Neurodevelopmental Problems at 18 Months Among Children Exposed to Paracetamolin Utero: a Propensity Score Matched Cohort Study. Int. J. Epidemiol.45 (6), dyw192–2008. 10.1093/ije/dyw192
69
WebbS. J.JonesE. J. H.MerkleK.NamkungJ.TothK.GreensonJ.et al (2010). Toddlers with Elevated Autism Symptoms Show Slowed Habituation to Faces. Child. Neuropsychol.16 (3), 255–278. 10.1080/09297041003601454
70
WentholdR.PetraliaR.BlahosJ.NiedzielskiA. (1996). Evidence for Multiple AMPA Receptor Complexes in Hippocampal CA1/CA2 Neurons. J. Neurosci.16 (6), 1982–1989. 10.1523/jneurosci.16-06-01982.1996
71
WrightJ. W.MurphyE. S.ElijahI. E.HoltfreterK. L.DavisC. J.OlsonM. L.et al (2004). Influence of Hippocampectomy on Habituation, Exploratory Behavior, and Spatial Memory in Rats. Brain Res.1023 (1), 1–14. 10.1016/j.brainres.2004.06.083
72
ZamberlettiE.GabaglioM.ParolaroD. (2017). The Endocannabinoid System and Autism Spectrum Disorders: Insights from Animal Models. Int. J. Mol. Sci.18 (9), 1916. 10.3390/ijms18091916
Summary
Keywords
analgeic, paracetamol, developmental toxicity, neurotoxcity, mice
Citation
Philippot G, Hosseini K, Yakub A, Mhajar Y, Hamid M, Buratovic S and Fredriksson R (2022) Paracetamol (Acetaminophen) and its Effect on the Developing Mouse Brain. Front.Toxicology. 4:867748. doi: 10.3389/ftox.2022.867748
Received
01 February 2022
Accepted
02 March 2022
Published
22 March 2022
Volume
4 - 2022
Edited by
Steven Jan Van Cruchten, University of Antwerp, Belgium
Reviewed by
Didima M. G. De Groot, Netherlands Organisation for Applied Scientific Research TNO, Netherlands
David Møbjerg Kristensen, Copenhagen University Hospital, Denmark
Updates
Copyright
© 2022 Philippot, Hosseini, Yakub, Mhajar, Hamid, Buratovic and Fredriksson.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Gaëtan Philippot, gaetan.philippot3@gmail.com
This article was submitted to Developmental and Reproductive Toxicology, a section of the journal Frontiers in Toxicology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.