ORIGINAL RESEARCH article

Front. Sustain. Food Syst., 24 September 2025

Sec. Crop Biology and Sustainability

Volume 9 - 2025 | https://doi.org/10.3389/fsufs.2025.1663405

Evaluation of potent Trichoderma strains against anthracnose-twister disease and enhancement of crop health and bulb yield in kharif onion

  • ICAR-Directorate of Onion and Garlic Research, Pune, Maharashtra, India

Abstract

In India, the productivity of onions during the kharif season (June-October) is quite low compared to the Rabi season (December-April). The yield losses in kharif onion are primarily attributed to the increased incidence of anthracnose-twister disease, which is often exacerbated by concurrent monsoon rains and high relative humidity during the kharif. To address this issue, a field study was conducted over three consecutive years (2021–2023) to assess the performance of eleven different Trichoderma strains in managing anthracnose-twister disease and improving plant growth and bulb yield in kharif onion. The strains were initially selected based on their ability to inhibit the growth of the anthracnose pathogen Colletotrichum gloeosporioides (in vitro confrontation assay) and HCN production; amylase, and protease production. The selected strains were also screened in vitro for PGPA traits (IAA and siderophore production; ability to grow in N2 free media, , Zn, and K solubilization). The antagonistic activity of Trichoderma strains against C. gloeosporioides ranged from 18.8% to 70.0% with T. longibrachiatum (OGRDT2) recording the highest inhibition (70%). Application of GRDT2 and OGRDT2 reduced the PDI to 36.00 ± 0.98 and 37.06 ± 1.38, respectively, compared to 62.77 ± 0.14 in the untreated control. The T. longibrachiatum (OGRDT2) and T. harzianum (GRDT2) treated plots registered an increased plant height (54.97 ± 0.80 and 53.29 ± 0.79 cm) and pseudostem diameter (13.96 ± 0.18 and 13.76 ± 0.20mm) compared to the control (42.68 ± 1.90 and 10.55 ± 0.04 mm), respectively, under field conditions. Additionally, these treatments supported higher biomass, as reflected in the increased normalized dry weights of the shoot (10.82 ± 0.89% and 10.39 ± 1.76 %), root (12.27 ± 0.11 % and 11.86 ± 2.67 %), and bulb (12.90 ± 0.65 % and 12.21 ± 0.81 %). The chlorophyll contents were again higher (4.1 ± 1.44 and 4.1 ± 0.83 mg/ml) in OGRDT2 and GRDT2 treated plants than 3.3 ± 0.80 mg/ml in the untreated control. The GRDT2 and OGRDT2 treated plots supported higher bulb yield of 20.66 ± 1.42 t/ha and 19.21 ± 0.87 t/ha compared to control (16.52 ± 0.69 t/ha). Our study demonstrated that T. harzianum (GRDT2) and T. longibrachiatum (OGRDT2) effectively reduced anthracnose severity and therefore can be explored for management of Anthracnose-twister disease of onion.

1 Introduction

Onion (Allium cepa) holds a central place in Indian agriculture, as it is a staple and indispensable ingredient in almost all Indian cuisines, enhancing taste and flavor while offering several health benefits (Kalyani et al., 2014; Benke et al., 2022). India has emerged as the leading onion-producing country, with an overall production of 31.7 Mt in 2022 and 30.2 Mt in 2023, surpassing China, which produced 24.5 and 24.9 Mt in the respective years (FAO, 2025). Despite surplus production, onion remains a critical area of focus for the Government due to their significant impact on rural economic growth and livelihoods (Kale et al., 2024). In India, onion is cultivated across three cropping seasons: kharif (crop sown with monsoon rains and harvested as they end during June- October), late kharif (post monsoon crop taken during September–December), and rabi (crop sown in winter and harvested before summer during December-April) (Sharma and Chauhan, 2024). Kharif onion is crucial in maintaining a steady supply and providing fresh produce when rabi onion stocks decline (Srinivas and Lawande, 2007; Gopal, 2015). However, kharif onion production is affected by several factors, including climatic conditions, soil health, and biotic stresses. Among the biotic stresses, several diseases caused by viruses, bacteria, fungi, and insect infestation can significantly reduce productivity (Paibomesai et al., 2012). During the kharif season, anthracnose-twister is the most devastating disease, causing estimated yield losses up to 80–100% (Chawda and Rajasab, 1996; Alberto and Aquino, 2010; Salunkhe et al., 2022; Dutta et al., 2024a).

The development of Anthracnose-twister disease of onion crop can be attributed either to a single fungal pathogen or to a complex of closely related fungal species acting synergistically, which include complex interplay of fungal pathogens such as Colletotrichum gloeosporioides, Glomerella cingulata, and Fusarium acutatum, Gibberella moniliformis (Guarro et al., 1998; Schwartz and Mohan, 2007; Dutta et al., 2022, 2024a; Saini et al., 2024). Anthracnose disease typically begins as water-soaked, whitish, sunken lesions on leaf blades that later darken into oval or elliptical spots, leading to chlorosis and eventually necrosis (Schwartz and Mohan, 2007; Dutta et al., 2022, 2024a). The disease causes leaf curling, disrupts vascular function, and reduces photosynthesis, leading to major yield losses (Alberto, 2014; Dutta et al., 2022). In case of severe anthracnose infection, the symptoms may also appear on onion bulbs (Schwartz et al., 2015).

Management of anthracnose in Kharif onions is rather more challenging due to the frequent rainfall during the monsoon season and high humidity, which is conducive for spore germination and the splashing of fungal spores from infected plant debris onto healthy tissues, thereby spreading the disease rapidly (Salunkhe et al., 2022). The frequent rains during kharif wash away fungicides, reducing their effectiveness against anthracnose pathogens. The problem is further aggravated by the simultaneous increase in the number of insect vectors (Lorini et al., 1986; Liu, 2004), which may contribute further to the spread of fungal spores during the kharif season (McKenzie et al., 1993). Such challenges make the kharif onion cultivation less remunerative to farmers due to the lower yields and higher production costs, which adversely affect the onion supply chain and thereby increase onion prices during the lean period (August–October). Efforts have been undertaken to address the challenges of kharif onion cultivation through various strategies like developing anthracnose resistant/tolerant varieties through conventional breeding or biotechnological intervention, usage of effective chemical fungicides and dosage optimization, improved agronomic practices, and other integrated disease and pest management practices. The development of anthracnose-resistant onion varieties through traditional breeding is particularly difficult due to the lack of novel resistance gene(s) in the onion gene pool, as well as challenges related to gene introgression and viability of the crosses. To date, no complete resistance gene has been reported in onion; however, partial resistance has been observed in the shallot cultivar “Sumenep,” which too lacks flowering, leading to practical difficulties in its use for introgression (Suhardi, 1993; Bui et al., 2019). Two more onion cultivars, “Barreiro” and “Texas Early Grano” have exhibited resistance against C. gloeosporioides, suggesting that resistance is controlled by multiple genes, making it difficult to incorporate into a traditional breeding programme (Melo and Costa, 1983). Similar challenges exist in breeding Allium fistulosum, A. galanthum, and A. roylei, which have shown only partial resistance to anthracnose (Galván et al., 1997). These factors further complicate disease management, forcing the farmers to rely solely on chemical fungicides, which may lead to resistance development and other environmental concerns (Jaiswal et al., 2020).

To overcome these issues, an eco-friendly use of beneficial microbes having plant growth-promoting and bio-control potential is highly effective, as it has no negative impact on agroecosystems or human health. Beneficial microbes can influence plant growth parameters either directly (Direct mechanism) or through indirect mechanism (El-Saadony et al., 2022). The direct processes include the microbe-facilitated nutrient acquisition (nitrogen fixation, phosphate and other mineral solubilization) and phytohormone production [indole-3-acetic acid, gibberellins, and cytokinins, and the production of 1-aminocyclopropane-1-carboxylate (ACC) deaminase]. The indirect processes include antibiosis, mycoparasitism, competition for niches, and induction of systemic resistance that primarily operate through biocontrol activities that mitigate the deleterious effects of pathogens and adverse environmental factors. Several bacteria and fungi have been identified as antagonistic to Glomerella cingulata, Colletotrichum gloeosporioides, G. moniliformis, and Fusarium spp., and they can be utilized to manage the anthracnose sustainably. These include Paenibacillus polymyxa APEC128, Bacillus spp., Trichoderma piluliferum, and Trichoderma spp., Cryptococcus nemorosus, Rhodotorula toruloides and Nakaseomyces glabratus (Han et al., 2013; Kim et al., 2016; Musheer and Ashraf, 2017; da Costa et al., 2021; Ezebo and Okigbo, 2024, Li et al., 2025).

Biocontrol agents play a dual role: they exhibit antagonistic activity (antibiosis, parasitism, and secondary metabolites production) and promote plant growth by solubilization of phosphate and production of IAA (Indole acetic acid) and ammonia (Jaiswal et al., 2020). Among fungi, Trichoderma is the most extensively studied genus as a biocontrol agent. Several species, including T. asperellum, T. atroviride, T. harzianum, T. longibrachiatum, T.virens, and T. viride, were frequently used as biocontrol agents (Guzman-Guzman et al., 2019, Li et al., 2025). Unlike chemical pesticides and fertilizers, which often leave harmful residues and results in loss of soil microbial diversity, the application of Trichoderma-based formulations offer a safer alternative for sustaining crop yields and managing crop diseases without any adverse impact on soil ecology (Abdullah et al., 2021; Siddiqui et al., 2025). Various investigators have documented that the secondary metabolites from T. harzianum and T. virens, such as viridins, azaphilones, heterocyclic nitrogen compounds, and volatile terpenes, were pivotal in the biocontrol of fungal pathogens (Chethana et al., 2012; Priya et al., 2015; Manzar et al., 2022; Ramzan et al., 2023). Recently, da Silva Pereira et al. (2025) demonstrated that bioactive proteins such as glutaminase, metalloproteinase, chitinase, and peptide hydrolase from Trichoderma exhibit strong antagonistic activity against Fusarium spp., highlighting their biocontrol potential. While Trichoderma is well-known for antagonism and plant growth promotion, very few studies have correlated their PGP traits and in vitro antagonism with actual reduction in PDI and yield enhancement in onion. Whereas disease incidence and yield losses are higher in kharif onion, the published reports are more skewed on rabi onion crop as majority of onion production comes from rabi crop. Our study assumes significance because all Trichoderma strains do not perform equally and strain-specific evaluations are required to bridge the knowledge gap concerning identification of region-specific, potent strains that can be recommended for sustaining yield and for integrated management of anthracnose–twister disease of kharif onion crop.

Considering these factors, the current study was undertaken to assess the potent Trichoderma strains that can serve as dual-purpose biocontrol and growth-promoting agents for linking the in vitro traits with in vivo performance, thereby reducing the disease severity and increasing the bulb yield in kharif onion crop.

2 Materials and methods

2.1 Trichoderma strains

In this study, the Trichoderma strains were isolated from the soil samples collected from the experimental plots of ICAR-Directorate of Onion and Garlic Research, Pune, and ICAR-Directorate of Groundnut Research, Junagadh, Gujarat, India. Trichoderma selective medium (TSM) and Potato dextrose agar (PDA) were used for the isolation, and putative colonies were identified and purified by the single spore isolation method as described in our previous study (Dutta et al., 2024b), The pure cultures obtained were preserved at 4°C for further study.

2.2 Morphological and DNA-based identification

The morphology of Trichoderma strains was studied based on colony and spore morphology following the guidelines of the International Sub-Commission on Trichoderma and Hypocrea as given by Kumar and Sharma (2016). Genomic DNA was isolated from the 5 days old fresh mycelium grown on Potato dextrose broth (PDB) using the CTAB method (cetyl-trimethyl ammonium bromide) as Kumar et al. (2013). DNA-based identification of all Trichoderma isolates was carried out using the ITS (Internal Transcribed Spacer) and Tef1α (translation elongation factor) with the following primers pairs (5′TCCGTAGGTGAACCTGCGG3′) and (5′TCCTCCGCTTATTGATATGC3′) and (5′CATCGAGAAGTTCGAGAAGG3′) and (5′TACTTGAAGGAACCCTTACC3′), respectively synthesized by Eurofins Genomics (Bengaluru, India). The obtained sequences of ITS gene (NCBI accessions: OR048743-OR048753) and Tef1α gene (NCBI accessions: OR102865-OR102875) were analyzed using the BLAST algorithm against the NCBI GenBank database to confirm the identity of the strains. The colony morphology and microscopic images of the strains used in the current study are provided in the Supplementary Figure S1. Phylogenetic analysis was conducted using MEGA version 11 (Tamura et al., 2021). The evolutionary history was inferred employing the Maximum Likelihood method based on the Jukes-Cantor model (Jukes and Cantor, 1969).

2.3 Confrontation assays

A confrontation assay was performed for all eleven Trichoderma strains on potato dextrose agar plates (HiMedia Laboratories, Mumbai, India). Five mm mycelial disks taken from the margin of 5 days old culture of the Trichoderma were tested against the onion Anthracnose pathogen, Colletotrichum gloeosporioides, previously described by Dutta et al. (2024a). The potential test Trichoderma strains were inoculated at the margin of the Petri plate, placed opposite each other. Observations were recorded up to 7 days of incubation at 28°C. The Colletotrichum gloeosporioides plates without Trichoderma served as control. The treatments were replicated five times. The percent inhibition of the pathogen growth was calculated according to formula given by Vincent, 1927 as described below

T = Radial growth of the pathogen (mm) in presence of antagonist Trichoderma strain used.

I = Percentage inhibition of pathogen growth

C= growth (radial mycelial growth) in control.

2.4 Biochemical characterization

All eleven Trichoderma strains were subjected to various biochemical characterizations for PGP activities using qualitative or quantitative assays. Indole acetic acid (IAA) production was tested by growing isolates in tryptophan-supplemented broth, where IAA reacts with Salkowski's reagent to produce a pink coloration the intensity of which is proportional to the amount of IAA secreted into the medium. The absorbance of the developed color was measured at 540 nm using spectrophotometer (SpectroNanoStar, BMG LABTECH, Ortenberg, Germany) as described by Glickmann and Dessaux (1995). The siderophore production was assessed on Chrome Azurol S (CAS) medium based on the principle of iron chelation in which the siderophores chelate Fe3+ from the CAS-dye complex, leading to a blue-to-orange color change. The Trichoderma isolates were inoculated onto CAS agar plates and plates were incubated at 30°C. The siderophore production was indicated by the development of a distinct orange halo around colonies against the blue background of the medium. The diameter of the halo was used as a qualitative measure of siderophore production (Schwyn and Neilands, 1987; Machuca and Milagres, 2003; Louden et al., 2011), The phosphate solubilization was determined on Pikovskaya's agar, containing insoluble tricalcium phosphate [Ca3(PO4)2] as the only phosphorus source, which makes the medium opaque. The phosphate solubilizer strains can releases organic acids that dissolve the insoluble phosphate, resulting in a development of clear halo zone around the test colony (Promwee et al., 2014). Zinc solubilization was evaluated on mineral salt medium supplemented with insoluble zinc compounds, with solubilization indicated by halo zone formation (Sharma et al., 2012). Potassium solubilization was tested on Aleksandrov medium containing insoluble mica or feldspar, where solubilization is visualized as halo zones around colonies (Dhaked et al., 2017), Hydrogen cyanide (HCN) production was assayed by culturing isolates on glycine-supplemented medium, where volatile HCN reacts with picrate-impregnated filter paper placed in the lid, causing a color change from yellow to brown or reddish brown (Bakker and Schippers, 1987; Meera and Balabaskar, 2012).

Enzymatic activities, including amylase and protease, were analyzed using GYP (Glucose Yeast extract Peptone) medium with 1% soluble starch (Abdel and Shearer, 2002) and 0.4% gelatin (Sathish et al., 2012). For amylase activity, plates containing 1% soluble starch were inoculated with Trichoderma strains and incubated. After growth, the plates were flooded with iodine solution; amylase-producing isolates hydrolyse starch into simple sugars, resulting in clear zones around colonies against the blue-black background. The nitrogen-fixing ability of the Trichoderma strains was evaluated using Jensen's media devoid of nitrogen source, where the growth of Trichoderma strain indicated its ability to grow in N2-free medium by fixing the nitrogen (Zhang et al., 2017).

2.5 Field application of Trichoderma strains

Field experiments were conducted during kharif season for three consecutive years viz., 2021, 2022, and 2023, at the experimental research farm of ICAR-Directorate of Onion and garlic Research (DOGR), Pune, Maharashtra, India. The weather data of 2021, 2022, and 2023 kharif onion season were obtained from the ICAR-DOGR automatic weather station installed 50 m away from the experimental field. The potent Trichoderma strains, identified through in vitro screening, were evaluated under field conditions using a randomized complete block design comprising eleven treatments of Trichoderma and untreated control, each replicated thrice. For this study, the Bhima Super variety released from ICAR-DOGR, recommended for the kharif season, was used. Each Trichoderma strain was cultured in potato dextrose broth at 25 ± 2°C for 36 h. A 100 mL aliquot of the liquid culture, adjusted to 108 cfu/mL, was thoroughly mixed with 50 kg of farmyard manure (FYM) of nearly uniform composition, achieved through vigorous mixing. The mixture was placed in a rectangular pit (100 × 100 × 100 cm; l × b × h) and covered with a polythene sheet, allowing the Trichoderma strains to multiply in the FYM over a period of 12 days (Dutta et al., 2024b). The Trichoderma-enriched FYM was applied to each plot at a rate of 250 g per plot (8 m2), corresponding to 250 kg FYM per hectare, as a soil amendment prior to transplanting onion seedlings. Subsequent applications were made at 35, 65, and 95 days after transplanting (DAT). Control plots (T9) received similarly processed FYM without Trichoderma inoculation, applied at the same rate and time intervals. A mineral fertilizer dose of 100:50:50:30 kg NPKS per hectare was applied, and standard recommended practices were followed throughout the crop production cycle.

2.6 Anthracnose disease severity, relative water content (RWC), chlorophyll content, biomass, and bulb yield

Anthracnose disease severity was assessed using the 0–9 grade scale for scoring the disease (Dutta et al., 2022), and the Percent Disease Index (PDI) was calculated as described by Wheeler (1969). At 60 days after treatment application, the crop growth parameters, viz., number of leaves, plant height (cm), and pseudostem diameter (mm), were recorded. Total biomass production was also determined from each replicate at 60 DAT (Dutta et al., 2024b). The bulb yield per plot was expressed in t/ha.

At 60 DAT, Leaf relative water content was measured using the following formula;

The Chlorophyll content was also estimated at 60 DAT using the procedure as described by Arnon (1949). Total biomass production was calculated using the fresh and dry weights of the shoot, root, and bulb at 60 DAT. Total biomass was determined by expressing the normalized weight as described by Dutta et al. (2024b).

2.7 ICBR (incremental cost-benefit ratio) calculation

The incremental cost benefit ratio (ICBR) was calculated for all treatments using formula described by Chejara (2013), i.e., ICBR = Additional income received (from the particular treatment)/Additional cost incurred for the particular treatment. The additional income and cost were estimated based on the prevailing market rates.

2.8 Statistical analysis

Analysis of variance (ANOVA) was performed on the dataset to assess the efficacy of Trichoderma strains using pooled analysis. The differences in treatment means at p ≤ 0.05 were computed using Dunken's Multiple Range Test (DMRT) in SPSS Statistics, Version 22.0 (IBM Corp., Armonk, NY, USA). The effect of Trichoderma on the suppression of anthracnose-twister disease and supporting bulb yield was studied through Linear Regression and Pearson's correlation analysis using SPSS software. Data from 3 years were pooled, and SD (Standard deviation) values were figured for each treatment to reflect the variability across years and replications. The Canonical Correspondence Analysis (CCA analsysis) was performed to link biological responses like PDI with weather parameters using PAST software.

3 Results

3.1 Morphological and molecular characterization of Trichoderma strains

Based on the morphological and molecular characterization, seven out of eleven strains were identified as T. longibrachiatum (OGRDT1, OGRDT2, GRDT1, GRDT4, GRDT5, GRDT7, and GRDT8), two as T. asperellum (GRDT3 and GRDT6), one as T. harzianum (GRDT2) and one as T. capillare (OGRDT3) (Supplementary Tables S1, S2). The ITS and Tef1α gene sequences of eleven strains have been submitted to NCBI GenBank, with the corresponding ITS accessions (OR048743–OR048753) and Tef1α accessions (OR102865–OR102875) listed in Supplementary Table S2. A phylogenetic tree (Figure 1) was constructed using concatenated ITS and Tef 1α gene sequences from 11 isolated Trichoderma strains, along with reference sequences retrieved from NCBI GenBank. The sequence of Nectria cinnabarina was used as outgroup to root the phylogenetic tree. The pure cultures of all eleven species used in this study have been deposited in the International Repository of the ICAR- National Agriculturally Important Microbial Culture Collections (NAIMCC), Mau, Uttar Pradesh, India, and presented in Supplementary Table S2.

Figure 1

3.2 Confrontation assay

All eleven Trichoderma strains exhibited antagonistic activity against the plant pathogen C. gloeosporioides, ranging from 18.8 to 70.0% (Figure 2). Based on the inhibition percentage, the antagonistic activity followed a decreasing trend as T. longibrachiatum (OGRDT2) exhibited the highest inhibition (70.0%), followed by T. longibrachiatum (GRDT7) (42.9%). A set of strains comprising T. capillare (OGRDT3), T. longibrachiatum (GRDT5, GRDT8, GRDT1, OGRDT1), and T. asperellum (GRDT3) exhibited moderate antagonistic activity, with inhibition percentages ranging between 38.24 and 41.18%. Two strains, T. harzianum (GRDT2) and T. asperellum (GRDT6) exhibited lower inhibition (36.0%), whereas T. longibrachiatum (GRDT4) showed the lowest antagonistic activity (18.82%). Conclusively, the strain T. longibrachiatum (OGRDT2) outperformed all other Trichoderma strains effectively inhibiting the growth of C. gloeosporioides by 70% (Supplementary Figure S2).

Figure 2

3.3 Biochemical characterization

Biochemical analysis for plant growth promotion activity (PGPA) of the Trichoderma strains was done, and the strains were assessed for IAA, siderophore, and HCN production; phosphate, zinc, and potassium solubilization; enzymatic activity of amylase and protease; and N2 fixation (Table 1). Qualitative and quantitative analyses were conducted to determine IAA and siderophore production, and significant differences were observed among all eleven Trichoderma strains. A high amount of IAA was produced by OGRDT3 (45.65 μg/mL), whereas GRDT5 produced the lowest (23.52 μg/mL). Similarly, the production of siderophore also differed among the tested Trichoderma strains, with the highest siderophore production recorded for OGRDT3 (40.45%), and the lowest for GRDT4 (30.00%). The presence of transparent zones on media containing zinc indicated that the strains could solubilize Zn. The results showed that T. asperellum and T. longibrachiatum strains formed a prominent transparent zone around the culture, confirming their Zn solubilizing ability. Likewise, three T. longibrachiatum strains (OGRDT1, GRDT7, and GRDT8) demonstrated the ability to solubilize phosphorus by forming transparent circles in the medium. In contrast, the remaining strains failed to produce transparent zones around the culture. However, all strains tested negative for potassium solubilization. On the contrary, all strains tested positive for HCN production as indicated by the change of filter paper color from yellow to orange or reddish brown. All Trichoderma strains also showed positive results for amylase and protease activity, as evidenced by the formation of clear zones due to starch and gelatin degradation, respectively. Among Trichoderma isolates, nine strains, including T. longibrachiatum, T. harazianum, T. capillare and T. asperellum, showed nitrogen fixation in N-free medium.

Table 1

Strain IDIAA (μg/ml)Siderophore (%)Phosphate solubilization (mm)Zinc solubilization (mm)HCN productionAmylaseProteaseN fixation
OGRDT126.9636.223.101.10+++
OGRDT238.4538.4301.50++++
GRDT145.5439.2001.05++++
GRDT232.1038.5102.7++++
GRDT337.4436.4504.75++++
OGRDT345.6540.451.401.70++++
GRDT428.8430.0001.45++++
GRDT523.5231.2201.35++++
GRDT633.5239.4005.60++++
GRDT731.1733.223.592.35+++-
GRDT827.1334.152.151.50++++

Evaluation of PGPA traits for Trichoderma isolates.

3.4 Effect of Trichoderma strains on growth attributes, physiological responses, biomass and yield parameters

3.4.1 Effect of Trichoderma strains on growth attributes

Different Trichoderma strains exhibited variable effects on plant growth parameters, including plant height, pseudostem diameter, and number of leaves per plant. Among the Trichoderma strains used, maximum plant height (54.97 ± 0.80 and 53.29 ± 0.79 cm), number of leaves per plant (7.89 ± 0.99 and 7.62 ± 0.57), pseudostem diameter (13.96 ± 0.18 and 13.76 ± 0.20 mm) were recorded in OGRDT2 and GRDT2 strains, respectively (Table 2). The Trichoderma strain OGRDT2 consistently performed best in terms of plant height, pseudostem diameter, and number of leaves/plant in each experimental season of 2021–23 (The year wise data presented in Supplementary Table S3).

Table 2

Trichoderma isolatesPlant height (cm)Pseudostem diameter (mm)No. of leaves/plantNormalized dry weight (%)
ShootRootBulb
OGRDT146.37cd ± 0.6811.52b ± 0.406.77a ± 0.687.69b ± 2.367.96b ± 0.829.99b ± 1.55
OGRDT254.97a ± 0.8013.96a ± 0.187.89a ± 0.9910.39a ± 1.7611.86a ± 2.6712.21a ± 0.81
GRDT149.93abc ± 2.5211.98b ± 0.676.90a ± 0.268.03b ± 0.638.72b ± 0.7710.47a ± 0.87
GRDT253.29a ± 0.7913.76a ± 0.207.62a ± 0.5710.82a ± 0.8912.27a ± 0.1112.90a ± 0.65
GRDT351.37abc ± 1.1712.56a ± 0.607.23a ± 0.438.88a ± 0.349.94b ± 0.5411.11a ± 0.52
OGRDT352.26ab ± 2.8913.03a ± 0.737.38a ± 0.479.40a ± 1.4710.74a ± 0.2311.50a ± 0.73
GRDT448.34bc ± 1.8311.96b ± 0.386.83a ± 0.118.00b ± 0.068.32b ± 1.4510.02a ± 0.92
GRDT552.60ab ± 3.1113.21a ± 0.567.57a ± 0.109.90a ± 1.9411.43a ± 1.0511.82a ± 1.49
GRDT645.05d ± 1.9611.17b ± 0.495.93b ± 0.137.53b ± 0.677.89b ± 0.309.54b ± 1.05
GRDT750.32abc ± 1.5712.11b ± 0.967.11a ± 0.238.45a ± 0.959.12b ± 0.4310.42a ± 0.58
GRDT850.89abc ± 0.7612.37b ± 0.567.18a ± 0.718.64a ± 0.499.38b ± 0.5610.64a ± 0.98
Untreated control42.68c ± 1.9010.55c ± 0.045.78b ± 0.157.08b ± 0.877.35c ± 0.447.38c ± 0.34
LSD (p = 0.05) (year)1.270.450.360.760.600.83
LSD (p = 0.05) (treatments)2.550.900.711.531.191.66
LSD (p = 0.05) (years × treatments)4.411.551.232.652.062.88

Effect of application of Trichoderma strains on the plant growth of onion (pooled mean of Kharif 2021–2023).

Superscript alphabets signify statistically significant grouping of the treatments.

Application of different Trichoderma strains significantly influenced root, shoot and bulb biomass accumulation in onion plants. The highest shoot biomass accumulation was recorded for GRDT2 (and OGRDT2 treated plants (Table 2). The pooled analysis of 3 year normalized dry weights of shoot, root, and bulb revealed significantly higher weight for T. harzianum (GRDT2) treated plots with normalized dry weight values of 10.82 ± 0.89%, 12.27 ± 0.11%, and 12.90 ± 0.65% whereas T. longibrachiatum (OGRDT2) showed at par results in terms of normalized dry weight (Table 2). Both the strains (OGRDT2 and GRDT2) consistently performed superior in all experimental years (2021–23) in terms of shoot, root, and bulb biomass accumulation (Supplementary Table S4).

3.4.2 Effect of Trichoderma application on physiological responses

A three-year comparison of cumulative RWC values revealed that the Trichoderma application enhanced the RWC in the leaves as compared to the untreated control (Table 3). The highest RWC values (~71.36.0%) were observed in plots treated with GRDT2, OGRDT2, GRDT5, OGRDT3, GRDT3, and GRDT8, which were statistically at par with each other, whereas the lowest (57.86 ± 3.07%) was recorded in the untreated control. Strains GRDT2 and OGRDT2 consistently performed best across all three experimental years (2021–2023) (Supplementary Table S5). Similarly, substantial differences were recorded in chlorophyll content. Plots treated with OGRDT2 and GRDT2 strains recorded higher total chlorophyll contents (4.1 ± 0.83 mg/mL and 4.1 ± 1.44 mg/mL, respectively), whereas the control exhibited the lowest value (3.3 ± 0.84 mg/mL). All strains induced an increase in total chlorophyll content, indicating a clear positive effect on the chlorophyll levels in the leaf. Moreover, the total chlorophyll content showed a stronger correlation with chlorophyll a than with chlorophyll b.

Table 3

Trichoderma isolatesRelative water contentChlorophyll a (mg/mL)Chlorophyll b (mg/mL)Total Chlorophyll (mg/mL)
OGRDT161.32b ± 3.462.8 ± 1.110.6 ± 0.093.5 ± 1.29
OGRDT268.77a ± 3.803.2 ± 1.100.9 ± 0.224.1 ± 0.83
GRDT163.91a ± 2.783.1 ± 0.550.7 ± 0.183.7 ± 0.35
GRDT271.36a ± 5.413.2 ± 0.660.8 ± 0.344.1 ± 1.44
GRDT368.13a ± 3.853.1 ± 0.540.8 ± 0.143.9 ± 0.18
OGRDT368.70a ± 3.873.1 ± 1.130.8 ± 0.033.9 ± 1.38
GRDT462.41b ± 2.762.9 ± 0.550.7 ± 0.203.6 ± 0.73
GRDT568.34a ± 3.773.2 ± 0.830.8 ± 0.234.0 ± 1.05
GRDT661.56b ± 3.102.7 ± 0.750.7 ± 0.063.3 ± 0.80
GRDT764.83a ± 2.863.0 ± 0.300.7 ± 0.033.8 ± 0.58
GRDT865.61a ± 2.873.1 ± 0.210.8 ± 0.243.9 ± 0.62
Untreated control57.86b ± 3.072.7 ± 0.720.6 ± 0.093.3 ± 0.84
LSD (p = 0.05) (year)2.20NSNSNS
LSD (p = 0.05) (treatments)4.40NSNSNS
LSD (p = 0.05) (years × treatments)7.63NSNSNS

Effect of Trichoderma strains on RWC and Chlorophyll in onion leaves (pooled mean of kharif 2021-2023).

Superscript alphabets signify statistically significant grouping of the treatments.

3.4.3 Effect of Trichoderma strains on bulb yield

The Trichoderma strains exerted significant and variable effects on bulb yield across three consecutive years, with the highest yield (21.77 t/ha) recorded in 2022 for strain GRDT2, whereas the control plots produced only 16.71 t/ha in the same year (Supplementary Table S7). The results of the pooled analysis presented in Table 4, showed that the highest yield (20.66 ± 1.42 t/ha) was recorded in plots treated with T. harzianum (GRDT2) which were statistically at par with T. longibrachiatum OGRDT2 (19.21 ± 0.87 t/ha), GRDT5 (18.95 ± 0.61 t/ha), OGRDT3 (18.66 ± 0.36 t/ha), GRDT3 (18.50 ± 0.44 t/ha), GRDT8 (18.35 ± 1.49 t/ha), GRDT7 (18.24 ± 0.74 t/ha) and GRDT1 (18.10 ± 1.14 t/ha) indicating an overall increase of 19.89, 14.04, 12.81, 11.36, 10.62, 9.88, 9.33 and 8.63 %, respectively, over the untreated control (Table 4).

Table 4

Trichoderma strainsPercent disease index (PDI)Disease reduction over control (%)Bulb yield (t/ha)Increase in yield over control (%)ICBR
OGRDT153.31 (46.92)*c ± 0.9515.0717.12bc ± 0.653.543.00
OGRDT237.06 (37.52)a ± 1.3840.9619.21ab ± 0.8714.0413.45
GRDT149.04 (44.47)b ± 3.2121.8818.10ab ± 1.148.637.90
GRDT236.00 (36.89)a ± 0.9842.6520.66a ± 1.4219.8920.70
GRDT342.67 (40.80)b ± 0.5732.0318.50ab ± 0.4410.629.90
OGRDT340.81 (39.73)b ± 1.6634.9818.66ab ± 0.3611.3610.70
GRDT449.28 (44.61)b ± 1.1421.4817.30bc ± 0.554.553.90
GRDT539.73 (39.09)a ± 1.5436.7018.95b ± 0.6112.8112.15
GRDT655.97 (48.45)c ± 0.5710.8316.99bc ± 0.172.772.35
GRDT746.59 (43.07)b ± 0.8725.7718.24ab ± 0.749.338.60
GRDT845.61 (42.50)b ± 0.9127.3518.35ab ± 1.499.889.15
Untreated control62.77 (52.42)a ± 0.1416.52c ± 0.69
CD @ 5% for years1.830.75
CD @ 5% for treatments3.651.49
CD @ 5% for years × treatments6.322.58

Effect of Trichoderma strains on anthracnose disease severity and yield of onion (pooled mean of kharif 2021–2023).

*Figures in parentheses are arcsine-transformed values. Superscript alphabets signify statistically significant grouping of the treatments.

3.5 Effect of Trichoderma strains against anthracnose disease of onion

The field efficacy of Trichoderma strains against anthracnose of onion was assessed over three consecutive kharif seasons (2021–2023) (Supplementary Table S6), and the pooled analysis results are presented in Table 4 indicating the strain-wise PDI recorded. Overall, all Trichoderma strains effectively reduced the disease severity compared to the control. The most effective treatments were T. harzianum (GRDT2) and T. longibrachiatum (OGRDT2 and GRDT5), which recorded the lowest PDI (36.00 ± 0.98, 37.06 ± 1.38 and 39.73 ± 1.54 pooled mean) and the highest disease inhibition (42.65, 40.96, and 36.70%). This was followed by OGRDT3, GRDT3, GRDT8, GRDT7, GRDT1, GRDT4 with PDI of 40.81 ± 1.66, 42.67 ± 0.57, 45.61 ± 0.91, 46.59 ± 0.87, 49.04 ± 3.21, 49.28 ± 1.14 and corresponding reductions of 34.98, 32.03% 27.35, 25.77, 21.88, and 21.48%, respectively. In contrast, the highest disease (62.77 ± 0.14 PDI) was observed in the untreated (control) plot.

3.6 Correlation and linear regression analysis between anthracnose-twister disease severity and bulb yield

Correlation between anthracnose-twister disease severity and bulb yield for pooled analysis mean data of three consecutive years showed a strong negative correlation with r = −0.92. Linear regression line graphs for each individual year (2021–23) are presented in Supplementary Figure S3. Additionally, the data were exposed the linear regression analysis to determine the influence of disease incidence on bulb yield. The coefficient of determination (R2) for the pooled data is R2 = 0.8643, showing a high goodness of fit (Figure 3). This indicates that each 1% increase in disease severity corresponded to a reduction of approximately 0.07–0.12 t/ha in bulb yield.

Figure 3

3.7 Effect of weather parameters on anthracnose-twister disease severity

Disease severity varied across cropping seasons, ranging from 21.33 to 42.00 PDI in 2021, 45.19 to 80.00 PDI in 2022, and 41.48 to 66.30 PDI in 2023 (Supplementary Table S6). Rainfall during the kharif (July–October) was 275 mm in 2021, 402 mm in 2022, and 266 mm in 2023 (Supplementary file 2). Canonical correspondence analysis (CCA) revealed differential associations of Trichoderma strains with total rainfall, relative humidity, and temperature. Strains OGRDT2 and GRDT2 showed strong affinity for high rainfall, humidity, and lower temperatures, indicating their niche preference and proliferation under moderate relative humidity (67–80%) and moderately lower temperatures (17–26°C) conditions (Figure 4). The rainfall obtained during the kharif from July to October was 275 mm in 2021, 402 mm in 2022, and 266 mm in 2023 (Supplementary file 2). Interestingly, although rainfall and humidity are known to increase anthracnose-twister incidence, these conditions simultaneously favored OGRDT2 and GRDT2 proliferation (Figure 4), thereby reducing disease pressure and enhancing their biocontrol efficacy. Thus, efficacy of OGRDT2 and GRDT2 was highest in 2021 due to the concurrent presence of moderate disease pressure and favorable conditions for Trichoderma strains (OGRDT2 and GRDT2) establishment, since year 2021 received lesser rainfall (275) compared to 2022 (402 mm). Although the recorded rainfall in 2023 was even lower (266 mm), the higher average relative humidity (90%) may have contributed to the inferior performance of OGRDT2 and GRDT2 during that year.

Figure 4

In CCA plot, the years 2021–2023 were positioned near the origin, with year 2022 slightly inclined toward rainfall and humidity, reflecting relatively wetter conditions during this year (2022) and consequently more PDI during this year. The multivariate analysis (CCA analysis) also revealed correlation amongst weather parameters where average minimum temperature, relative humidity, rainfall, and wind velocity clustered on the right-hand side of the CCA plot, indicating their strong association with higher anthracnose incidence, as elevated humidity and rainfall are known to favor Colletotrichum growth (Figure 4). Wind velocity can also be a critical determinant, as higher wind speeds during infestation may facilitate greater spore dissemination. Contrary to this, the weather conditions like higher temperature, more sunshine hours, and lower relative humidity/rainfall are typically unfavorable for anthracnose development.

3.8 Cost-economic analysis of bioagent

Pooled mean data from 2021 to 2023 revealed that the treatments T. harzianum (GRDT2) achieved the highest incremental cost-benefit ratio (ICBR) of 20.70, followed by T. longibrachiatum (OGRDT2) (13.45). However, the lowest ICBR was recorded for T. asperellum (GRDT6) (2.35) due to the lower yields (Table 4). Notably, the input cost of bioagents was lower than that of chemicals, highlighting their economic advantage, particularly for the resource-poor farmers.

4 Discussion

Trichoderma is extensively used in agriculture for its mycoparasitic (direct attack on pathogen hyphae), antibiosis (production of antifungal compounds), and Plant Growth Promoting Potential (PGPP). This work was aimed to screen the potential of eleven Trichoderma strains of Indian origin against the devastating Anthracnose-twister disease of onion. Our results showed that the eleven Trichoderma strains tested in this study displayed variable PGPA potential and varying disease reduction efficacy against the Anthracnose pathogen Colletotrichum gloeosporioides. The Trichoderma strains identification was confirmed initially through morphological (Singh et al., 2015) methods and then through molecular methods (Samuels et al., 2012). Accurate species identification is crucial because different Trichoderma species vary significantly in their biocontrol efficacy and PGPA potential, and enzyme production. Based on Tef1α gene sequences and morphological characters, seven out of eleven strains were identified as Trichoderma longibrachiatum, two as T. asperellum, and T. harzianum, and T. capillare, one each. In this study, Trichoderma longibrachiatum emerged as the most frequently isolated species, likely owing to their saprotrophic competitiveness rendered by cellulolytic, chitinolytic, and proteolytic activity and secretion of effector proteins like Cpe1 and its efficiency as a root colonizer which favors their persistence in rhizosphere/ bulk soils (Wang et al., 2025). The repeated isolation of Trichoderma longibrachiatum can also be attributed to its high level of adaptation to edaphic stresses, which supports its persistence even under unfavorable soil conditions (Liu et al., 2023). Samuels et al. (2012) and Alwadai et al. (2024) used the polyphasic approach involving a combination of molecular (ITS and Tef1α gene sequences) and morphological characters to identify all strains of T. longibrachiatum due to existing concerns related to the longibrachiatum clade. While the ITS region is widely used for fungal identification, it has limitations in resolving closely related species within Trichoderma, as ITS sequences often lack sufficient variability to distinguish between phylogenetically proximate taxa (Chaverri et al., 2015). On the other hand, the translation elongation factor 1-alpha (Tef1α) gene provides greater discriminatory power at the species level and is frequently used for higher-resolution phylogenetic inference. Alwadai et al. (2024) further emphasized the use of a polyphasic approach combining morphology (e.g., spore size, colony structure), and molecular phylogenetics (ITS and tef1α gene sequences) for identification of T. longibrachiatum and T. harzianum strains. Furthermore, molecular phylogenetic analyses have revealed that T. longibrachiatum, while traditionally considered a single morphological species, represents a genetically diverse complex with cryptic species (Samuels et al., 2012; Alwadai et al., 2024).

The bio-efficacy of Trichoderma against plant pathogens has been well documented. To evaluate its antagonistic potential against C. gloeosporioides, a dual culture (confrontation) assay was conducted using eleven Trichoderma strains. Among them, T. longibrachiatum (OGRDT2) showed stronger in vitro inhibition, achieving 70% suppression of C. gloeosporioides mycelial growth (Figure 2 and Supplementary Figure S2). The results of confrontation assay between Trichoderma strains and Colletotrichum gloeosporioides (the causal agent of anthracnose), clearly indicated that certain Trichoderma strains possessed strong inhibitory activity, while others showed only moderate to weak suppression. The strain OGRDT2 exhibiting the highest inhibition (~70%), can also be explored for production of hydrolytic enzymes (chitinases, glucanases), and secretory antifungal metabolites, which rapidly inhibit mycelial growth of Colletotrichum gloeosporioides for effective management of anthracnose disease. The other strains showing lower inhibitory activity may lack strong antifungal metabolite production or competitive ability, making them less suitable as stand-alone biocontrol agents. Still, the strain GRDT2 which showed moderate inhibitory activity (40%) against Colletotrichum gloeosporioides, in the dual culture assay, it proved equally effective under field conditions, which may be due to triggering the Induced Systemic Resistance (ISR), enabling plants to resist infection more effectively instead of directly inhibiting the mycelial growth (Khan et al., 2023).

The strain specific variations in biocontrol efficacy is known from previous findings, which have highlighted broad spectrum antagonistic potential of T. longibrachiatum, T. asperellum, and T. harzianum against wide range of onion pathogens including C. gloeosporioides, S. cepivorum, A. porri, S. vesicarium, F. oxysporum f. sp. cepae, F. proliferatum and several post-harvest pathogens (Cos-kuntuna and Ozer, 2008; Kumar et al., 2012; Prakasam and Sharma, 2012; Ghanbarzadeh et al., 2016; Helman et al., 2019; Rivera-Méndez et al., 2020; Pawar et al., 2020; Camacho-Luna et al., 2023). Likewise, Mishra and Gupta (2012) also highlighted the antagonistic activity of T. harzianum, T. viride, T. hamatum, T. koningii, and T. virens against the S. vesicarium. The antagonistic activity of these Trichoderma strains has been validated under both in vitro and in vivo conditions, indicating their potential for use in integrated disease management strategies in onion cultivation. The varying potential among Trichoderma strains is largely attributed to differences in the production of extracellular cell wall-degrading enzymes (like chitinases, glucanases, and proteases), which play a key role in degrading the cell walls of the fungal pathogens. Additionally, differential production of secondary metabolites, particularly triterpenes, is linked to the activity of the ERG-1 gene encoding squalene epoxidase, an essential enzyme in the sterol/triterpene biosynthesis pathway. These mechanisms collectively contribute to the strain specific efficacy observed in Trichoderma mediated fungal suppression (Rai et al., 2016).

In this study, all eleven Trichoderma isolates were evaluated for plant growth-promotion, including the direct mechanism based attributes like production of IAA, siderophore, HCN, and phosphate, zinc, potassium solubilization, N fixation and indirect mechanism traits like activity of amylase, protease, and cellulase. The strains classified as T. longibrachiatum, varied in IAA and siderophore production (Table 1), confirming that PGP traits are strain-dependent. These findings underscore the importance of selecting specific strains for optimal crop benefits (Pedrero-Mendez et al., 2021). All Trichoderma strains demonstrated the ability to solubilize zinc however, none showed potassium solubilization activity. Notably, only three strains of T. longibrachiatum (OGRDT1, GRDT7, and GRDT8) were capable of solubilizing phosphate. Additionally, all tested strains exhibited positive reactions for HCN production and Nitrogen fixation, highlighting their plant growth-promoting potential (Singh et al., 2017, 2019; Singh et al., 2020; Chouhan, 2022; Alwadai et al., 2024). All Trichoderma strains used in this study produced protease and amylase lytic enzymes, enabling them to degrade pathogen cell walls. The production of these enzymes by Trichoderma spp. has been previously documented (Harman and Shoresh, 2007; Singh et al., 2013; Keswani et al., 2014; Singh et al., 2019) and contributes to improved disease management.

In this study, Trichoderma application significantly enhanced overall crop biomass (Table 2) and bulb yield (Table 4), with T. harzianum and T. longibrachiatum strains showing the most pronounced effects. These treatments performed significantly better than the untreated control and were at par with each other in pooled data, particularly improving plant height and pseudostem diameter (Table 2), which are the key indicators of onion health and productivity. These results align with previous findings by Metwally and Al-Amri (2020) who reported increased plant height and neck diameter of onion plants due to the application of Trichoderma viride. Similarly, Prakasam and Sharma (2012) also reported that T. harzianum and T. viride application enhanced Plant height and leaf number in onion. A related study by Vojnović et al. (2023) found that T3 significantly increased bulb yield by approximately 24.3% over the control with application of Trichoderma sp. through foliage spray.

In addition to growth parameters, this study also assessed the canopy traits, including leaf number per plant (Table 2), relative water content, and chlorophyll content (Table 3). A normal increase in leaf number was recorded after Trichoderma application, which might be attributed to enhanced nutrient uptake, stimulation of growth hormones, and improved root health (Harman et al., 2004). RWC improved across treatments, with notable increases observed in the pooled data (Table 3). The strains T. harzianum and T. longibrachiatum were particularly effective in improving chlorophyll content, surpassing the levels observed in the control treatment. Among the Trichoderma strains tested, T. harzianum and T. longibrachiatum significantly enhanced chlorophyll content, resulting in higher levels than the untreated control. Since chlorophyll is vital for photosynthesis and biomass accumulation (Simkin et al., 2022), this increase suggests improved physiological performance. These findings align with previous studies demonstrating T. asperellum application improved chlorophyll and carotenoid contents in onions (Helman et al., 2019; Metwally and AL-AMri 2020; Hernandez et al., 2023). These cumulative results support the role of Trichoderma in enhancing photosynthetic activity, ultimately contributing to improved plant growth and productivity under field conditions (Zhou et al., 2020; Mergawy et al., 2022).

In our study, Trichoderma strain OGRDT2 not only inhibited the growth of C. gloeosporioides but also enhanced plant growth parameters by attaining better root, shoot, and leaf biomass accumulation (Table 2). Even though, the strain OGRDT2 was positive for HCN production, amylase and protease activity which might render this strain biocontrol potential but the strain was not adjudged best in terms of other PGPA traits like IAA production (38.45 μg/ml), % siderophore production (38.43%), and Zinc solubilization (1.5 mm) along with the other better performing strain GRDT2 (Table 1). Our data pointed out that the strain that showed the best PGPA traits in vitro did not perform best in the actual field experiments in terms of plant biomass and bulb yield enhancement. Our findings are in agreement with those of Alwadai et al. (2024) who tested eight different Trichoderma strains (T. lixii, T. harzianum, T. koningii, T. virens, and T. longibrachiatum) for plant-growth-promoting traits in vitro but the presence of growth-promoting traits in vitro did not show direct correspondence to plant growth promotion of tomato plants. The absence of a direct correspondence between PGPA traits and field performance of the Trichoderma strains can be attributed to multiple factors, including strain-specific variation in root colonization efficiency, environmental stability, rhizosphere competence, and interactions with the native soil microbiota. Root colonization ability is both strain- and host-dependent, with different Trichoderma strains showing variable persistence and root association across plant species (Cripps-Guazzone et al., 2025). Consistent with this, several strains in our study that displayed strong PGPA traits in vitro may have failed to effectively colonize onion roots, thereby limiting their performance under field conditions. Therefore, employing the population density-based assessments (colony forming units per gram of rhizosphere soil), confocal laser scanning microscopy (CLSM) or scanning/transmission electron microscopy (SEM/TEM) based approaches may help to link rhizosphere competence more directly with field performance of Trichoderma strains. Furthermore, the edaphic factors like soil temperature, aeration, moisture, pH, salinity, and nutrient regime also strongly influence the growth, sporulation, metabolite secretion, and reproductive potential of the strains (Poppeliers et al., 2023). Field microclimates are often quite different from lab culture condition (25–35°C, moderate pH), influencing the root colonization of the strains. The interaction of applied Trichoderma strains with native soil microbiota remains an important determinant of strain successful determinant as native communities may outcompete the applied strain leading to inoculant functional attenuation (Causevic et al., 2024; Cavalcante et al., 2025).

Our findings revealed that the increased bulb yield observed with T. harzianum was positively influenced by root development. The fungus is known to produce phytohormones such as indole-3-acetic acid and auxin-like metabolites and also the reduced ethylene levels through ACC deaminase activity, which stimulate root elongation (Wang et al., 2024). Improved root systems not only facilitate more efficient acquisition of water and nutrients but also contribute to higher biomass accumulation and ultimately greater yield of the crop. Over three consecutive experimental years, T. harzianum GRDT2 consistently improved onion yield, averaging 20.66 ± 1.42 t/ha, being statistically at par with T. longibrachiatum OGRDT2 (19.21 ± 0.87 t/ha) against control plants (16.52 ± 0.69 t/ha), confirming the beneficial effects of Trichoderma application. Furthermore, cost economics (ICBR) revealed that the Trichoderma application provided higher returns due to its low cost and effective protection (Table 4). T. harzianum (GRDT2) supported the highest incremental cost-benefit and marginal rate of return, highlighting its economic advantage, particularly for resource-poor farmers. These findings are in agreement with earlier studies highlighting the cost effectiveness of Trichoderma based biocontrol strategies in various cropping systems (Sharma et al., 2011; Prasad and Anwar, 2020; Sultana et al., 2021). The integration of Trichoderma not only improves crop productivity and health but also contributes to sustainable and economically feasible disease management.

Our field trials demonstrated that anthracnose-twister disease reduction was highest in T. harzianum (GRDT2) and T. longibrachiatum (OGRDT2) treated plots, identifying these as the most effective strains among those tested (Table 4). Beyond disease suppression, these strains significantly promoted plant growth. Our results align with those of Alberto and Perez (2020), who reported that Trichoderma spp. effectively reduce anthracnose-twister disease incidence. Similarly, Manthesha et al., 2022 also demonstrated effective control of onion twister disease using a combination of Trichoderma and Pseudomonas spp., while Prakasam and Sharma (2012) highlighted the efficacy of T. harzianum against onion purple blotch and basal rot. The disease suppressive effects of Trichoderma are attributed to its multifaceted mechanisms, including antifungal metabolites, mycoparasitism, competition for nutrients and space, and induced systemic resistance in the host (Elad, 2000; Solanki et al., 2011). Few other studies have identified T. virens as highly effective against A. porri (Imtiaj and Lee, 2008) and T. asperellum against S. cepivorum (Alvarado-Marchena and Rivera-Mendez, 2016; Helman et al., 2019).

The disease severity, in general, is negatively correlated with bulb yield; a trend was also observed in our study (Figure 3). Over 3 years, the Trichoderma strains GRDT2 and OGRDT2 consistently showed a strong negative correlation between anthracnose-twister disease severity and bulb yield. As the disease advanced, a significant decline in bulb yield was recorded. Linear Regression analysis quantified this relationship, indicating a yield reduction of 0.07 to 0.12 tons for every one percent increase in disease severity (Tanya et al., 2020; Dias et al., 2016; Rajput et al., 2022). Collectively, these results confirm T. harzianum and T. longibrachiatum as the most potent biocontrol agents against anthracnose-twister of onion under field conditions.

Our findings also highlight the impact of weather on anthracnose-twister development, with notable variations in disease progression among Trichoderma strains. Disease progression was consistently lowest in strains GRDT2 and OGRDT2 treated plots, followed by GRDT5 and OGRDT3. The disease typically peaks between August and September, coinciding with favorable weather conditions, the crop's vulnerable stage, and peak pathogen activity, resulting in sustainable yield loss. This highlights the importance of timely disease management strategies that interrupt the overlap between peak disease pressure and the crop's most susceptible stage. The onset and severity of anthracnose-twister are strongly influenced by the interaction of three key factors: conducive environmental conditions, a susceptible host, and a virulent pathogen. Notably, the 2022 season experienced more favorable conditions for disease development compared to 2021 and 2023, leading to significantly higher disease severity and yield loss that year.

5 Conclusion

Our study highlights the beneficial effects of Trichoderma on onion crop health, bulb yield, and anthracnose-twister disease management, reinforcing its role as a valuable bio-stimulant. Among the evaluated strains in our study, GRDT2 (T. harzianum) showed highest bulb yield and thereby higher incremental cost-benefit ratio (ICBR) of 20.70 adjudged to be best for kharif onion cultivation. The strain OGRDT2 (T. longibrachiatum) (exhibited the highest potential for enhancing green onion production and reducing the anthracnose-twister supporting ICBR (13.45). Therefore, based on the above findings these two Trichoderma strains namely OGRDT2 and GRDT2 could be exploited for the use by farming community as these strains recorded higher green onion (OGRDT2) and bulb yield (GRDT2) production during the kharif season while managing the anthracnose-twister disease.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary material.

Author contributions

RD: Conceptualization, Investigation, Supervision, Writing – original draft, Writing – review & editing. KJ: Conceptualization, Data curation, Investigation, Methodology, Project administration, Writing – original draft, Writing – review & editing. SK: Visualization, Writing – original draft, Writing – review & editing. PS: Visualization, Writing – review & editing. RA: Visualization, Writing – review & editing. VM: Funding acquisition, Visualization, Writing – review & editing. MS: Supervision, Writing – review & editing.

Funding

The author(s) declare that financial support was received for the research and/or publication of this article. This research was supported by the lndian Council of Agricultural Research, Department of Agricultural Research and Education, Government of lndia through its in-house projects (IXX16540 & IXX16074) implemented at ICAR-Directorate of Onion and Garlic Research, Pune, MH, India.

Acknowledgments

The authors gratefully acknowledge the Indian Council of Agricultural Research and ICAR-DOGR, Pune, for funding support and providing the necessary facilities to conduct the research. The authors are also grateful to those who directly or indirectly supported this work and the development of the manuscript.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Gen AI was used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fsufs.2025.1663405/full#supplementary-material

References

  • 1

    AbdelR. A.ShearerC. A. (2002). Extracellular enzyme production by freshwater ascomycetes. Fungal Div.11, 119.

  • 2

    AbdullahN. S.DoniF.MispanM. S.SaimanM. Z.YusufY. M.OkeM. A.et al. (2021). Harnessing Trichoderma in agriculture for productivity and sustainability. Agronomy11:2559. 10.3390/agronomy11122559

  • 3

    AlbertoR. T. (2014). Pathological response and biochemical changes in Allium cepa L. (bulb onions) infected with anthracnose-twister disease. Pl. Pathol. Quar. 4, 2331. 10.5943/ppq/4/1/4

  • 4

    AlbertoR. T.AquinoV. M. (2010). Characterization of Colletotrichum gloeosporioides (Penzig) Penzig and Sacc. (anthracnose) and Gibberella moniliformis Wineland (twister) infecting onions in the Philippines. Asia Life Sci. 19, 2358.

  • 5

    AlbertoR. T.PerezP. M. (2020). Development of integrated disease management program against Anthracnose-Twister (Colletotrichum gloeosporioides-Gibberella moniliformis) disease of onion (Allium cepa). Pl. Pathol. and Quar.10, 111119. 10.5943/PPQ/10/1/13

  • 6

    Alvarado-MarchenaL.Rivera-MendezW. (2016). Molecular identification of Trichoderma spp. in garlic and onion fields and in vitro antagonism trials on Sclerotium cepivorum. Rev. Brasil. Ciênc. Solo40:e0150454. 10.1590/18069657rbcs20150454

  • 7

    AlwadaiA. S.Al WahibiM. S.Alsayed MF. (2024). Molecular characterization of plant growth-promoting Trichoderma from Saudi Arabia. Sci. Rep.14:23236. 10.1038/s41598-024-73762-5

  • 8

    ArnonD. L. (1949). A copper enzyme is isolated chloroplast polyphenol oxidase in Beta vulagaris. Plant Physiol. 24, 115. 10.1104/pp.24.1.1

  • 9

    BakkerA. W.SchippersB. (1987). Microbial cyanide production in the rhizosphere in relation to potato yield reduction and pseudomonas SPP-mediated plant growth-stimulation. Soil Bio. Biochem.19, 451457. 10.1016/0038-0717(87)90037-X

  • 10

    Benke AP.MahajanV.Manjunathagowda DC.Mokat DN. (2022). Interspecific hybridization in Allium crops: status and prospectus. Gen. Resou. Crop Evol.69, 19. 10.1007/s10722-021-01283-5

  • 11

    BuiT. T.NguyenD. K.TranQ. T. (2019). Identification of shallot pathogens in Vinh Châu town of Sóc Trăng province. J. Innov. Sust. Develop.11, 1118. 10.22144/ctu.jen.2019.033

  • 12

    Camacho-LunaV.Pizar-QuirozA. M.Rodríguez-HernándezA. A.Rodríguez-MonroyM.Sepúlveda-JiménezG. (2023). Trichoderma longibrachiatum, a biological control agent of Sclerotium cepivorum on onion plants under salt stress. Biol. Cont. 180:105168. 10.1016/j.biocontrol.2023.105168

  • 13

    CausevicS.DubeyM.MoralesM.SalazarG.SentchiloV.CarraroN.et al. (2024). Niche availability and competitive loss by facilitation control proliferation of bacterial strains intended for soil microbiome interventions. Nat. Commun.15:2557. 10.1038/s41467-024-46933-1

  • 14

    CavalcanteA. L. A.NegreirosA. M. P.MeloN. J. D. A.SantosF. J. Q.Soares SilvaC. S. A.PintoP. S. L.et al. (2025). Adaptability and sensitivity of Trichoderma spp. isolates to environmental factors and fungicides. Microorganisms13:1689. 10.3390/microorganisms13071689

  • 15

    ChaverriP.Branco-RochaF.JaklitschW.GazisR.DegenkolbT.SamuelsG. J. (2015). Systematics of the Trichoderma harzianum species complex and the re-identification of commercial biocontrol strains. Mycologia107, 558590. 10.3852/14-147

  • 16

    ChawdaH. T.RajasabA. H. (1996). Onion anthracnose disease symptoms: a review. Onion Newslett. Trop. 7, 8284.

  • 17

    ChejaraB. K. (2013). Studies on Gram Pod Borer, Helicoverpa armigera (hub.) on Chickpea and its Control With Insecticides and Biopesticides (M.Sc. Thesis). Jabalpur: Jawaharlal Nehru Krishi Vishwavidyalaya.

  • 18

    ChethanaB.GaneshanG.RaoA. S.BellishreeK. (2012). In vitro evaluation of plant extracts, bioagents and fungicides against Alternaria porri (Ellis) Cif., causing purple blotch disease of onion. Pest. Manag. Hortic. Ecosyst.18, 194198.

  • 19

    ChouhanG. K. (2022). “Exploration of plant growth-promoting rhizobacteria (PGPR) for improving productivity and soil fertility under sustainable agricultural practices,” in Singh, U. B., Rai, J. P., Sharma, A. K., editors. Re-visiting the Rhizosphere Eco-system for Agricultural Sustainability. Rhizosphere Biology (Singapore: Springer).

  • 20

    Cos-kuntunaA.OzerN. (2008). Biological control of onion basal rot disease using Trichoderma harzianum and induction of antifungal compounds in onion set following seed treatment A. Crop Prot. 27,330–336. 10.1016/j.cropro.2007.06.002

  • 21

    Cripps-GuazzoneN.RidgwayH. J.CondronL. M.McLeanK. L.StewartA.JonesE. E. (2025). Isolate and plant host specificity of rhizosphere competence in Trichoderma species. Fungal Biol.129:101554. 10.1016/j.funbio.2025.101554

  • 22

    da CostaA. C.de MirandaR. F.CostaF. A.UlhoaC. J. (2021). Potential of Trichoderma piluliferum as a biocontrol agent of Colletotrichum musae in banana fruits. Biocat. Agric. Biotechnol. 34:102028. 10.1016/j.bcab.2021.102028

  • 23

    da Silva PereiraL.SalomónA. L.BermudezV. A. C.RiusS. P. (2025). Bioactive proteins from Trichoderma for the control of Fusarium: evaluation of antagonist efficacy and potential for agronomic application. Biocatal. Agric. Biotechnol.67:103628. 10.1016/j.bcab.2025.103628

  • 24

    DhakedB. S.TriveniS.SubhashR.PadmajaG. (2017). Isolation and screening of potassium and zinc solubilizing bacteria from different rhizosphere soil. Int. J. Curr. Microbiol. App. Sci.6, 12711281. 10.20546/ijcmas.2017.608.154

  • 25

    DiasM. D.ValdeciF. P.AdalbertoC. C. (2016). Impact of anthracnose on the yield of soybean subjected to chemical control in the north region of Brazil. Summa Phytopathol. 42, 1823. 10.1590/0100-5405/2114

  • 26

    DuttaR.JayalakshmiK.NadigS. M.ManjunathagowdaD. C.GuravV. S.SinghM. (2022). Anthracnose of onion (Allium cepa L.): a twister disease. Pathogens11:884. 10.3390/pathogens11080884

  • 27

    DuttaR.JayalakshmiK.SatishK.RadhakrishnaA.ManjunathagowdaD. C.NadigS. M.et al. (2024a). Insights into the cumulative effect of Colletotrichum gloeosporioides and Fusarium acutatum causing anthracnose-twister disease complex of onion. Sci. Rep. 14:9374. 10.1038/s41598-024-59822-w

  • 28

    DuttaR.KumarS.JayalakshmiK.RadhakrishnaA.BhagatK.ManjunathagowdaD. C.et al. (2024b). Potential of Trichoderma strains to positively modulate plant growth processes and bulb yield in Rabi onion. Front. Sustain. Food Syst. 8:1427303. 10.3389/fsufs.2024.1427303

  • 29

    EladY. (2000). Biological control of foliar pathogens by means of Trichoderma harzianum and potential modes of action. Crop Protec. 19, 70971410.1016/S0261-2194(00)00094-6

  • 30

    El-SaadonyM. T.SaadA. M.SolimanS. M.SalemH. M.AhmedA. I.MahmoodM.et al. (2022). Plant growth-promoting microorganisms as biocontrol agents of plant diseases: mechanisms, challenges and future perspectives. Front. Plant Sci.13:923880. 10.3389/fpls.2022.923880

  • 31

    EzeboR. O.OkigboR. N. (2024). Biological control of post-harvest rot in water yam (Dioscorea alata L.) using antagonistic fungi. Int. J. Pathog. Res.13, 101116. 10.9734/ijpr/2024/v13i6325

  • 32

    FAO (2025). FAOSTAT Statistical Database. Rome: Food and Agriculture Organization of the United Nations. Available online at: https://www.fao.org/faostat/ (accessed August 18, 2025).

  • 33

    GalvánG. A.WietsmaW. A.PutrasamedjaS.PermadiA. H.KikC. (1997). Screening for resistance to anthracnose (Colletotrichum gloeosporioides Penz) in Allium cepa and its wild relatives. Euphytica95, 173178. 10.1023/A:1002914225154

  • 34

    GhanbarzadehB.SafaieN.Mohammadi EG.Younes RD.FatemehK. (2016). Biological control of Fusarium basal rot of onion using Trichoderma harzianum and Glomus mosseae. J. Crop Prot. 5, 35936810.18869/modares.jcp.5.3.359

  • 35

    GlickmannE.DessauxY. (1995). A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Appl. Environ. Microbiol. 61, 793796. 10.1128/aem.61.2.793-796.1995

  • 36

    Gopal (2015). Onion research in India: status and challenges. Progr. Hortic. 47, 119. 10.5958/2249-5258.2015.00001.9

  • 37

    GuarroJ. T.SvidinskiE.ZarorL.ForjazM. H.GeneJ.FischmanO. (1998). Subcutaneous hyalohyphomycosis caused by Colletotrichum gloeosporioides. J. Clin. Microbiol. 36, 30603065. 10.1128/JCM.36.10.3060-3065.1998

  • 38

    Guzman-GuzmanP.Porras-TroncosoM. D.Olmedo-MonfilV.Herrera EstrellaA. (2019). Trichoderma species, versatile plant symbionts. Phytopathology109:616. 10.1094/PHYTO-07-18-0218-RVW

  • 39

    HanS.ChiY, Liu, L.YiH. (2013). Biological characteristics of Trichoderma strain. Chinese Agric. Sci. Bull.29, 3741 (in Chinese). 10.11924/j.issn.1000-6850.2013-1038

  • 40

    HarmanG. E.HowellC. R.ViterboA.ChetI.LoritoM. (2004). Trichoderma species—opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2, 435610.1038/nrmicro797

  • 41

    HarmanG. E.ShoreshM. (2007). “The mechanisms and applications of opportunistic plant symbionts,” in Vurro, M., Gressel, J., eds. Novel Biotechnologies for Biocontrol Agent Enhancement and Management (Amsterdam: Springer), 131153.

  • 42

    HelmanZ. S. D.Palacios-PERodríguez-H,. AMelchorD.RodríguezM.Mario JG. (2019). Trichoderma asperellum, a potential biological control agent of Stemphylium vesicarium, on onion (Allium cepa L.). Biol. Cont.140, 104105. 10.1016/j.biocontrol.2019.104105

  • 43

    HernandezR. A.Herrera-AM.Zapata-S DH.Becerra ME.Rodríguez MM.Sepúlveda JG. (2023). Trichoderma asperellum promotes the development and antioxidant activity of white onion (Allium cepa L.) plants. Hortic. Environ. Biotechnol. 64, 2539. 10.1007/s13580-022-00467-x

  • 44

    ImtiajA.LeeT. (2008). Antagonistic effect of three Trichoderma species on the Alternaria porri pathogen of onion Blotch. World J. Agri.Sci. 4, 1317.

  • 45

    JaiswalA. K.MengisteT. D.MyersJ. R.EgelD. SHoaglL. A. (2020). Tomato domestication attenuated responsiveness to a beneficial soil microbe for plant growth promotion and induction of systemic resistance to foliar pathogens. Front. Microbiolol.11:604566. 10.3389/fmicb.2020.604566

  • 46

    JukesT. H.CantorC. R. (1969). Evolution of Protein Molecules. New York, NY: Academic Press, 21132.

  • 47

    KaleR. B.GavhaneA. D.ThoratV. S.GadgeS. S.WayalS,. MGaikwadS,. Y.et al. (2024). Efficiency dynamics among onion growers in Maharashtra: a comparative analysis of drip irrigation adopters and non-adopters. BMC Plant Biol. 24:237. 10.1186/s12870-024-04875-2

  • 48

    KalyaniG.BalsubramanianS.ChandraP. (2014). Plant based butters: review. J. Food Sci. Tech. 52, 39653976. 10.1007/s13197-014-1572-7

  • 49

    KeswaniC.MishraS.Sarma BK.Singh SP.Singh HB. (2014). Unraveling the efficient applications of secondary metabolites of various Trichoderma spp. App. Microb. Biotechnol. 98, 533544. 10.1007/s00253-013-5344-5

  • 50

    KhanR. A. A.NajeebS.ChenJ.WangR.ZhangJ.HouJ.et al. (2023). Insights into the molecular mechanism of Trichoderma stimulating plant growth and immunity against phytopathogens. Physiol. Plant.175:e14133. 10.1111/ppl.14133

  • 51

    KimY. S.BalarajuK.JeonY. H. (2016). Biological control of apple anthracnose by Paenibacillus polymyxa APEC128, an antagonistic rhizobacterium. Plant Path. 32, 251259. 10.5423/PPJ.OA.01.2016.0015

  • 52

    KumarK.AmaresanN.BhagatS.MadhuriK.SrivastavaR. C. (2012). Isolation and characterization of Trichoderma spp. for antagonistic activity against root rot and foliar pathogens. Indian J. Microbiol. 52:3. 10.1007/s12088-011-0205-3

  • 53

    KumarM. A.SharmaP. (2016). Morphological characterization of biocontrol isolates of Trichoderma to study the correlation between morphological characters and biocontrol efficacy. Int. Lett. Natural Sci. 55, 5767. 10.56431/p-9s33dk

  • 54

    KumarS.RajS.MauryaD. K.KashyapP. L.SrivastavaA. K.AnandarajM. (2013). Cross-species transferability of microsatellite markers from Fusarium oxysporum for the assessment of genetic diversity in Fusarium udum. Phytoparasitica41, 615622. 10.1007/s12600-013-0324-y

  • 55

    LiX.LiaoQ.ZengS.WangY.LiuJ. (2025). The use of Trichoderma species for the biocontrol of postharvest fungal decay in fruits and vegetables: challenges and opportunities. Postharvest Biol. Technol.219:113236. 10.1016/j.postharvbio.2024.113236

  • 56

    LiuT. X. (2004). Seasonal population dynamics, life stage, composition of T tabaci (Thysanoptera: Thripidae) and predacious natural enemies on onions in south Texas. Southwest Entomol.29, 127135.

  • 57

    LiuZ.XuN.PangQ.KhanR. A. A.XuQ.WuC.et al. (2023). A salt-tolerant strain of Trichoderma longibrachiatum HL167 is effective in alleviating salt stress, promoting plant growth, and managing Fusarium wilt disease in cowpea. J. Fungi9:304. 10.3390/jof9030304

  • 58

    LoriniI.TorresL.GuimaraesD. R. (1986). Study about population fluctuations of T. tabaci in an onion crop. Int. J. Entomol. 62, 19.

  • 59

    LoudenB. C.HaarmannD.LynneA. M. (2011). Use of blue agar CAS assay for siderophore detection. J. Microb. Bio. Edu. 12, 5153. 10.1128/jmbe.v12i1.249

  • 60

    MachucaA.MilagresA. M. F. (2003). Use of CAS-agar plate modified to study the effect of different variables on the siderophore production by aspergillus. Lett. App. Microbiol. 36, 177181. 10.1046/j.1472-765X.2003.01290.x

  • 61

    MantheshaH. D.MallikarjunK.YenjerappaS. T.AswathanarayanaD. S.VikasK. (2022). Management of onion twister disease under field condition. The Pharma Inn. J. 1, 551555.

  • 62

    ManzarN.KashyapA. S.GoutamR. S.RajawatM. V. S.SharmaP. K.SharmaS. K.et al. (2022). Trichoderma: advent of versatile biocontrol agent, its secrets and insights into mechanism of biocontrol potential. Front. Sust. 14:12786. 10.3390/su141912786

  • 63

    McKenzieC. L.CartwrightB.MillerM. E.EdelsonJ. V. (1993). Injury to onions by Thrips tabaci (Thysanoptera: Thripidae) and its role in the development of purple blotch. Environ. Entomol.22, 12661277. 10.1093/ee/22.6.1266

  • 64

    MeeraT.BalabaskarP. (2012). Isolation and characterization of Pseudomonas fluorescens from rice fields. Int. J. Food Agri. Vet. Sci.2, 113120.

  • 65

    MeloI. G.CostaC. P. (1983). Estimativas de parametros geneticos em cebola (Allium cepa L.) populacoes Pira Rosa e Pira Tropical, para o car'ater resistencia a Colletotrichum gloeosporioides Penz. Summa Phytopath.9, 207213.

  • 66

    MergawyM. M.MetwalyH. A.Shoeip AM. (2022). Evaluation of the efficacy of some bioagents accompanied with bio-and mineral fertilizers in controlling early blight of tomato and improvement yield. Egypt. J. Phytopath.50, 3150. 10.21608/ejp.2022.133129.1059

  • 67

    MetwallyR. A.Al-AmriS. M. (2020). Individual and interactive role of Trichoderma viride and arbuscular mycorrhizal fungi on growth and pigment content of onion plants. Lett. App. Microbiol. 70, 7986. 10.1111/lam.13246

  • 68

    MishraR. K.GuptaR. P. (2012). In vitro evaluation of plant extracts, bio-agents and fungicides against purple blotch and Stemphylium blight of onion. J. Med. Plant Res.6, 58405843. 10.5897/JMPR10-246

  • 69

    MusheerN.AshrafS. (2017). Effect of Trichoderma spp. on Colletotrichum gleosporiodes Penz and Sacc. causal organism of turmeric leaf spot disease. Trends Biosci. 10, 96059608.

  • 70

    PaibomesaiM.CelettiM.TesfaendriasM. (2012). Update on Stemphylium leaf blight of onions in Ontario. Hort. Matt.12, 1112.

  • 71

    PawarS. B.BhosaleS. B.ChavanA. M. (2020). Antagonistic activity of Trichoderma harzianum on fungi of onion (Allium cepa L.). Purakala31, 710714.

  • 72

    Pedrero-MendezA.InsuastiH. C.NeaguT.Illescas MRubio M, B.MonteE. (2021). Why is the correct selection of Trichoderma strains important? The case of wheat endophytic strains of T. harzianum and T. simmonsii. J. Fungi. 7:1087. 10.3390/jof7121087

  • 73

    PoppeliersS. W.Sánchez-GilJ. J.de JongeR. (2023). Microbes to support plant health: understanding bioinoculant success in complex conditions. Curr. Opin. Microbiol.73:102286. 10.1016/j.mib.2023.102286

  • 74

    PrakasamV.SharmaP. (2012). Trichoderma harzianum (Th-3) a potential strain to manage the purple blotch of onion (Allium cepa L.) caused by Alternaria porri under North Indian Plains. J. Agric. Sci. 4, 266272. 10.5539/jas.v4n10p266

  • 75

    PrasadR. D.AnwarM. (2020). Economic analysis of biocontrol-based integrated management of root rot in chickpea using Trichoderma spp. J. Biol. Control.34, 129134.

  • 76

    PriyaR. U.SataraddiA.DarshanS. (2015). Efficacy of non-systemic and systemic fungicides against purple blotch of onion (Allium cepa L.) caused by Alternaria porri (Ellis) Cif. Int. J. Recent Sci. Res. 6, 65196521.

  • 77

    PromweeA.IssarakraisilaM.IntanaW.ChamswarngC.YenjitP. (2014). Phosphate solubilization and growth promotion of rubber tree (Hevea brasiliensis Muell. Arg.) by Trichoderma strains. J. Agric. Sci. 6:8. 10.5539/jas.v6n9p8

  • 78

    RaiS.KashyapP. L.KumarS.SrivastavaA. K.RamtekeP. W. (2016). Identification, characterization and phylogenetic analysis of antifungal Trichoderma from tomato rhizosphere. Springerplus5:1939. 10.1186/s40064-016-3657-4

  • 79

    RajputL. S.KumarS.NataraJ. V.ShivakumarM.MaheshwariH. S.GhodkiB S (2022). Evaluation of novel fungicide for the management of soybean anthracnose disease and yield loss estimation. Legume Res. 10, 18. 10.18805/LR-4783

  • 80

    RamzanU.AbidK.ZafarM. A.AnwarA. M.NadeemM.TanveerU.et al. (2023). Trichoderma: multitalented biocontrol agent. Int. J. Agric. Biosci. 12, 7782. 10.47278/journal.ijab/2023.047

  • 81

    Rivera-MéndezW.ObregónM.MoránDiezM. E.HermosaR.MonteE. (2020). Trichoderma asperellum biocontrol activity and induction of systemic defenses against Sclerotium cepivorum in onion plants under tropical climate conditions. Biol.Cont. 141:104145. 10.1016/j.biocontrol.2019.104145

  • 82

    SainiS.RajK.SainiA. K.KumarR.SainiA.KhanA.et al. (2024). Unravelling the synergistic interaction of Thrips tabaci and newly recorded, Thrips parvispinus with Alternaria porri (Ellis.) Cif, inciting onion purple blotch. Front. Microbiol. 15:1321921. 10.3389/fmicb.2024.1321921

  • 83

    SalunkheV. N.GedamP.PradhanA.GaikwadB.KaleR.GawandeS. (2022). Concurrent waterlogging and anthracnose-twister disease in rainy-season onions (Allium cepa): Impact and management. Front. Microbiol.8:1063472. 10.3389/fmicb.2022.1063472

  • 84

    SamuelsG. J.IsmaielAMulawT. B. (2012). The longibrachiatum clade of Trichoderma: a revision with new species. Fungal Divers.55, 77108. 10.1007/s13225-012-0152-2

  • 85

    SathishL.PavithraN.AnandaK. (2012). Antimicrobial activity and biodegrading enzymes of endophytic fungi from eucalyptus. Int. J. pharmocol. Sci. Res. 3, 25742583.

  • 86

    SchwartzH. F.du ToitL. J.CoutinhoT. (2015). Diseases of Onion and Garlic (Allium cepa L. and A. sativum L., Respectively). St Paul, MN: The American Phytopathological Society.

  • 87

    SchwartzH. F.MohanS. K. (2007). Compendium of Onion and Garlic Diseases and Pests. 2nd ed. St. Paul, MN: The American Phytopathological Society, 136.

  • 88

    SchwynB.NeilandsJ. B. (1987). Universal chemical assay for the detection and determination of siderophore. Anal. Biochem. 160, 4756. 10.1016/0003-2697(87)90612-9

  • 89

    SharmaD.ChauhanA. (2024). Kharif onion production in India-present status and future potential: a review. Agric. Rev.45, 653660. 10.18805/ag.R-2455

  • 90

    SharmaP.SharmaN.SindhanG. S. (2011). Economic viability of Trichoderma harzianum in management of soil-borne diseases in vegetables. Indian Phytopath.64, 281284.

  • 91

    SharmaS. K.SharmaM. P.RameshA.JoshiO. P. (2012). Characterization of zinc solubilizing Bacillus isolates and their potential to influence zinc assimilation in soybean seeds. J. Microbio. Biotechnol.22, 352359. 10.4014/jmb.1106.05063

  • 92

    SiddiquiS.SultanN.KhatoonA.KamalA. (2025). Exploring the multifaceted roles of Trichoderma in agriculture: from growth stimulation to pollution remediation. Biochem. Cell. Arch.25:49. 10.51470/BCA.2025.25.1.49

  • 93

    SimkinA. J.KapoorL.DossC. G. P.Hofmann TA.LawsonT.RamamoorthyS. (2022). The role of photosynthesis related pigments in light harvesting, photoprotection and enhancement of photosynthetic yield in planta. Photosynthesis Res. 152, 2342. 10.1007/s11120-021-00892-6

  • 94

    SinghA.JainA.SarmaB. K.UpadhyayR. S.SinghH. B. (2013). Rhizosphere microbes facilitate redox homeostasis in Cicer arietinum against biotic stress. Ann. Appl. Biol. 163, 3346. 10.1111/aab.12030

  • 95

    SinghA.PandeySSrivastavaM.ShahidM.KumarV.TrivadiS.et al. (2015). Physiological and biochemical analysis of Trichoderma species isolated from different location U. P. Afr. J. Agri. Res. 10, 48374843. 10.5897/AJAR2015.10374

  • 96

    SinghV.KeswaniC.RayS.UpadhyayR. S.DhananjayaP.SinghP. R.et al. (2019). Isolation and screening of high salinity tolerant Trichoderma spp. with plant growth property and antagonistic activity against various soilborne phytopathogens. Arch. Phytopathol. Plant. Protec. 52, 667680. 10.1080/03235408.2019.1648917

  • 97

    SinghV.RayS.BisenK.KeswaniC.UpadhyayR,. SSarmaB. K.et al. (2017). Unravelling the dual applications of Trichoderma spp. as biopesticide and biofertilizer. Adv. PGPR Res. 364–374. 10.1079/9781786390325.0364

  • 98

    SolankiM. K.SinghN.SinghR. K.SinghP.SrivastavaA. K.KumarS.et al. (2011). Plant defense activation and management of tomato root rot by a chitin-fortified Trichoderma/Hypocrea formulation. Phytoparasitica39, 47148110.1007/s12600-011-0188-y

  • 99

    SrinivasP. S.LawandeK. E. (2007). Seedling root dip method for protecting onion plants from thrips. Indian J. Plant Protect.35, 206209.

  • 100

    SuhardiH. A. (1993). Anthracnose on shallot (Allium cepa group aggregatum) in Java. Onion Newslett. Trop. 5, 4850.

  • 101

    SultanaN.HossainI.AhmedM. U. (2021). Economic evaluation of Trichoderma-based management for damping-off in vegetables. Bang. J. Agric. Res.46, 243253.

  • 102

    TamuraK.StecherG.KumarS. (2021). MEGA11: molecular evolutionary genetics analysis. Mol. Biol. Evol. 38, 30223027. 10.1093/molbev/msab120

  • 103

    TanyaM.TrinaS.SunitaM.SrikantD. (2020). Measuring and assessing the yield loss and yield loss model of green gram due to Anthracnose of green gram (Vigna radiata). Legume Res.43, 678682.

  • 104

    VincentJ. M. (1927). Distribution of fungal hyphae in the presence of certain inhibitors. Nature159, 239241.

  • 105

    VojnovićD.MaksimovićI.HoreckiA. TŽunićD.AdamovićB.MilićA. (2023). Biostimulants affect differently biomass and antioxidant status of onion (Allium cepa) depending on production method. Horticulturae9:1345. 10.3390/horticulturae9121345

  • 106

    WangX.ChenW.ZhangJ.HuW.LiM.ZhaoP.et al. (2025). Effector Cpe1 secreted by Trichoderma longibrachiatum induces plant disease resistance. Biol. Control202:105726. 10.1016/j.biocontrol.2025.105726

  • 107

    WangX.ZhaoZ.LiH.WeiY.HuJ.YangH.et al. (2024). The growth-promoting and disease-suppressing mechanisms of Trichoderma inoculation on peanut seedlings. Front. Plant Sci.15:1414193. 10.3389/fpls.2024.1414193

  • 108

    WheelerB. E. J. (1969). An Introduction to Plant Diseases. London: John Wiley and Sons Limited, 301.

  • 109

    ZhangL.NiazS. I.KhanD.WangZ.ZhuY.ZhouH. (2017). Induction of diverse bioactive secondary metabolites from the mangrove endophytic fungus Trichoderma sp. (strain 307) by co-cultivation with Acinetobacter johnsonii (strain B2). Mar Drugs15:35. 10.3390/md15020035

  • 110

    ZhouX. F.ZhangX. Y.CaiW. Y.YanT.JingW. X.XuH. W. (2020). The effect of Trichoderma harzianum on the growth-promoting effect of cucumber seedlings. J. Jilin Norm. Univ. 41, 9399.

Summary

Keywords

anthracnose-twister, Colletotrichum gloeosporioides, kharif onion, Trichoderma, bulb yield

Citation

Dutta R, Jayalakshmi K, Kumar S, Soumia PS, Auji R, Mahajan V and Singh M (2025) Evaluation of potent Trichoderma strains against anthracnose-twister disease and enhancement of crop health and bulb yield in kharif onion. Front. Sustain. Food Syst. 9:1663405. doi: 10.3389/fsufs.2025.1663405

Received

10 July 2025

Accepted

04 September 2025

Published

24 September 2025

Volume

9 - 2025

Edited by

Matteo Balderacchi, Independent Researcher, Piacenza, Italy

Reviewed by

Surasak Khankhum, Mahasarakham University, Thailand

Abayeneh Girma, Mekdela Amba University, Ethiopia

Mingzheng Duan, Zhaotong University, China

Updates

Copyright

*Correspondence: Ram Dutta K. Jayalakshmi Satish Kumar

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics