ORIGINAL RESEARCH article

Front. Nutr., 18 January 2022

Sec. Nutrigenomics

Volume 8 - 2021 | https://doi.org/10.3389/fnut.2021.812011

Dietary Hermetia illucens Larvae Meal Improves Growth Performance and Intestinal Barrier Function of Weaned Pigs Under the Environment of Enterotoxigenic Escherichia coli K88

  • 1. State Key Laboratory of Livestock and Poultry Breeding, Ministry of Agriculture Key Laboratory of Animal Nutrition and Feed Science in South China, Guangdong Key Laboratory of Animal Breeding and Nutrition, Maoming Branch, Guangdong Laboratory for Lingnan Modern Agriculture, Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Guangzhou, China

  • 2. Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Institute of Animal Nutrition and Feed Science, College of Animal Science, Ministry of Education, Guizhou University, Guiyang, China

  • 3. Guangzhou AnRuiJie Environmental Protection Technology Co., Ltd., Guangzhou, China

Abstract

The aim of this study was to evaluate the effect of Hermetia illucens larvae meal (HI) on the growth performance and intestinal barrier function of weaned pigs. To achieve this, 72 weaned pigs [28-day-old, 8.44 ± 0.04 kg body weight (BW)] were randomly assigned to three dietary treatments: basal diet (negative control, NC), zinc oxide-supplemented diet (positive control, PC), and HI-supplemented diet [100% replacement of fishmeal (FM), HI], for 28 days in the presence of enterotoxigenic Escherichia coli (ETEC). The results showed that HI and PC increased (p < 0.05) the average daily gain (ADG) and average daily feed intake (ADFI) of weaned pigs from day 1 to 14, and decreased diarrhea incidence from day 1 to 28. Additionally, HI increased (p < 0.05) claudin-1, occludin, mucin-1 (MUC-1), and MUC-2 expression, goblet cell number, and secretory immunoglobulin A (sIgA) concentration in the intestine of weaned pigs. Compared with NC, HI downregulated (p < 0.05) interleukin-1β (IL-1β) and IL-8 expression, and upregulated IL-10, transforming growth factor-β (TGF-β), antimicrobial peptide [porcine β defensin 1 (pBD1), pBD2, protegrin 1-5 (PG1-5)] expression in the jejunum or ileum. Moreover, HI decreased (p < 0.05) toll-like receptor 2 (TLR2), phosphorylated nuclear factor-κB (p-NF-κB), and phosphorylated mitogen-activated protein kinase (p-MAPK) expression, and increased sirtuin 1 (SIRT1) expression in the ileum. Additionally, HI increased histone deacetylase 3 (HDAC3) expression and acetylation of histone 3 lysine 27 (acH3k27) in the ileum. Furthermore, HI positively influenced the intestinal microbiota composition and diversity of weaned pigs and increased (p < 0.05) butyrate and valerate concentrations. Overall, dietary HI improved growth performance and intestinal barrier function, as well as regulated histone acetylation and TLR2-NF-κB/MAPK signaling pathways in weaned pigs.

Introduction

Fishmeal (FM) is an important protein source in piglet nutrition; however, marine overfishing has led to soaring FM prices and reduced its availability (1). In 2019, ~1.420 million tons of FM were imported by China, with a local supply of only 0.699 million tons, indicating that China is extremely dependent on importation to meet its FM demand. Therefore, to reverse this trend, there is a need for effective, safe, and sustainable alternatives to FM, one of which is Hermetia illucens larvae meal (HI).

Hermetia illucens larvae is a common insect with high protein content (37–44.6%) and an essential amino acid profile similar to that of fishmeal (1–3). Importantly, H. illucens larvae are rich in antimicrobial peptides (AMPs) and medium-chain fatty acids, which play important roles in regulating animal intestinal microbiota and intestinal immunity (4, 5). Studies have reported improved growth performance in Chinese soft-shelled turtles, chickens, and fattening pigs fed diets containing appropriate levels of H. illucens larvae as the protein source (6–8). Additionally, HI has been shown to promote the expression of mucins (MUCs) and tight junction (TJ) proteins, and improve intestinal barrier function in juvenile barramundi, broilers, and fattening pigs (9–11).

Furthermore, some studies have shown that HI improves the intestinal microflora and metabolism, and regulates immune homeostasis in fish, broilers, and fattening pigs (11–13). A recent study reported that feeding 2% HI (replacing 50% of dietary FM) improved intestinal microflora and intestinal immune homeostasis in weaned pigs (14), which is probably through the activities of AMPs. Research findings suggest that the expression of AMPs depends on histone acetylation. Histone deacetylase (HDAC) and sirtuin 1 (SIRT1) regulates the modification mode of histone H3 [acetylation of histone lysine 9 (acH3k9), acetylation of histone 3 lysine 27 (acH3k27), and phosphorylation of histone H3 at serine s10 (pH3s10)] in the promoter region of antimicrobial peptides, which specifically increases the expression of intestinal AMPs and enhances their ability against bacterial infections (15–17). However, it is unclear whether HI regulates the expression of AMPs through histone acetylation, improving the intestinal microbiota and intestinal immune homeostasis of weaned pigs. Moreover, although studies have examined the effect of HI diet on aquatic animals, poultry, and fattening pigs, studies on weaned pigs are limited.

Enterotoxigenic Escherichia coli (ETEC) K88 is one of the main causes of diarrhea in weaned pigs, and is strongly associated with retarded growth performance, intestinal barrier dysfunction, and microbiota disorders (18, 19). However, the effect of HI on weaned pigs in the environment of ETEC K88 has not been reported to date. Therefore, the aim of this study was to examine the effect of HI on the growth performance, intestinal barrier function, and intestinal microbiota of weaned pigs in the environment of ETEC K88.

Materials and Methods

Preparation of HI

HI was provided by Guangzhou AnRuiJie Environmental Protection Technology Co., Ltd. (Guangzhou, China). The prepupae were dried at 80°C for 30 min and air-dried, crushed into powder, and passed through a 1.0 mm sieve as described previously (11). The DM (GB/T 6435-2014), ash (GB/T 6438-2007), CP (GB/T 6432-1994), EE (GB 5009.6-2016), total P (GB/T 6437-2018), Ca (GB 5009.268-2016), and amino acid (GB/T 18246-2000) content of HI was determined by Guangzhou HuiBiao Testing Technology Center, as shown in Table 1.

Table 1

Nutritional compositionContent
DM, %93.3
Ash, %17.6
CP, %37.91
EE, %31.2
Total P, %0.83
Ca, %4.39
Essential amino acids
Lys1.88
Met0.40
Met + Cys0.50
Ile1.16
Leu2.02
Trp0.36
Val1.67
Thr1.27
Arg1.65
Phe1.05
His0.89
Non-essential amino acids
Ala2.05
Asp2.86
Glu4.24
Gly1.61
Ser1.21
Tyr1.83
Pro2.07

Nutritional composition of the Hermetia illucens larvae meal.

Experimental Procedure and Sample Collection

A total of 72 crossbred pigs [Duroc × (Landrace × Yorkshire)] with initial body weight (BW) of 8.44 ± 0.04 kg were weaned at an average age of 28 days and randomly allocated to three treatments (six replicate pens per treatment and four weaned pigs per pen) in a complete randomized experimental design. Pigs were fed a basal diet (negative control, NC), and basal diet supplemented with 1,445 mg zinc/kg of zinc oxide (positive control, PC) or basal diet with 3% FM replaced with HI. The nutritional composition of the basal diets met the requirements recommended by the National Research Council (20) and are shown in Table 2. An ultra-low volume sprayer (Yitaizheng 211) was used to evenly spray 6 × 108 CFU/mL ETEC K88 bacterial solution in a 60 m2 environment. The spray volume of the entire environment was 2 L at a constant flow rate. The pigsty was not cleaned and disinfected during the entire trial period. Environmental samples were collected on day 10 of the experiment from the leakage dung plate, water dispenser, and aisle in the pig house and stored in 10 mL preservation tubes. The number of E. coli was measured using eosin-methylene blue agar medium. The results showed that the number of E. coli on the leakage dung plate, water dispenser, and aisle, was 5.19 × 108 CFU/m2, 4.79 × 104 CFU/piece, and 1.78 × 108 CFU/m2, respectively. The experimental pigs had ad libitum access to water and assigned diet. When the feeding trial ended, 18 pigs (six per group) were euthanized by intravenous injection of sodium pentobarbital solution (40 mg/kg body weight) and segments of the middle jejunum and distal ileum were collected and fixed in 4% paraformaldehyde for intestinal morphology analysis. Segments of the middle jejunum and distal ileum, and colonic contents were snap-frozen in liquid N2 and stored at −80°C for further analysis.

Table 2

IngredientsNCPCHI
Corn28.4528.4526.55
Extruded corn10.0010.0010.00
Soybean flour processing14.0014.0014.00
Fermented soybean meal11.5011.5011.50
Soybean meal7.007.009.00
Fishmeal3.003.00–
Hermetia illucens larvae meal––3.00
Low protein whey powder15.0015.0015.00
Whey protein concentrate1.001.001.00
Soybean oil1.001.001.00
Sucrose3.003.003.00
CaHPO40.200.200.20
NaCl0.250.250.25
CaHPO40.600.600.85
Calcium citrate1.851.851.50
L-Lys·HCl0.550.550.55
DL-Met0.150.150.15
L-Thr0.200.200.20
L-Try0.050.050.05
L-Val0.100.100.10
Choline chloride0.200.200.20
TiO20.400.400.40
Premixa1.501.501.50
Total100.00100.00100.00
Nutrient levelsb
ME, MJ/kg14.3414.3414.35
CP21.0321.0720.98
EE5.895.686.64
SID Lys1.441.441.43
SID Met0.440.440.42
SID Thr0.850.850.85
SID Trp0.260.260.27
SID Val0.920.920.93
SID Ile0.760.760.76
Ca0.830.830.80
STTD P0.350.350.35
Total P0.600.570.54

Composition and nutrient levels of diets (as-fed basis, %).

a

The premix provided per kg of the diet: VA 12,400 IU, VD3 2,800 IU, VE 30 IU, VK 5 mg, VB1 3 mg, VB2 10 mg, niacin 40 mg, pantothenic acid 15 mg, folic acid 1 mg, VB6 8 mg, biotin 0.08 mg, VB12 40 μg, Fe(FeSO4·H2O)120 mg, Cu(CuSO4·5H2O) 16 mg, Mn(MnSO4·H2O) 70 mg, Zn(ZnSO4·H2O) 100 mg, I(CaI2O6) 0.7 mg, Se(Na2SeO3) 0.48 mg.

b

CP, EE, Ca, and TP were measured values, whereas the others were calculated values.

Bacterial Culture

The ETEC K88 used in this experiment was a strain preserved in our laboratory. ETEC K88 stored in glycerol medium at −80°C was resuscitated, poured into a 25 mL centrifuge tube, and sterilized Luria-Bertani medium was added and the tubes were cultured in an incubator at 37°C for 12 h. Thereafter, the entire liquid was poured into a conical bottle containing 1 L sterilized Luria-Bertani medium, placed in a shaker (250 rpm), and cultured at 37°C for 24 h. Thereafter, the concentration of ETEC K88 was determined using enzyme-labeling instrument, and the solution was sub-packaged at −20°C. Before use, 200 mL of the solution was diluted 10-fold with 0.9% normal saline.

Growth Performance and Diarrhea Incidence

To evaluate the growth performance of the pigs, the weaned pigs were fasted for 12 h and weighed at 08:00 on days 1, 15, and 29 of the experiment. The average daily gain (ADG), average daily feed intake (ADFI), and feed/gain ratio (F/G) were calculated at the end of the experiment. To determine the incidence and severity of diarrhea, the feces of the pigs were observed twice daily throughout the study and scored: 0, normal; 1, soft stool; 2, mild diarrhea; and 3, severe diarrhea, with a score ≥ 2 considered as diarrhea (21). The formula for calculating the diarrhea incidence and diarrhea index was: diarrhea incidence (%) = Σ (the number of pigs with diarrhea per pen × days of diarrhea)/(total number of pigs × number of experimental days) × 100; diarrhea index = Σ (diarrhea score × number of pigs scored for diarrhea × days of diarrhea score)/(total number of pigs × number of experimental days).

Histomorphological and Histological Analysis

Fixed jejunal and ileal segments were dehydrated, embedded in paraffin, cut into 5 μm thick slices, and stained with hematoxylin and eosin (HE) staining. Another jejunal slice was stained with periodic acid-Schiff (PAS) as described previously (22). Subsequently, slides were scanned using Pannoramic DESK (3D Histech, Hungary), and all measurements were conducted using the associated Pannoramic Scanner software. A minimum of 10 straight and integrated villi and their associated crypts were measured in HE section images. The number of goblet cells and mucus layer thickness was measured in at least three microscopic fields (original magnification × 100) in the PAS section images.

RNA Isolation and Quantitative Real-Time PCR

Total RNA from the jejunum and ileum was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA purity and concentration were assessed using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA). Thereafter, 1 μg of RNA was reverse transcribed into cDNA using a PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Tokyo, Japan), according to the manufacturer's instructions. Quantitative real-time PCR was performed using a CFX Connect Detection System (Bio-Rad, Hercules, CA, USA). The reaction mixture (10 μL) comprised 5 μL iTaq Universal SYBR Green Supermix, 0.5 μL forward primer (10 μm), 0.5 μL reverse primer (10 μm) and 4 μL 10-fold diluted cDNA template. The target genes examined in this study and sequences for the target gene and housekeeping gene (β-actin) are listed in Table 3. The mRNA expression data of the target genes were calculated using the 2−ΔΔCt method, and target gene expression in the NC group was set at 1.0.

Table 3

GeneSequence (5′-3′)Size (bp)Accession number
IL-1βF: CTCCAGCCAGTCTTCATTGTTC
R: TGCCTGATGCTCTTGTTCCA
230NM214055.1
IL-6F: TGGCTACTGCCTTCCCTACC
R: CAGAGATTTTGCCGAGGATG
132NM_001252429.1
IL-8F: TTCGATGCCAGTGCATAAATA
R: CTGTACAACCTTCTGCACCCA
176NM_213867.1
IL-10F: GCTGAAGACCCTCAGGCTGA
R: TTGCTCTTGTTTTCACAGGGC
66HQ026020.1
TGF-βF: ACGTGGAGCTATACCAGAAATACAG
R: ACAACTCCGTGACATCAAAGG
111NM_214015.1
TNF-αF: CACGCTCTTCTGCCTACTGC
R: GTCCCTCGGCTTTGACATT
164NM_214022.1
ZO-1F: AGCCCGAGGCGTGTTT
R: GGTGGGAGGATGCTGTTG
147XM_013993251
OccludinF: GCACCCAGCAACGACAT
R: CATAGACAGAATCCGAATCAC
144XM_005672525
Claudin-1F: ACGGCCCAGGCCATCTAC
R: TGCCGGGTCCGGTAGATG
221AJ318102.1
MUC-1F: ACACCCATGGGCGCTATGT
R: GCCTGCAGAAACCTGCTCAT
68XM_021089730.1
MUC-2F: CTGCTCCGGGTCCTGTGGGA
R: CCCGCTGGCTGGTGCGATAC
100XM_007465997.1
pBD1F: TCCTTGTATTCCTCCTCA
R: ACACGCCTTTATTCCTTA
93NM_213838.1
pBD2F: CCAGAGGTCCGACCACTACA
R: GGTCCCTTCAATCCTGTTGAA
88AY506573.1
PG1-5F: GTAGGTTCTGCGTCTGTGTCG
R: CAAATCCTTCACCGTCTACCA
273XM_005669497.2
PR-39F: CAAGGCCACCTCCGTTTT
R: CCACTCCATCACCGTTTTCC
103NM_214450.1
NOD1F: ACCGATCCAGTGAGCAGATA
R: AAGTCCACCAGCTCCATGAT
140NM_001114277.1
NOD2F: CCTTTTGAAGATGCTGCCTG
R: GATTCTCTGCCCCATCGTAG
100NM_001105295.1
TLR2F: TCACTTGTCTAACTTATCATCCTCTTG
R: TCAGCGAAGGTGTCATTATTGC
162NM_213761.1
TLR4F: GCCATCGCTGCTAACATCATC
R: CTCATACTCAAAGATACACCATCGG
108NM_001113039.1
β-actinF: CACGCCATCCTGCGTCTGGA
R: AGCACCGTGTTGGCGTAGAG
380XM_003124280.4

Primers for the real-time PCR analysis.

TGF-β, transforming growth factor-β; ZO-1, zonula occludens-1; pBD, porcine beta defensin; PG1-5, protegrin 1-5; PR-39, proline-arginine rich 39; NOD, nucleotide-binding oligomerization domain; TLR, toll-like receptor.

ELISA

Approximately 100 mg of intestinal tissue sample was added to 900 μL of 0.86% normal saline, homogenized with a tissue homogenizer, and centrifuged at 3,500 × g at 4°C for 10 min; the supernatant was used to determine the level of secretory immunoglobulin A (sIgA) in the jejunum and ileum using a porcine ELISA kit (Jiancheng, Nanjing, China).

Western Blot

Approximately 100 mg of intestinal tissue sample was placed in 1 mL of RIPA buffer containing 1% protease inhibitor cocktail and 1% phosphatase inhibitor, left on ice for 30 min, and centrifuge at 10,000 × g for 5 min. The concentration of protein in the supernatant was determined using a BCA protein assay kit (Thermo Fisher Scientific, Wilmington, USA). Equivalent amounts of protein were diluted with 5 × loading buffer (Biosharp, Hefei, China) to the same amount of protein and denatured at 100°C for 8 min. Approximately 30 μg of protein was separated using 7.5 or 10% SDS-PAGE, transferred onto polyvinylidene fluoride membrane, blocked using 5% bovine serum albumin, incubated overnight at 4°C with the primary antibodies, followed by incubation for 1 h at room temperature with secondary antibodies. For phosphorylated proteins, the primary and secondary antibodies [(phosphorylated nuclear factor-κB (p-NF-κB), phosphorylated mitogen-activated protein kinase (p-MAPK)] from a western blot membrane were striped and then incubated with the antibodies (NF-κB, MAPK) for total protein detection. Primary antibodies against NF-κB p65, phosphorylated NF-κB p65, MUC-2, occludin, claudin 1, pH3s10, acH3k9, acH3k27, histone H3, HDAC3, HDAC7, and SIRT1 were purchased from Abcam; p38 mitogen-activated protein kinase (MAPK) and phosphorylated p38 MAPK were purchased from Cell Signaling Technology; zonula occludens-1 (ZO-1) was purchased from Thermo Fisher Scientific, and β-actin was purchased from Abcam. The blots were detected using Clarity Western ECL Substrate (Bio-Rad, Hercules, CA, USA). The protein band intensities were measured using ImageJ software (National Institutes of Health, MD, USA).

Microbial Composition Analysis

Total DNA was extracted from each sample of colonic content using the CTAB method, and the purity and yield were quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Wilmington, USA) and agarose gels. The V3-V4 regions of the 16S rRNA genes were amplified using the forward primer 341F (5′-CCTAYGGGRBGCASCAG-3′) and the reverse primer 806R (5′-GGACTACNNGGGTATCTAAT-3′). The PCR products were recovered and purified using the GeneJETTM Gel Extraction Kit (Thermo Fisher Scientific, Wilmington, USA). Validated libraries were sequenced on the NovaSeq6000 platform provided by Novogene (Beijing, China).

Determination of SCFA Concentrations

Gas chromatography-mass spectrometry (GC-MS) TRACE 1310-ISQ was used to measure the concentration of short-chain fatty acids (SCFAs) in colonic contents. Briefly, the colon contents were weighed and added to 50 μL of 15% phosphoric acid, 100 μL of 125 μg/mL internal standard, and 400 μL of ether. The supernatant was collected after centrifugation at 12,000 × g for 10 min at 4°C, and the concentration of SCFAs was measured using GC-MS analysis, as described previously (23).

Statistical Analysis

All experimental data were analyzed using SPSS software package (version 26.0; SPSS Inc., Chicago, IL, USA). Data obtained during the study were normalized using Shapiro-Wilk normality test. Data were analyzed using one-way ANOVA and differences among treatment groups were determined using Duncan's multiple range post-hoc test. All data were expressed as mean ± SEM, and statistical significance was set at p < 0.05.

Results

Effect of H. illucens on the Growth Performance and Diarrhea Incidence in Weaned Pigs

Compared with the NC group, there was an increase (p < 0.05) in the BW of pigs in HI and PC groups on day 14. From day 1 to 14 of the experiment, there was an increase in the ADG and ADFI of pigs in the HI and PC groups compared with those of pigs in the NC group (Table 4). From day 15 to 28 and day 1 to 28 of the experiment, there was an increase (p < 0.05) in the ADFI of pigs in the PC group compared with those of pigs in the NC group. The diarrhea incidence of the piglets during the experimental period is shown in Figure 1A. Compared with the NC group, there was a decrease (p < 0.05) in diarrhea incidence in pigs in the PC and HI groups during the three periods examined (days 1–14, 15–28, and 1–28). However, pigs in the PC group had lower diarrhea incidence (p < 0.05) compared with pigs in the HI group during the three periods (Table 4). Furthermore, there was a decrease (p < 0.05) in the diarrhea index of pigs in the PC and HI groups compared with those of pigs in the NC group during 1–14 days and 1–28 days of the study. However, pigs in the PC group had lower diarrhea index than those in the HI and NC groups during 15–28 days of the study.

Table 4

ItemsNCPCHISEMp-value
Day 1 BW, kg8.428.428.470.040.892
Day 14 BW, kg11.76b12.81a12.61a0.180.026
Day 28 BW, kg20.6122.6821.980.450.161
Days 1–14
ADG, g238.81b313.81a295.47a12.100.019
ADFI, g341.99b428.89a402.42a13.890.021
G/F0.700.740.730.020.634
Diarrhea incidence, %28.17a1.98c15.48b2.95<0.01
Diarrhea index0.76a0.13c0.57b0.07<0.01
Days 15–28
ADG, g631.55704.52669.7622.240.433
ADFI, g852.32b1,046.32a905.32ab38.030.092
G/F0.750.680.750.020.328
Diarrhea incidence, %32.76a2.30c20.11b3.55<0.01
Diarrhea index1.24a0.04b1.17a0.14<0.01
Days 1–28
ADG, g435.18509.17482.6215.760.153
ADFI, g597.16b737.60a653.87ab22.940.031
G/F0.740.700.740.020.600
Diarrhea incidence, %30.47a2.14c17.80b3.09<0.01
Diarrhea index1.00a0.08c0.87b0.10<0.01

Effects of dietary Hermetia illucens larvae meal on growth performance and diarrhea incidence in weaned pigs.

n = 6 replicates per treatment.

NC, basal diet; PC, basal diet supplemented with 1,445 mg zinc/kg of zinc oxide; HI, 100% replacement of FM in basal diet with H. illucens larvae meal.

a, b

Mean values with different superscript letters across rows are significantly different (p < 0.05).

Figure 1

Effect of HI on the Intestinal Morphology of Weaned Pigs

Compared with the NC and PC groups, there was an increase (p < 0.05) in jejunal villi height and ratio of villus height to crypt depth (V/C) of pigs in the HI treatment group. Additionally, compared with the NC group, there was a decrease (p < 0.05) in the jejunal crypt depth of pigs in HI group (Table 5; Figure 1B).

Table 5

ItemsNCPCHISEMp-value
Jejunum
Villi height/μm488.43b470.82b567.03a16.380.027
Crypt depth/μm267.09a247.50ab217.53b8.490.045
Ratio of villi height to crypt depth1.88b1.90b2.62a0.110.003
Ileum
Villi height/μm385.69371.31381.6215.520.935
Crypt depth/μm187.79179.72189.167.620.875
Ratio of villi height to crypt depth2.102.122.050.100.969

Effect of dietary Hermetia illucens larvae on intestinal morphology in weaned pigs.

n = 6 replicates per treatment.

NC, basal diet; PC, basal diet supplemented with 1,445 mg zinc/kg of zinc oxide; HI, 100% replacement of FM in basal diet with H. illucens larvae meal.

a, b

Mean values with different superscript letters across rows are significantly different (p < 0.05).

Effect of H. illucens on the Expression of TJ Protein in the Intestines of Weaned Pigs

Compared with the NC group, there was an increase (p < 0.05) in claudin-1 expression in the jejunum of pigs in the HI group (Figure 1C). In addition, there was an increase (p < 0.05) in occludin expression in the ileum of pigs in the HI group compared with those of pigs in the NC and PC groups. Furthermore, compared with the NC group, there was an increase (p < 0.05) in occludin protein expression in the ileum of pigs in the HI and PC groups. Moreover, there was an increase (p < 0.05) in claudin-1 protein expression in the ileum of pigs in HI group compared with those of pigs in the PC and NC groups (Figures 1D,E).

Effect of H. illucens on the Expression of Mucins in the Intestines of Weaned Pigs

Compared with the NC group, there was an increase (p < 0.05) in the number of goblet cells in the jejunum of pigs in the HI group (Figures 2A,B). In addition, there was an increase (p < 0.01) in mucus layer thickness of the jejunum of pigs in the HI group compared with that of pigs in the NC and PC groups. However, the mucus layer thickness of the jejunum of pigs in the PC group was higher (p < 0.05) than those of pigs in the NC group (Figure 2C). Based on the changes in the number of goblet cells and mucus layer thickness of the jejunum, the expression profiles of MUC-1 and MUC-2 in the jejunum and ileum were examined. Compared with the NC and PC groups, there was an increase in MUC-1 expression in the jejunum (p < 0.01) and ileum (p < 0.05) of pigs in the HI group (Figure 2D). Similarly, there was an increase (p < 0.05) in MUC-2 expression in the ileum of pigs in the HI group compared with those of pigs in the PC and NC groups. Furthermore, western blot analysis showed there was an increase (p < 0.05) in the expression of MUC-2 protein in the ileum of pigs in the HI group compared with those of pigs in the NC group (Figures 2E,F).

Figure 2

Effect of H. illucens on the Intestinal Immunity in Weaned Pigs

Regarding intestinal immunity, there was a decrease (p < 0.05) in interleukin-1β (IL-1β) expression in the jejunum and IL-8 expression in the ileum, and an increase (p < 0.05) in transforming growth factor-β (TGF-β) expression in the ileum of pigs in the PC and HI groups compared with those of pigs in the NC group (Figures 3A,B). Additionally, there was a decrease (p < 0.05) in IL-1β expression and an increase (p < 0.05) in IL-10 expression in the ileum of pigs in the HI group compared with those of pigs in the NC group. Furthermore, there was an increase (p < 0.01) in porcine β-defensin 1 (pBD1) expression in the jejunum and ileum, and an increase (p < 0.01) in pBD2 expression in the ileum of pigs in the HI group compared with those of pigs in the NC and PC groups (Figure 3C). Compared with the NC group, there was an increase (p < 0.01) in protegrin 1-5 (PG1-5) expression in the jejunum of pigs in the PC and HI groups. Moreover, there was an increase (p < 0.05) in PG1-5 expression and sIgA concentration in the ileum of pigs in the HI compared with those of pigs in the NC group (Figure 3D).

Figure 3

Effect of H. illucens on the TLR2-NF-κB/MAPK Signaling Pathway and Histone Acetylation Modification in the Intestine of Weaned Pigs

To explore the possible mechanisms of HI in immune responses, changes in histone acetylation modification, and the expression of nucleotide-binding oligomerization domains (NODs), toll-like receptor (TLR), NF-κB, and MAPK in the ileum, were examined. Compared with the NC and PC groups, there was an increase (p < 0.05) in NOD1 expression and a decrease (p < 0.05) in TLR2 protein expression in the ileum of pigs in the HI group (Figures 4A–D). Additionally, there was a decrease (p < 0.05) in p-NF-κB/NF-κB and p-MAPK/MAPK ratio and an increase (p < 0.05) SIRT1 protein expression in the ileum of pigs in the HI and PC groups compared with those of pigs in the NC group. Moreover, there was an increase (p < 0.05) in HDAC3 protein expression in the ileum of pigs in the PC group compared with those of pigs in the HI and NC groups (Figures 4E,F). Compared with the HI and NC groups, there was an increase (p < 0.05) in acH3k9 protein expression in the ileum of pigs in the PC group. Additionally, there was an increase (p < 0.05) in acH3k27 protein expression in the ileum of pigs in the HI group compared with those of pigs in the PC and NC groups (Figures 4E,G).

Figure 4

Effect of H. illucens on the Colon Microbiota and SCFAs of Weaned Pigs

The microbial composition of the colonic digesta in response to HI treatment was determined using 16S rRNA Illumina MiSeq sequencing. Figure 5A shows the distributions of common and specific OTUs among the three groups. At the phylum level, Firmicutes, Bacteroidetes, and Proteobacteria were the three most abundant bacteria in all groups (Figure 5B). Compared with the NC and HI group, there was a decrease (p < 0.05) in Chao1 and ACE indices of the colonic content of pigs in the PC group. Additionally, there was a decrease (p < 0.05) in the Shannon's index of the colonic content of pigs in the PC group compared with those of pigs in the HI group (Figure 5C). As shown in the NMDS plot (Figure 5D), samples from the PC group formed a distinct cluster from those of the other groups. A phenetic tree of the three groups was constructed based on unweighted unifrac distance using UPGMA clustering method (Figure 5E). Furthermore, LEFSe analysis identified statistically different bacteria between the three groups (Figure 5F). Petostreptococcales Tissierellales, Peptostreptococcaceae, and Terrisporobacter were more abundant in the NC group, whereas Muribaculaceae, Bacteroidaceae, Bacteroides, and Coprococcus were more abundant in the PC group. Oscillospirales, Subooligranulum, Alloprevotella, Agathobacter, Lactobacillus reuteri, Faecalibacterium prausnitzii, and Prevotella were more abundant in the HI group. The relative abundance of different genera at the genus level is shown in Figure 6A. Furthermore, univariate statistical analysis indicated an increase (p < 0.05) in the abundance of Muribaculaceae and Bacteroidaceae and a decrease (p < 0.05) in the abundance of Agathobacter in the colonic content of pigs in the PC group compared with those of pigs in the NC and HI group (Figure 6B). Compared to the NC group, there was a decrease (p < 0.05) in the abundance of Terrisporobacter in the colonic content of pigs in the HI and PC groups. In addition, there was an increase (p < 0.05) in the abundance of Ruminococcus and Faecalibacterium prausnitzii, and Alloprevotella and Lactobacillus reuteri in the colonic content of pigs in the HI group compared with those of pigs in the PC group, and NC and PC groups, respectively.

Figure 5

Figure 6

Regarding SCFAs, there was a decrease (p < 0.05) in the concentration of butyrate and butyrate/acetate ratio in pigs in the PC group compared with those of pigs in the NC and HI groups (Figure 6C). There was also an increase in the valerate concentration and valerate/propionate ratio in pigs in the HI group compared with those of pigs in the PC group, and NC and PC groups, respectively.

Correlation Analysis Between Dominant Bacteria, SCFAs, Barrier Function Factor, and Immune Factor

Spearman's correlation analysis was performed to determine whether there was any relationship between microbial species, SCFAs, and expression levels of barrier function factor and immunomodulatory factors. As shown in Figure 7A, butyrate and valerate were positively correlated (p < 0.05) with Alloprevotella, Agathobacter, Faecalibacterium prausnitzii, and Lactobacillus reuteri, but negatively correlated (p < 0.05) with Muribaculaceae and Bacteroidaceae. Moreover, Muribaculaceae was negatively correlated (p < 0.05) with claudin1 and sIgA; Bacteroidaceae was negatively correlated (p < 0.05) with V/C, claudin1, and NOD1; and Terrisporobacter was negatively correlated (P < 0.05) with V/C and pBD1. Conversely, Agathobacter was positively (p < 0.05) correlated with V/C, claudin1, MUC-2; Faecalibacterium prausnitzii was positively (p < 0.05) correlated with V/C, claudin1, IL-1β, pBD2, PG1-5, and sIgA; and Lactobacillus reuteri was positively (p < 0.05) correlated with V/C, claudin1, MUC-2, pBD1, and NOD1. Additionally, Ruminococcus and Alloprevotella were positively (P < 0.05) correlated with MUC-2, but negatively correlated (P < 0.05) with TLR2 (Figure 7B). NOD1 was positively correlated (p < 0.05) with IL-10, TGF-β, pBD1, pBD2, and PG1-5; SIRT1 was positively correlated (p < 0.05) with TGF-β and PG1-5; and acH3k27 was positively correlated (p < 0.05) with pBD1, pBD2, and PG1-5. In contrast, p-MAPK/MAPK was negatively correlated (p < 0.05) with IL-10, pBD1, pBD2 and p-NF-κB/NF-κB was negatively correlated (p < 0.05) with pBD1, pBD2, and PG1-5. HDAC3 was positively correlated (p < 0.05) with IL-8, but negatively correlated (p < 0.05) with pBD1 (Figure 7C).

Figure 7

Discussion

Early weaning (3–4 weeks) can cause nutritional and environmental stress in piglets, which can lead to impaired gut function, reduced immunity, inefficient feed utilization, and retarded growth (24). Optimal intestinal barrier function is essential for nutrient absorption and delivery. This study showed that 100% replacement of FM with HI significantly improved the growth performance and reduced the diarrhea incidence of weaned pigs. Moreover, HI addition improved the intestinal barrier function by regulating goblet cell population, mucin production, expression of TJ proteins and AMPs, cytokine levels, and intestinal microbiota (Figure 8). Furthermore, the findings of this study showed that HI regulated the expression of intestinal cytokines through the TLR2-NF-κB/MAKP signaling pathway and promoted histone acetylation modification by increasing SIRT1 expression and decreasing HDAC3 expression, regulating the expression of AMPs. These positive results suggest that HI could be used as a protein source in pig nutrition.

Figure 8

Over the last few decades, studies have shown that diets high in zinc oxide (1,000–3,000 mg zinc/kg) can reduce the incidence of diarrhea and improve the growth performance of weaned pigs (25, 26). Similarly, this study showed that dietary supplementation with 1,445 mg zinc/kg zinc oxide increased the ADFI and ADG of weaned pigs during day 1–14 of the study. However, zinc oxide use is gradually decreasing because of its negative effects on animals and the environment. Previous studies have shown that the addition of HI in diets at appropriate levels can improve the growth performance of Chinese soft-shelled turtles, chickens, and fattening pigs (6–8). A recent study showed that feeding small amounts of live H. illucens larvae had no adverse effect on the growth performance of weaned pigs (27). Surprisingly, the pigs that were fed HI-supplemented diet showed increased ADG and ADFI from day 1 to 14, similar to those that were fed zinc oxide-supplemented diets. In addition, feeding HI-supplemented diet reduced diarrhea incidence from 28.17–32.76% in the control group to 15.48–20.11%; however, pigs fed a zinc oxide-supplemented diet had the lowest diarrhea incidence rate (1.98–2.30%). These findings indicated that HI improved the growth performance of weaned pigs in the first 2 weeks post-weaning and reduced the diarrhea incidence in weaned pigs during the experimental period.

Furthermore, the effect of HI on parameters and genes involved in intestinal health, such as goblet cells, MUC-1, MUC-2, and several intestinal immunity-related genes, was examined in this study. The primary function of intestinal goblet cells is to form and secrete mucus, which plays an important role in protecting the intestinal epithelial barrier from pathogen invasion (28). Among other physiological effects, ETEC K88 can cause damage to the mucus layer of the intestinal mucosa. However, this study showed that feeding HI-supplemented diet protected the pigs against ETEC K88 strain by increasing the mucus layer thickness and goblet cells. Moreover, there was an increase in the expression of MUC-1 and MUC-2 in the intestine of pigs fed HI-supplemented diet, thus validating the increase in mucus layer thickness of these pigs, and this improvement is better than zinc oxide-supplemented diets. MUC-2 plays an essential role in the tissue mucus layer and in mucosal repair (29). Previous studies have shown that 4% addition of HI increased MUC-1 expression in the intestines of fattening pigs and weaned pigs (11, 14). These data suggest that HI improved intestinal barrier function through regulating mucin protein production in the intestine.

TJ proteins are involved in the integrity of tight junction structures by binding to the cellular skeleton and are thought to be essential regulators of paracellular permeability (30). Previous studies have shown that ETEC K88 can reduce the expression of TJ proteins and cause intestinal barrier dysfunction (31). In this study, feeding HI-supplemented diet improved the intestinal morphology of weaned pigs at 28 days after weaning. Moreover, addition of HI increased claudin-1 expression in the jejunum and occludin expression in the ileum, which was higher than the expression levels in pigs fed zinc oxide-supplemented diets. A previous study reported that 4% addition of HI enhanced ZO-1, occludin, and claudin-2 expression in the ileum of weaned pigs (14). However, the expression of ZO-1 contradicted the results of the present study, which could be attributed to the differences in study environment, such as the presence of ETEC K88. Overall, feeding HI-supplemented diets improved jejunum morphology and the expression of TJ protein, which improved intestinal epithelial barrier function in weaned pigs.

Cytokines play essential roles in the integrity of the intestinal barrier. Pro-inflammatory cytokines often disrupt TJs, whereas anti-inflammatory cytokines protect the epithelial barrier function (32). Improved growth performance and reduced diarrhea incidence have been linked to improved immune function in weaned pigs. This study showed HI addition in the diets of piglets caused a decrease in the expression of IL-1β and IL-8, and an increase in IL-10 and TGF-β expression in the intestine, similar to those fed zinc oxide-supplemented diets. Recent studies have shown that feeding diets containing 2 or 4% HI can decrease TNF-α and IFN-γ expression and increase IL-10 expression in the intestinal mucosa of weaned pigs or fattening pigs (11, 14). These findings suggest that HI improved growth performance and reduced diarrhea incidence by improving intestinal immunity and barrier function.

As an important component of specific immune response, antibacterial proteins are the first line of defense against intestinal toxins and pathogenic microorganisms (33). This study showed there was an increase in ileal sIgA secretion but not jejunal secretion in pigs fed diet containing HI. We speculate this may be because a certain component of HI accumulates in the terminal ileum and exerts a strong stimulating effect. Studies have established that insects are one of the major sources of AMPs (34). Previous studies have reported that AMPs can alleviate epithelial barrier damage in the intestinal epithelial cells of diarrheic weaned pigs and infected pigs (22, 35). However, whether feeding HI-supplemented diet can promote the secretion of AMPs in the intestinal mucosa of weaned pigs has not been examined. This study showed HI-supplemented diets increased the expression of pBD1, pBD2, and PG1-5 in the intestine, and zinc oxide-supplemented diets increased the expression of PG1-5 in the intestine. Overall, this study showed that HI improved the intestinal immune barrier function in weaned pigs by regulating sIgA secretion, and the expression of cytokines and AMPs, and the improvement is better than that seen in zinc oxide-supplemented diets.

The regulatory mechanism of intestinal immunity is complex and involves multiple signaling pathways. TLRs are innate immune receptors that recognize conserved microbial structures and host alarm proteins and are involved in regulating inflammatory responses (36, 37). NOD1 and NOD2 rely on well-orchestrated downstream signaling networks that involve the MAPK and NF-κB pathways for regulating host defense and tissue homeostasis. The NF-κB and MAPK signaling pathways are two classical pathways associated with immune regulation and play important roles in processes such as inflammation and cell survival (38, 39). Notably, the present study showed a HI-supplemented diet inhibited the TLR2-NF-κB/MAPK signaling pathway and increased NOD1 expression. A zinc oxide-supplemented diet also inhibited NF-κB/MAPK activation. Next, we investigated the mechanisms by which HI induced AMPs expression. Histone acetylation opens the chromatin structure and facilitates the binding of transcription factors to transcription sites to promote gene transcriptional expression. The elevated levels of acetylated histone H3 lysine 27 (acH3k27), acetylated histone H3 lysine 56 (acH3k56), and pH3s10 in the promoter region are typical markers of transcriptional activation of AMPs. Inhibition of HDAC regulates the modification mode of histone H3 (acH3k9, acH3k27, pH3s10, etc.) in the promoter region of AMPs, which specifically increases the expression of intestinal AMPs and enhances their ability to combat bacterial infections (15–17, 40). Sirtuins are members of HDAC (40). Recent studies have shown that SIRT1 plays an important role in maintaining intestinal mucosal barrier integrity (41, 42). However, SIRT1 and HDAC interact to regulate the expression of intestinal AMPs (43, 44). In addition, SIRT1 inhibits the activation of the NF-κB/MAPK signaling pathway and participates in immune regulation (40, 45). This study showed that HI-supplemented diets increased the level of acH3k27 in the promoter region, and zinc oxide-supplemented diets increased the level of acH3k9 in the promoter region. These data suggest that the increase in intestinal AMP expression in pigs fed HI-supplemented diet was associated with increased levels of SIRT1 and acH3k27, but zinc oxide-supplemented diets were associated with increased levels of SIRT1 and acH3k9. Overall, feeding HI-supplemented diet inhibited the activation of the TLR2-NF-κB/MAPK pathway and promoted histone acetylation modification, enhancing the intestinal immune regulation in weaned pigs.

Epithelial barrier impairment and immune disturbances are usually associated with disruption of the host gut microbial composition during pathogenic infection (22). This study showed that feeding HI-supplemented diet did not significantly influence intestinal microbiota diversity. However, there was an increase in the relative abundance of some species, such as Lactobacillus reuteri in the intestines of pigs fed HI-supplemented diet. Our previous studies found that Lactobacillus reuteri promoted the metabolism of intestinal amino acids and improved the intestinal barrier function in weaned pigs (46, 47). Additionally, there was an increase in the relative abundance of Alloprevotella, Ruminococcus, Agathobacter, and Faecalibacterium prausnitzii in the colon of pigs fed HI-supplemented diets. Notably, Ruminococcus and Faecalibacterium prausnitzii are important butyrate-producing bacteria (48–50). In the present study, there was a decrease in the abundance of Terrisporobacter, which is an emerging anaerobic pathogen (51), in the colon of pigs fed HI-supplemented diets. Regulating the intestinal microbiota by HI may be related to its high AMP and fatty acid content. Insect AMPs have broad-spectrum antimicrobial properties, and lauric acid (C12:0) is particularly effective for the inhibition of gram-positive bacteria (5).

SCFAs have several beneficial effects on the dynamic balance of the colon by promoting energy metabolism of epithelial cells and stimulating immune development (49, 52). SCFAs provide energy and can lower intestinal pH and inhibit the proliferation of pathogenic bacteria (53). Previous studies have shown that butyrate is a major source of energy for colonic epithelial cells and has anti-inflammatory effects (54). In this study, there was an increase in butyrate to propionate ratio in the colon of pigs fed HI-supplemented diets. These results indicate that HI-supplemented diets had no negative effects on intestinal microbiota and their metabolic activities, which was contrary to observations in pigs in the PC group. Moreover, correlation analysis revealed that Lactobacillus reuteri, which was high in pigs fed HI-supplemented diets, showed a strong positive correlation with butyrate and valerate, but strong negative correlation with Muribaculaceae and Bacteroidaceae. These results suggest that Lactobacillus reuteri, Muribaculaceae, and Bacteroidaceae may have a regulatory effect on SCFA production and intestinal barrier function.

In this study, Lactobacillus reuteri was positively correlated with SCFAs (butyrate and valerate), and intestinal barrier function factors, including NOD1, but negatively correlated with TLR2. However, Muribaculaceae and Bacteroidaceae had the opposite relationship with SCFAs, intestinal barrier function factors, and TLR2. We speculated that Lactobacillus reuteri, and SCFAs may improve the intestinal barrier function of weaned pigs by mediating TLR2 and NOD1, whereas Muribaculaceae and Bacteroidaceae may inhibit this pathway, but the potential mechanism needs to be further studied. Additionally, TLR2, p-MAPK/MAPK, and P-NF-KB/NF-κB were negatively correlated with the expression of AMPs, IL-10, and TGF-β; whereas NOD1, SIRT1, and acH3k27 were positively correlated with IL-10, TGF-β, and AMPs. This suggests there may be an interaction between cytokines regulated by the TLR2-NF-κB/MAPK pathway and the expression of AMPs regulated by SIRT1 and HDAC3, but further studies are needed to clarify the potential mechanism.

Conclusion

A 100% replacement of FM with HI improved the growth performance of weaned pigs in the first 2 weeks after weaning and reduced the incidence of diarrhea after weaning in the environment of ETEC K88. Moreover, dietary HI improved intestinal barrier function and microflora. Additionally, HI-supplemented diet improved intestinal immune homeostasis by promoting histone acetylation and inhibiting the activation of the TLR2-NF-κB/MAPK signaling pathway in weaned pigs.

Funding

This study was funded by the China Agriculture Research System of MOF and MARA, the Outstanding Talents Training Program of Guangdong Academy of Agricultural Sciences (R2018PY-JC001), a special fund for scientific innovation strategy construction of the high-level Academy of Agriculture Science (R2016YJ-YB2003, R2019PY-QF005, R2018QD-068), the project of swine innovation team in Guangdong Modern Agricultural Research System (2021KJ126), and Independent Research and Development Projects of Maoming Laboratory (2021ZZ003).

Publisher's Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/, PRJNA782794.

Ethics statement

The experiments were conducted in accordance with the Chinese guidelines for animal welfare and experimental protocols, and all animal experimental procedures were approved by the Animal Care and Use Committee of Guangdong Academy of Agricultural Sciences (Guangzhou, China). Permit Number: GAASIAS-2020-039.

Author contributions

HY and LW designed the experiments. QT and EX drafted the manuscript and sample analysis. MX, ZW, SC, and SH conducted the experiments and data curation. QW, YX, FW, and GY verified the validity of experiment and checked the results. ZJ supervised the entire study. All authors have read and agreed to the published version of the manuscript.

Conflict of interest

FW and GY were employed by the company Guangzhou AnRuiJie Environmental Protection Technology Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fnut.2021.812011/full#supplementary-material

References

  • 1.

    VeldkampTBoschG. Insects: a protein-rich feed ingredient in pig and poultry diets. Anim Front. (2015) 5:45–50. 10.2527/af.2015-0019

  • 2.

    Barragan-FonsecaKDickeMvan LoonJ. Nutritional value of the black soldier fly (Hermetia illucens L.) and its suitability as animal feed - a review. J Insects as Food Feed. (2017) 3:105–20. 10.3920/JIFF2016.0055

  • 3.

    WangYShelomiM. Review of black soldier fly (Hermetia illucens) as animal feed and human food. Foods. (2017) 6:91. 10.3390/foods6100091

  • 4.

    ElhagOZhouDSongQSoomro AACaiMZhengLet al. Screening, expression, purification and functional characterization of novel antimicrobial peptide genes from Hermetia illucens (L.). PLoS ONE. (2017) 12:e169582. 10.1371/journal.pone.0169582

  • 5.

    SpranghersTMichielsJVrancxJOvynAEeckhoutMDe ClercqPet al. Gut antimicrobial effects and nutritional value of black soldier fly (Hermetia illucens L.) prepupae for weaned piglets. Anim Feed Sci Tech. (2018) 235:33–42. 10.1016/j.anifeedsci.2017.08.012

  • 6.

    LiMLiMWangGLiuCShangRChenYet al. Defatted black soldier fly (Hermetia illucens) larvae meal can partially replace fish meal in diets for adult Chinese soft-shelled turtles. Aquaculture. (2021) 541:736758. 10.1016/j.aquaculture.2021.736758

  • 7.

    DabbouSGaiFBiasatoICapucchio MTBiasibettiEDezzuttoDet al. Black soldier fly defatted meal as a dietary protein source for broiler chickens: effects on growth performance, blood traits, gut morphology and histological features. J Anim Sci Biotechno. (2018) 9:49. 10.1186/s40104-018-0266-9

  • 8.

    YuMLiZChenWRongTWangGLiJet al. Use of Hermetia illucens larvae as a dietary protein source: effects on growth performance, carcass traits, and meat quality in finishing pigs. Meat Sci. (2019) 158:107837. 10.1016/j.meatsci.2019.05.008

  • 9.

    HenderASiddik M ABHowiesonJFotedarR. Black soldier fly, Hermetia illucens as an alternative to fishmeal protein and fish oil: impact on growth, immune response, mucosal barrier status, and flesh quality of juvenile barramundi, lates calcarifer (Bloch, 1790). Biology. (2021) 10:505. 10.3390/biology10060505

  • 10.

    BiasatoIFerrocinoIDabbouSEvangelistaRGaiFGascoLet al. Black soldier fly and gut health in broiler chickens: insights into the relationship between cecal microbiota and intestinal mucin composition. J Anim Sci Biotechno. (2020) 11:11. 10.1186/s40104-019-0413-y

  • 11.

    YuMLiZChenWRongTWangGMaX. Hermetia illucens larvae as a potential dietary protein source altered the microbiota and modulated mucosal immune status in the colon of finishing pigs. J Anim Sci Biotechno. (2019) 10:50. 10.1186/s40104-019-0358-1

  • 12.

    HuybenDVidakovićAHallgren SWLangelandM. High-throughput sequencing of gut microbiota in rainbow trout (Oncorhynchus mykiss) fed larval and pre-pupae stages of black soldier fly (Hermetia illucens). Aquaculture. (2019) 500:485–91. 10.1016/j.aquaculture.2018.10.034

  • 13.

    BorrelliLCorettiLDipinetoLBoveraFMennaFChiariottiLet al. Insect-based diet, a promising nutritional source, modulates gut microbiota composition and SCFAs production in laying hens. Sci Rep. (2017) 7:16269. 10.1038/s41598-017-16560-6

  • 14.

    YuMLiZChenWWangGRongTLiuZet al. Hermetia illucens larvae as a fishmeal replacement alters intestinal specific bacterial populations and immune homeostasis in weanling piglets. J. Anim.Sci. (2020) 98:skz395. 10.1093/jas/skz395

  • 15.

    FischerNSechetEFriedmanRAmiotASobhaniINigroGet al. Histone deacetylase inhibition enhances antimicrobial peptide but not inflammatory cytokine expression upon bacterial challenge. Natl Acad Sci USA. (2016) 113:E2993–3001. 10.1073/pnas.1605997113

  • 16.

    SchulthessJPandeySCapitaniMRue-Albrecht KCArnoldIFranchiniFet al. The short chain fatty acid butyrate imprints an antimicrobial program in macrophages. Immunity. (2019) 50:432–45. 10.1016/j.immuni.2018.12.018

  • 17.

    XiongHGuoBGanZSongDLuZYiHet al. Butyrate upregulates endogenous host defense peptides to enhance disease resistance in piglets via histone deacetylase inhibition. Sci Rep. (2016) 6:27070. 10.1038/srep27070

  • 18.

    Guttman JALiYWickham MEDengWVogl AWFinlay BB. Attaching and effacing pathogen-induced tight junction disruption in vivo. Cell Microbiol. (2006) 8:634–45. 10.1111/j.1462-5822.2005.00656.x

  • 19.

    ChoiJWangLLiuSLuPZhaoXLiuHet al. Effects of a microencapsulated formula of organic acids and essential oils on nutrient absorption, immunity, gut barrier function, and abundance of enterotoxigenic Escherichia coli F4 in weaned piglets challenged with E. coli F4. J Anim Sci. (2020) 98:skaa259. 10.1093/jas/skaa259

  • 20.

    Nutrient Requirements of Swine. 12th revised ed. Washington, DC: The national Academies Press (2012).

  • 21.

    Bhandari SKXuBNyachoti CMGiesting DWKrause DO. Evaluation of alternatives to antibiotics using an Escherichia coli K88+ model of piglet diarrhea: effects on gut microbial ecology. J Anim Sci. (2008) 86:836–47. 10.2527/jas.2006-822

  • 22.

    YiHHuWChenSLuZWangY. Cathelicidin-WA improves intestinal epithelial barrier function and enhances host defense against enterohemorrhagic Escherichia coli O157:H7 infection. J Immunol. (2017) 198:1696–705. 10.4049/jimmunol.1601221

  • 23.

    SunJZengBChenZYanSHuangWSunBet al. Characterization of faecal microbial communities of dairy cows fed diets containing ensiled Moringa oleifera fodder. Sci Rep. (2017) 7:41403. 10.1038/srep41403

  • 24.

    SmithFClark JEOverman BLTozel CCHuang JHRivier J EFet al. Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am J Physiol Gastr L. (2010) 298:G352–63. 10.1152/ajpgi.00081.2009

  • 25.

    Heo JMOpapeju FOPluske JRKim JCHampson DJNyachoti CM. Gastrointestinal health and function in weaned pigs: a review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds. J Anim Physiol an N. (2013) 97:207–37. 10.1111/j.1439-0396.2012.01284.x

  • 26.

    SalesJ. Effects of pharmacological concentrations of dietary zinc oxide on growth of post-weaning pigs: a meta-analysis. Biol Trace Elem Res. (2013) 152:343–9. 10.1007/s12011-013-9638-3

  • 27.

    Ipema AFBokkers E AMGerrits W JJKempBBolhuis JE. Providing live black soldier fly larvae (Hermetia illucens) improves welfare while maintaining performance of piglets post-weaning. Sci Rep. (2021) 11:7371. 10.1038/s41598-021-86765-3

  • 28.

    Moughan PJRutherfurd SMBalanP. Chapter nine - kiwifruit, mucins, and the gut barrier. Adv Food Nutr Res. (2013) 68:169–85. 10.1016/B978-0-12-394294-4.00009-2

  • 29.

    Corfield APMyerscoughNLongmanRSylvesterPArulSPignatelliM. Mucins and mucosal protection in the gastrointestinal tract: new prospects for mucins in the pathology of gastrointestinal disease. Gut. (2000) 47:589–94. 10.1136/gut.47.4.589

  • 30.

    Harhaj NSAntonetti DA. Regulation of tight junctions and loss of barrier function in pathophysiology. Int J Biochem Cell Biol. (2004) 36:1206–37. 10.1016/j.biocel.2003.08.007

  • 31.

    WuYZhuCChenZChenZZhangWMaXet al. Protective effects of Lactobacillus plantarum on epithelial barrier disruption caused by enterotoxigenic Escherichia coli in intestinal porcine epithelial cells. Vet Immunol Immunop. (2016) 172:55–63. 10.1016/j.vetimm.2016.03.005

  • 32.

    Al-SadiRBoivinMMaT. Mechanism of cytokine modulation of epithelial tight junction barrier. Front Biosci. (2009) 14:2765–78. 10.2741/3413

  • 33.

    WittigBZeitzM. The gut as an organ of immunology. Int J Colorectal Dis. (2003) 18:181–7. 10.1007/s00384-002-0444-1

  • 34.

    YiHChowdhuryMHuangYYuX. Insect antimicrobial peptides and their applications. Appl Microbiol Biot. (2014) 98:5807–22. 10.1007/s00253-014-5792-6

  • 35.

    YiHZhangLGanZXiongHYuCDuHet al. High therapeutic efficacy of Cathelicidin-WA against postweaning diarrhea via inhibiting inflammation and enhancing epithelial barrier in the intestine. Sci Rep. (2016) 6:25679. 10.1038/srep25679

  • 36.

    CarioERosenberg IMBrandwein SLBeck PLReinecker HCPodolsky DK. Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors. J Immunol. (2000) 164:966–72. 10.4049/jimmunol.164.2.966

  • 37.

    LiTOginoSQian ZR. Toll-like receptor signaling in colorectal cancer: carcinogenesis to cancer therapy. World J Gastroentero. (2014) 20:17699–708. 10.3748/wjg.v20.i47.17699

  • 38.

    LeeYShinDKimJHongSChoiDKimYet al. Caffeic acid phenethyl ester-mediated Nrf2 activation and IkappaB kinase inhibition are involved in NFkappaB inhibitory effect: structural analysis for NFkappaB inhibition. Eur J Pharmacol. (2010) 643:21–8. 10.1016/j.ejphar.2010.06.016

  • 39.

    GehartHKumpfSIttnerARicciR. MAPK signalling in cellular metabolism: stress or wellness?EMBO Rep. (2010) 11:834–40. 10.1038/embor.2010.160

  • 40.

    KongPYuYWangLDouYZhangXCuiYet al. circ-Sirt1 controls NF-κB activation via sequence-specific interaction and enhancement of SIRT1 expression by binding to miR-132/212 in vascular smooth muscle cells. Nucleic Acids Res. (2019) 47:3580–93. 10.1093/nar/gkz141

  • 41.

    Wellman ASMetukuri MRKazganNXuXXuQRen N SXet al. Intestinal epithelial sirtuin 1 regulates intestinal inflammation during aging in mice by altering the intestinal microbiota. Gastroenterology. (2017) 153:772–86. 10.1053/j.gastro.2017.05.022

  • 42.

    IgarashiMGuarenteL. mTORC1 and SIRT1 cooperate to foster expansion of gut adult stem cells during calorie restriction. Cell. (2016) 166:436–50. 10.1016/j.cell.2016.05.044

  • 43.

    ParkKElias PMHupeMBorkowski AWGallo RLShinKet al. Resveratrol stimulates sphingosine-1-phosphate signaling of cathelicidin production. J Invest Dermatol. (2013) 133:1942–9. 10.1038/jid.2013.133

  • 44.

    ScutoAKirschbaumMBuettnerRKujawskiMCermak JMAtadjaPet al. SIRT1 activation enhances HDAC inhibition-mediated upregulation of GADD45G by repressing the binding of NF-κB/STAT3 complex to its promoter in malignant lymphoid cells. Cell Death Dis. (2013) 4:e635. 10.1038/cddis.2013.159

  • 45.

    XuFXuJXiongXDengY. Salidroside inhibits MAPK, NF-κB, and STAT3 pathways in psoriasis-associated oxidative stress via SIRT1 activation. Redox Rep. (2019) 24:70–4. 10.1080/13510002.2019.1658377

  • 46.

    YiHWangLXiongYWenXWangZYangXet al. Effects of Lactobacillus reuteri LR1 on the growth performance, intestinal morphology, and intestinal barrier function in weaned pigs. J Anim Sci. (2018) 96:2342–51. 10.1093/jas/sky129

  • 47.

    YiHYangGXiongYWuQXiaoHWenXet al. Integrated metabolomic and proteomics profiling reveals the promotion of Lactobacillus reuteri LR1 on amino acid metabolism in the gut-liver axis of weaned pigs. Food Funct. (2019) 1:7387–96. 10.1039/C9FO01781J

  • 48.

    Flint HJScott KPLouisPDuncan SH. The role of the gut microbiota in nutrition and health. Nat Rev Gastroenterol Hepatol. (2012) 9:577–89. 10.1038/nrgastro.2012.156

  • 49.

    HuaXZhuJYangTGuoMLiQChenJet al. The gut microbiota and associated metabolites are altered in sleep disorder of children with autism spectrum disorders. Front Psychiatry. (2020) 11:855. 10.3389/fpsyt.2020.00855

  • 50.

    LouisPScott KPDuncan SHFlint HJ. Understanding the effects of diet on bacterial metabolism in the large intestine. J Appl Microbiol. (2007) 102:1197–208. 10.1111/j.1365-2672.2007.03322.x

  • 51.

    Cheng MPDomingoMLévesqueSYansouni CP. A case report of a deep surgical site infection with Terrisporobacter glycolicus/T. Mayombei and review of the literature. BMC Infect Dis. (2016) 16:529. 10.1186/s12879-016-1865-8

  • 52.

    LouisPHold GLFlint HJ. The gut microbiota, bacterial metabolites and colorectal cancer. Nat Rev Microbiol. (2014) 12:661–72. 10.1038/nrmicro3344

  • 53.

    Kles KAChang EB. Short-chain fatty acids impact on intestinal adaptation, inflammation, carcinoma, and failure. Gastroenterology. (2006) 130:S100–5. 10.1053/j.gastro.2005.11.048

  • 54.

    TremaroliVBäckhedF. Functional interactions between the gut microbiota and host metabolism. Nature. (2012) 489:242–9. 10.1038/nature11552

Summary

Keywords

H. illucens, growth performance, intestinal barrier function, microbiota, weaned pigs, histone acetylation

Citation

Tang Q, Xu E, Wang Z, Xiao M, Cao S, Hu S, Wu Q, Xiong Y, Jiang Z, Wang F, Yang G, Wang L and Yi H (2022) Dietary Hermetia illucens Larvae Meal Improves Growth Performance and Intestinal Barrier Function of Weaned Pigs Under the Environment of Enterotoxigenic Escherichia coli K88. Front. Nutr. 8:812011. doi: 10.3389/fnut.2021.812011

Received

09 November 2021

Accepted

22 December 2021

Published

18 January 2022

Volume

8 - 2021

Edited by

Mingliang Jin, Zhejiang University, China

Reviewed by

Xihong Zhou, Institute of Subtropical Agriculture, Chinese Academy of Sciences (CAS), China; Guangtian Cao, China Jiliang University, China; Bing Yu, Sichuan Agricultural University, China; Xi Ma, China Agricultural University, China

Updates

Copyright

*Correspondence: Hongbo Yi Li Wang

†These authors have contributed equally to this work

This article was submitted to Nutrigenomics, a section of the journal Frontiers in Nutrition

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics