Abstract
Guard cells shrink in response to drought and abscisic acid (ABA), which is caused by efflux of ions that in turn reduces stomatal aperture and improves the plant’s ability to retain moisture. Cytosolic free calcium is an essential secondary messenger in guard cell ABA signaling, but the details of this regulatory pathway remain sketchy. Here, the calmodulin-like protein CML20, which has four EF-hand domains and calcium-binding activity in vitro, was found to be a negative regulator of ABA-induced stomatal movement in Arabidopsis. The guard cells of cml20 loss-of-function mutant plants were hypersensitive to both ABA-activated S-type anion currents, and ABA inhibited inward K+ currents than those of wild type. Additional, due to smaller stomatal aperture, cml20 showed less water loss from the leaves than wild type. These phenotypes of CML20 overexpressing plants contrasted with wild type in the opposite direction. In the cml20 mutant, the transcripts of stress responsive genes, such as MYB2, RAB18, ERD10, COR47, and RD29A were up-regulated in response to drought and ABA, while down-regulated of APX2 transcription and higher reactive oxygen species (ROS) accumulation. These observations support the CML20, a functional Ca2+ sensor, is a negative regulator in guard cell ABA signaling.
Introduction
Drought stress represents one of the most important constraints on crop productivity. Stomatal closure is a key early plant response to drought stress (Verslues et al., 2006), a process which is controlled by the turgor of the pair of guard cells surrounding each stoma (Kwak et al., 2008). Osmotically driven influx of water is required to expand the guard cell. Drought stress promotes the tissue content of the phytohormone abscisic acid (ABA), which acts as a prominent regulator of stomatal movement through its effect on ion channel activity (Schroeder et al., 2001). ABA inhibits the inward K+ channel and activates the anion channel (Schroeder et al., 1987; Pandey et al., 2007; Vahisalu et al., 2008; Li et al., 2014). The major transducer of ABA signaling is free calcium ion (Ca2+) concentration alterations in the cytoplasm (McAinsh et al., 1990, 1997). The supply of exogenous Ca2+ not only can induce stomatal closure but also can oscillate the concentration of cytosolic Ca2+ (McAinsh et al., 1995; Pei et al., 2000; Siegel et al., 2009). Certain stimuli that induce stomatal opening may also act to enhance the concentration of cytosolic Ca2+ (Kenichiro et al., 1992; Cousson and Vavasseur, 1998).
Drought stress (along with other abiotic stresses) alters the plant’s cellular redox balance, often promotes the accumulation of reactive oxygen species (ROS) (Rentel and Knight, 2004). The most prominent ROS is H2O2; its prolonged half-life and high permeability allow it to activate Ca2+ permeable channels (Rentel and Knight, 2004). As mentioned above, stomatal movements are also associated with guard cell calcium concentration changes (Pei et al., 2000; Thor and Peiter, 2014). Ca2+ is required for oxidative burst by activating NADPH oxidase (Xing et al., 1997) and for the activity of NAD kinase, which generates the NADP that subsequently used as a cofactor for NADPH oxidase (Karita et al., 2004; Turner et al., 2004). Many proteins involved in ROS signaling was regulated by Ca2+ signaling (Gong et al., 1997; Yang and Poovaiah, 2002; Takahashi et al., 2011; Ma et al., 2012; Wang et al., 2015). Both, Ca2+ and ROS serve as important signaling molecules in plants, are inter-regulated by feedback loops to keep their homeostasis in plant cells (Sierla et al., 2016).
Ca2+ plays important signaling roles in response to abiotic stress and many Ca2+ sensors are targets of Ca2+ in the signaling pathways, and kinds of Ca2+ sensors have been classified into four distinct groups, namely the calmodulins (CaMs), the CaM-like proteins (CMLs), the Ca2+ dependent protein kinase (CDPKs), and the calcineurin B-like proteins (CBLs). All of these proteins contain EF-hand motifs, which allow the binding of Ca2+ (David and Anthony, 2000; Oliver and Jorg, 2012). Transcriptomic analyses have shown that some CMLs members are induced by stress (McCormack et al., 2005). Previously reports have shown that CML9 (Tzahi et al., 1999; Helen and Marc, 2002; Hongtao et al., 2003; Fabienne et al., 2008), CML18, CaM15, and CML24 (Delk et al., 2005; Yamaguchi et al., 2005) are involved in abiotic stress signaling. The function of other CMLs, which represent the largest of these four protein families, remains unclear. To understand more details about the roles of CMLs in abiotic stress signaling, we have screened and found that the mutant cml20 is more tolerant to drought stress. As CML20 an expected Ca2+ sensor, we also analyzed its molecular roles in drought stress and ABA signaling pathway, especially in stomatal movement. CML20 like-proteins have been (a.k.a. CEN1) found to be present in the animal centrosome, where its role implicated in microtubule organization (Juliette et al., 2008). Here, we study the molecular role of CML20 in Arabidopsis in response to drought stress, and its contribution to stomatal movement, ROS production, and ion channel activity in response to ABA.
Materials and Methods
Plant Materials and Growth Conditions
Arabidopsis thaliana ecotype Columbia-0 (Col-0) and the T-DNA insertion mutant cml20 (SALK_079974c) generated in a Col-0 background were obtained from the ABRC1. The zygosity of the mutant individuals was validated by PCR using the cml20-specific primer pair cml20-LP/-RP and the T-DNA left border primer LBb1.32. The relevant primer sequences are given in Table 1. To grow plants, seeds were surface-sterilized by immersing in 75% v/v ethanol for 3 min, followed by 95% v/v ethanol for 1 min, then the ethanol was allowed to evaporate. The seeds were then plated on solidified (0.7% w/v agar) half strength Murashige and Skoog (1962) medium (1/2 MS) and held first for 2 days at 4°C and then kept in a growth chamber under long-day conditions (16 h light/8 h darkness, 22 ± 1/16 ± 4°C) with illumination by 100 μmol m-2s-1 light); the relative humidity was maintained at ∼70%.
Table 1
| Name | Forward (5′–3′) |
|---|---|
| cml20-LP | TAGATGATGATGTGCGCAGAG |
| cml20-RP | AGGGTTCCATGATTGAAGAAG |
| LBb1.3 | ATTTTGCCGATTTCGGAAC |
| CML20-HisF | GCCATATGATGTCGAGTATATACAGAAC |
| CML20-HisR | CCGCTCGAGTCACTTTGCCATCATGACTTTGAC |
| CaM7-HisF | GGAATTCCATATGATGGCGGATCAGCTAACCGAT |
| CaM7-HisR | CCGCTCGAGTCACTTTGCCATCATGACTTTGAC |
| CML20-OEF | GCTCTAGAATGTCGAGTATATACAGAAC |
| CML20-OER | GTGAGCTCCTAGTTACCACCATAAGC |
| CML20-PF | GTAAGCTTTCCGGAACAGGGTATGTA |
| CML20-PR | GAGGATCCATCTTCTACGAGTCCTCC |
| CML20-GFPF | GCGGATCCATGTCGAGTATATACAGAAC |
| CML20-GFPR | GAGTCGACGTTACCACCATAAGCAG |
| CML20-RTF | ATGTCGAGTATATACAGAA |
| CML20-RTR | CGTTACCACCATAAGCAG |
| ACTIN2-RTF | TCTTCTTCCGCTCTTTCTTTCC |
| ACTIN2-RTR | TCTTACAATTTCCCGCTCTGC |
| ACTIN2-QF | GGTAACATTGTGCTCAGTGGTGG |
| ACTIN2-QR | AACGACCTTAATCTTCATGCTGC |
| CML20-QF | CGCATGGCAAAGGACTTGGGT |
| CML20-QR | CCATCACGGTCTCGGTCTGCT |
| RAB18F | CGAATGGCATCCTTTCTCAATC |
| RAB18R | GTCACCGAGAGTGCGGATATG |
| COR47F | CTTGGCATTGGTGCAACTCC |
| COR47R | TCTTTCGTCTTGGCGTGTCA |
| MYB2F | TGCTCGTTGGAACCACATCG |
| MYB2R | ACCACCTATTGCCCCAAAGAGA |
| ERD10F | TCTCTGAACCAGAGTCGTTT |
| ERD10R | CTTCTTCTCACCGTCTTCAC |
| KIN1F | ACCAACAAGAATGCCTTCCA |
| KIN1R | CCGCATCCGATACACTCTTT |
| RD29F | TAATCGGAAGACACGACAGG |
| RD29R | GATGTTTAGGAAAGTAAAGGCTAG |
| KIN2F | ACCAACAAGAATGCCTTCCA |
| KIN2R | ACTGCCGCATCCGATATACT |
| APX2F | TGATGTGAAGACGAAGACAGGAGGAC |
| APX2R | CCCATCCGACCAAACACATCTCTTA |
| CML20-CF | GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTCGAGTATATACAG |
| CML20-CR | GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTTACCACCATAAGC |
Primer sequences employed.
Heterologous Expression of CML20 and Ca2+-Binding Assay
The coding region of CML20 (At3g50360) was amplified from Col-0 cDNA by using the primer pair CML20-HisF/-HisR (Table 1), while CaM7 (At3g43810) was amplified by using CaM7-HisF/-HisR (Table 1) as positive control. The amplicons and the prokaryotic expression vector pET30a (+) were both digested with NdeI and XhoI, and then ligated using T4 DNA ligase (TransGen Biotech, China). For heterologous expression of CML20, E. coli BL21 (DE3) transformants harboring recombinant plasmid CML20 were induced with 0.4 mM isopropyl β-D-1-thiogalactopyranoside (IPTG); the recombinant protein was thereafter purified using the Ni-NTA Purification System (Invitrogen, Uinted States). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) mobility shift assay for Ca2+ binding was performed by exposing denatured CML20 to either 15 mM CaCl2 or 15 mM ethylene glycol tetraacetic acid (EGTA), as described by Garrigos et al. (1991). The structure of CML20 was predicted using InterPro software3.
Construction of Plant Expression Vector and Generation of Transgenic Arabidopsis thaliana
To engineer plant expression vector for CML20 over-expression, the gene’s open reading frame was amplified using the primer pair CML20-OEF/-OER (Table 1), and the resulting amplicon was digested with XbaI and SacI, then ligated into the XbaI and SacI cloning sites of pSTART (+) which generated the p35S::CML20 construct. The CML20 open reading frame was amplified using the primer pair CML20-CF/-CR (Table 1) cloned into pDonor 221 vector and then introduced into pB2GW7.0 vector through gateway reaction (Invitrogen, United States) to generate pB2GW7.0-CML20. cml20 mutant plants were transformed with pB2GW7.0-CML20 to generate complemented lines, C-1 and C-2. The CML20 promoter sequence was amplified using the primer pair CML20-PF/-PR (Table 1), then ligated into the HindIII/BamHI cloning site of pCambia::UBI-GUS to generate the construct pCML20::GUS. All the constructs were transferred into Agrobacterium tumefaciens strain GV3101 and then introduced into Arabidopsis using the floral dip method (Clough and Bent, 1998). T1 transgenic seedlings were selected by growing on 1/2 MS containing 30 mg/L kanamycin (p35S::CML20 lines), or hygromycin (pCML20::GUS lines). The zygosity of T3 lines was deduced from the transgene’s segregation behavior, and the abundance of the transgene transcript was assessed by using PCR or quantitative real time PCR (qRT-PCR), and the selected seeds from T3 homozygous lines were used for further analysis.
Subcellular Localization of CML20
A p35S::CML20-GFP construct was generated by inserting the CML20 open reading frame (amplified using CML20-GFPF/-GFPR, see Table 1) into the BamHI/SalI cloning sites of a modified GFP expression vector (Lin et al., 2009). Both the p35S::CML20-GFP and the empty p35S::GFP plasmids were purified using a NucleoBond® Xtra Midi Kit4 (Macherey–Nagel) before introducing into Arabidopsis mesophyll protoplasts following Sheen (2001). After 16 h incubation at 23°C in the dark, protoplasts were examined for GFP signal using confocal laser scanning microscopy (performed at The Microscopy Characterization Facility, Shandong University).
GUS Staining
T3 homozygous transgenic plants harboring pCML20::GUS were assayed for GUS activity as described by Jefferson et al. (1987) with slight modification. Briefly, transgenic plant tissues were soaked in a GUS staining solution (2 mM X-Gluc, 2 mM K3Fe(CN)6, 2 mM K4Fe(CN)6, 0.1% Triton X-100, 10 mM EDTA in 50 mM sodium phosphate buffer, pH7.2) and incubated overnight at 37°C. After staining, the samples were washed in 50, 70, and 100% ethanol for 5 min consecutively, and then shook in 100% ethanol for about 5 h to remove chlorophyll. Subsequently, the samples were examined under an optical microscope.
Drought Stress and Water Loss Experiments
To apply drought stress, the protocol described by Sakamoto et al. (2004) was followed with minor modifications. Seedlings were grown under well-watered conditions for four weeks, and then deprived of water for 2–3 weeks. Then, the plants were re-watered for over three days and photographed. For water-loss assays, rosette leaves were collected from 4-week-old plants as test samples. The samples were weighed immediately on a piece of paper, and then placed on the laboratory bench (relative humidity: 40%–50%; 22°C–23°C). The weight lost by each sample at a set of pre-assigned time points was recorded.
Stomatal Movement
Arabidopsis thaliana plants were grown under a 10 h photoperiod (100 μmol m-2s-1 light), where the light and dark period temperatures were 22 and 20°C, respectively. The stomatal aperture assay was performed using fully expanded young leaves of 4-week-old plants. To characterize stomatal opening, detached rosette leaves were first floated adaxial side up for 2.5 h in the dark in 10 mM KCl, 7.5 mM iminodiacetic acid, 10 mM Mes-KOH (pH 6.15). Subsequently, either 50 μM ABA or solvent control (ethanol) was added, then the treated leaves were illuminated for 2.5 h. For the stomatal closure assay, initially leaves were floated in the solution containing 20 mM KCl, 1 mM CaCl2, 5 mM Mes-KOH (pH 6.15) for 2.5 h in the light, then either ABA (1, 10, or 50 μM) or solvent control (ethanol) was added. In both cases, abaxial epidermal strips were peeled off after 2.5 h incubation (with ABA/solvent control ethanol) and photographed immediately. Stomatal aperture widths were estimated from the captured digital images using ImageJ v1.475 software.
Electrophysiology
Arabidopsis thaliana guard cell protoplasts were isolated following the Zhang et al. (2008) method. K+ currents were recorded following Li et al. (2016) with slight modifications. The bath solution contained 4 mM MgCl2, 10 mM MES-Tris (pH 5.6), 1 mM CaCl2, 10 mM K-Glu, and the osmolarity was adjusted to 500 mOSM with sorbitol for measuring whole-cell channel K+ currents. The pipette solution contained 20 mM KCl, 10 mM HEPES-Tris (pH 7.8), and 80 mM K-Glu, and the osmolarity was adjusted to 550 mOSM, and also fresh ATP (5 mM Mg-ATP) was added before use. Axopatch-200B amplifier (Axon Instruments, United States) connected to a computer via an interface (TL-1 DMA Interface; Axon Instruments) was used to achieve whole-cell configuration, and the holding potential was set as –60 mV. The whole-cell currents were recorded 5 min later. The test voltage steps were from –200 mV to –40 mV with +20 mV increments, and each test voltage has 4.9-s duration. For the ABA treatment, 50 μM ABA was added to the bath solution after the whole-cell configuration was achieved. The whole-cell currents were recorded 10 min later. Guard cell anion currents were recorded as described by (Acharya et al., 2013). Briefly, the bath solutions contained 2 mM MgCl2, 30 mM CsCl, 10 mM MES-Tris (pH 5.6), and 1 mM CaCl2. The pipette solutions contained 150 mM CsCl, 2 mM MgCl2, 6.7 mM EDTA, 3.35 mM CaCl2, and 10 mM HEPES-Tris (pH 7.5). Osmolarity of the solutions was adjusted to 480 and 500 mOSM for bath and pipette solutions, respectively, with sorbitol. ATP (10 mM Mg-ATP) and GTP (10 mM) were added to the pipette solution before use. The holding potential was +30 mV. The voltage steps were applied from -145 to +35 mV with +30 mV increments, and each test voltage has a 60-s duration. For the ABA treatment, guard cell protoplasts were treated with 50 μM ABA for at least 1 h before recording.
RT-PCR and qRT-PCR
Total RNA was isolated using the TRIzol reagent (Roche, Switzerland), treated with RNase-free DNase I (Invitrogen, United States) and reverse transcribed using oligo-dT primers and SuperScriptTM III Reverse Transcriptase (Invitrogen, United States). The resulting cDNA was used as template in both RT- and qRT-PCRs. The former employed the CML20-specific primer pair CML20-RTF/-RTR (Table 1) and reference reactions were primed by ACTIN2-RTF/-RTR (Table 1), to amplify the gene ACTIN2 (At3g18780). For the qRT-PCRs, leaves and epidermal strips derived from four-week old plants were exposed to 50 μM ABA for 6 h. All reactions were performed in triplicates using FastStart Universal SYBR Green master mix (Roche, Switzerland), and ACTIN2 was used as the reference. The CML20-specific primer pair CML20-QF/-QR and the ACTIN2 pair ACTIN2-QF/-QR (Table 1) were used for the qRT-PCR assays. The abundance of transcript of a set of known stress-responsive genes was also assayed by qRT-PCR using cDNA synthesized from seedlings (two-week old) that were harvested 6 h after exposure to 50 μM ABA. The gene/primer pair combinations were RAB18 (At5g66400)/RAB18F/R, COR47 (At1g20440)/ COR47F/R, MYB2 (At2g47190)/MYB2F/R, ERD10 (At1g20450)/ERD10F/R, KIN1 (At5g15960)/KIN1F/R, RD29A (At5g52310)/RD29AF/R, KIN2 (At5g15970)/ KIN2F/R, and APX2 (At3g09640)/APX2F/R. All primer sequences are given in Table 1.
Fluorescent Imaging of ROS Production
Reactive oxygen species production in guard cells was detected by loading abaxial epidermal strips with H2DCF-DA (Zhang et al., 2011). Epidermal strips were peeled from detached leaves from plants, and floated in 10 mM KCl, 7.5 mM iminodiacetic acid, 10 mM Mes-KOH (pH 6.15) for 2 h to induce stomatal opening. Then, the epidermal strips were transferred to 10 mM Tris HCl, 50 mM KCl (pH 7.2) containing 50 mM H2DCF-DA, and held in the dark for 10 min. Unincorporated H2DCF-DA was removed by rinsing three times in double distilled water. The guard cells were then subjected to laser scanning confocal microscopy, and treated with either 50 μM ABA or solvent control before data collection. The fluorescence of H2DCF was captured by imaging at 2.5 min intervals over 25 min. ZEN software6 (2012, blue edition) was used to quantify the data. The change in fluorescence intensity at each time point was calculated in the form of a percentage of its initial intensity.
Results
CML20 Encodes a CAM-Like Protein with the Ability to Bind Ca2+
The predicted CML20 product was a CAM-like protein consisting of 169 aa residues. The structure of CML20, according to InterPro7, contains four EF-hand domains (Figure 1B), as seen in numerous Ca2+ binding proteins (Figure 1A) such as CAM2, CAM7 and CML9 (Fabienne et al., 2008; Garrigos et al., 1991; McCormack et al., 2005). The SDS-PAGE mobility shift assay revealed that CML20 migrated faster in the presence of free Ca2+ than in the presence of Ca2+ chelator EGTA (Figure 1C). Like CML20, we also observed similar result for CAM7 (Garrigos et al., 1991). Our findings suggested that CML20 could bind Ca2+in vitro and thus potentially acts as a Ca2+ sensor in plant.
FIGURE 1
Expression Profiling of CML20
As deduced from the sites of GUS production in transgenic plants harboring pCML20::GUS, expression of CML20 was observed in the root, leaf, inflorescence and silique (Figures 2A–G). CML20 expression was also induced in the guard cells of plants that were exposed to ABA (Figures 2F,G). qRT-PCR result also supported that CML20 was induced in response to ABA treatment in the leaf and epidermis, which contains a large number of guard cells (Figure 2H). All of these findings suggested the possible involvement of CML20 in the ABA-mediated regulation of stomatal movement. When mesophyll protoplasts were transformed with p35S::CML20-GFP, GFP signal was detected exclusively in the cytoplasm (Figure 2I), but mesophyll protoplasts transformed with p35S::GFP empty vector control showed GFP signal dispersed throughout the protoplast (Figure 2J). These findings indicate that CML20 is a cytosol-localized protein.
FIGURE 2
cml20 Mutant Plants Were Hypersensitive to ABA-Regulated Stomatal Movement and Show a Greater Tolerance to Drought Stress
Transcriptional analysis of the cml20 mutant (Figure 3A) was carried out using both RT- PCR and qRT-PCR which confirmed the absence of CML20 transcript (Figures 3B,C). Given that CML20 was clearly up-regulated by ABA in the guard cells, the response of cml20 guard cells was of interest to study its role in ABA signaling. Stomatal aperture was indistinguishable between the mutant and WT when plants were not treated with ABA, but in the presence of ABA (1, 10, or 50 μM), the mutant stomata showed smaller aperture than the WT (Figures 3D,E). The results indicated that cml20 stomata were hypersensitive to both ABA-promoted stomatal closure as well as the ABA-inhibited stomatal opening, and thus to minimize the water loss to increase the plant drought tolerance. This hypothesis was supported by the observed results of both the detached leaf assay and the whole plant response to drought stress as well (Figures 3F,G).
FIGURE 3
CML20 Over-Expression Reduces the Sensitivity of Stomatal Movement to ABA and Has a Negative Effect on Drought Stress Tolerance
qRT-PCR result revealed that CML20 over-expressing lines, OE-1 and -2 both produced more CML20 transcript than WT (Figure 4A). Stomatal movement in these lines was less affected by ABA than in the WT (Figures 4B,C). As predicted, the rate of water loss from detached leaves of the two OE lines was higher than WT leaves (Figure 4D), and the OE-1 and OE-2 plants were more sensitive to drought stress (Figure 4E). In addition, cml20/CML20 complementation lines (C-1 and C-2) showed similar phenotype for both ABA regulation of stomatal movement and drought stress resistance compared to WT (Supplementary Figure S1). These findings provided additional support that CML20 functions as a negative regulatory signaling component in response to both ABA and drought stress.
FIGURE 4
CML20 Is Involved in the ABA Regulation of Guard Cell Ion Channels
Stomatal closure relies on anion efflux via channels that are activated by ABA, which also simultaneously inhibits the influx of K+. The patch clamp assay was conducted to test whether ABA-modulated currents depended on CML20. Without ABA treatment, we did not observe any difference in either the K+ or the anion currents between WT, cml20 and the two OE lines. In contrast, in response to ABA treatment, the mutant’s guard cells showed hypersensitivity to ABA inhibition of K+ currents and ABA activation of anion currents, while the over-expression of CML20 impaired them both (Figures 5A–D). These results coincided with the performance of stomatal movement in response to ABA treatment. The conclusion was that CML20 functioned as a negative regulatory signaling component for ABA regulation of stomatal movement, partly via its regulatory effect on ion channels activity in guard cells.
FIGURE 5
Loss of Function of CML20 Affects the Transcription of Stress-Responsive Genes
Transcriptional (qRT-PCR) profiling showed that in cml20, certain ABA-inducible genes (ERD10, RAB18, COR47, and MYB2) were up-regulated by exposure to ABA for 6 h (Figure 6). The imposition of drought stress also induced the transcription of an ABA-independent gene RD29A in the cml20 mutant (Figure 6). The aforementioned genes are up-regulated in response to abiotic stresses also their transcript level could be correlated with sensitivity to a specific stress. These findings not only implicate that CML20 negatively regulates transcription of these above indicated genes but also suggest that CML20 is also a regulator of the ABA and drought stress signaling pathways.
FIGURE 6
ROS Production in cml20 Guard Cells Is Enhanced by Exposure to ABA
The ABA treatment resulted in a greater increase of ROS production in the guard cells of cml20 than in those of WT (Figures 7A,B). A qRT-PCR based assay of the transcription of a gene known to be involved in ROS elimination showed that APX2 (encoding an H2O2 scavenger) was down-regulated in cml20 whether or not the plants were exposed to ABA (Figure 7C). These above findings suggest that CML20 may play a positive role in guard cell ROS removal; in its absence, the down-regulation of APX2 could have compromised the plant’s ability to control the accumulation of ROS.
FIGURE 7
Discussion
As shown by the SDS-PAGE mobility shift assay (Figure 1), CML20 demonstrated an ability to bind Ca2+in vitro. Many Ca2+ sensors have been implicated as signaling components in the abiotic stress response. An example is the rice gene OsCaM1-1, which is induced by exposure to high temperature; its product enhances thermo tolerance when the gene is constitutively expressed in A. thaliana (Wu et al., 2012). Transcription factors such as AtCAMTA1, -A2 and -A3 are known to participate in response to low temperature stress (Kim et al., 2013). The product of AtCAMTA1 is also involved in the drought stress response (Pandey et al., 2013). Despite being one of the largest Ca2+ sensor families, few CMLs have been identified yet that participate in the abiotic stress response: these comprise the A. thaliana proteins CML9, 10, 18, 24, and 42, as well as the rice protein OsMSR and ShCML44 from Solanum habrochaites (Delk et al., 2005; Yamaguchi et al., 2005; Fabienne et al., 2008; Xu et al., 2011; Vadassery et al., 2012; Cho et al., 2015; Munir et al., 2016). Here, the current work demonstrated that AtCML20 is negatively involved in guard cell ABA signaling during plant drought response.
A consistent implication emerged from the present set of experiments was that CML20 acted as a negative regulator of ABA and drought stress responses in plants. Stomatal movement was more sensitive to the ABA treatment in the cml20 mutant than in the WT (Figure 3). In addition, OE lines with higher expression of CML20 showed less sensitivity to ABA-mediated stomatal movement, which might have caused OE plants to be lower ability of drought tolerant. In plants, stomatal closure represents an early response to drought stress, and aids for the maintenance of the plant’s internal osmotic environment (Verslues et al., 2006). Thus, the action of CML20 to inhibit stomatal movement has a negative effect on the plant’s tolerance to drought stress. Nevertheless, WT plants treated with ABA showed 100% increase of CML20 transcript (Figure 2H). A possibility is that the function of CML20 during an episode of drought stress is to enforce stomata to remain in a partial open state, a physiological condition that would allow the plant to exchange gas.
Interestingly, we further found that CML20 had roles in ABA regulating ion channels. The results from patch clamp assay indicated that both K+in channels and anion channels were influenced in loss-of-function mutant and OE lines in response to ABA (Figure 5). Some CDPKs, as Ca2+ sensors like CMLs, have been reported to regulate guard cell SLAC1 channel’s activity (Geiger et al., 2010). We also explored the molecular mechanism to define the function of CML20 in ABA signaling.
ABA is a critical regulator of the abiotic stress response, which acts via complex signaling networks. From the qRT-PCR analysis, it was obvious that the loss-of-function of CML20 affected the transcription of a number of ABA-inducible genes in mutant plants treated with ABA (Figure 6), which in turn may have been responsible for the mutant’s enhanced level of drought stress tolerance. By acting as a negative regulator, CML20 likely limits the extent of the responsiveness of these genes to ABA; it also negatively regulates the transcription of RD29A, a gene which responds to drought stress, in an ABA- independent manner (Yamaguchi-shinozaki and Shinozaki, 2006).
Fluorescent probes demonstrated that the cml20 mutant generated more ROS than WT under ABA treatment (Figures 7A,B), consistent with the negative role of CML20 in stomatal movements and drought response. ROS is generated by NADPH oxidases (Respiratory Burst Oxidase Homologs, RBOHs), and the enzyme AtRBOHD and AtRBOHF are mainly expressed in guard cells and could be up-regulated by ABA. In the ABA signal pathway, OST1 is released by ABA from PP2C to activate AtRBOHF through directly phosphorylation (Kwak et al., 2003; Sirichandra et al., 2009; Shang et al., 2016). In another way, the elimination of ROS is achieved by a range of antioxidants and enzymes. The gene APX2, which encodes a cytosolic ascorbate peroxidase (a ROS scavenger), had a lower expression level in cml20 than WT whether or not the plants were exposed to ABA (Figure 7C). A reduced presence of the ROS scavenging enzyme APX2 in ABA-treated cml20 mutant plants was predicted from the lowered abundance of APX transcript in cml20 compared to that in WT, may have allowed for a greater accumulation of ROS, which in turn could have enhanced the transduction of the ABA signal.
Meanwhile the prominent ROS species H2O2, which is induced by ABA in the guard cells, can activate Ca2+ channels and regulate stomatal movement (Pei et al., 2000; Mustilli et al., 2002), inversely, Ca2+ could also bind and activate RBOH for ROS generation (Ogasawara et al., 2008; Kimura et al., 2012). Both Ca2+ and ROS are important signal integrators in plants (Murata et al., 2015). Given its proven Ca2+ binding ability, CML20 may play roles both in Ca2+ and ROS signal pathways to regulate stomatal aperture in plants either exposed to exogenous ABA or subjected to drought stress.
The CML20 may serve as a fine regulator for cytosol ROS homeostasis in guard cell ABA signaling. Previous studies have demonstrated that the guard cell anion channels (SLAC1) and K+in channels are regulated by ROS (Köhler et al., 2003; Joo et al., 2005; Sierla et al., 2016), and the APX2 serves as a ROS scavenger to reduce ROS concentration in cytosol (Fryer et al., 2003). Here we show that, the cml20 mutants were with lower APX2 transcripts and higher ROS (Figure 7), so the CML20 may serve as opposite factor with ABA to avoid too much ROS accumulation, and to keep appropriate stomatal aperture under finely balanced control. In addition, CML20 could also be the negative regulator of ABA and drought via other plant abiotic stress responsive gene mediated pathways (Figure 8). Besides ROS, Ca2+ and ion channels, there may be other factors along with CML20 are involved in the signaling cascades that play critical roles in response to drought stress and ABA treatment. Follow-up research will attempt to identify the targets of CML20, so as to further elucidate the signaling pathways used by plants that are exposed to abiotic stress.
FIGURE 8
Statements
Author contributions
WZ designed the experiments; XW, CL, and ZQ performed the experiments with assistance from HL; WZ, XW, CL, ZQ, and BA analyzed and discussed the results; WZ, XW, CL, and ZQ wrote the manuscript.
Funding
This research was financially supported by the National Natural Science Foundation of China (31271506, 31500211), the key special project “Breeding and Cultivation of Novel GM varieties” (2014ZX08009-022B), the Program for New Century Excellent Talents in University (NCET-13-0354) and the Shandong Science Fund for Distinguished Young Scholars (2014JQE27047).
Acknowledgments
We thank the Arabidopsis Biological Resource Center (ABRC) for providing T-DNA insertion seeds SALK_079974c.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer GM and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review.
Supplementary material
The Supplementary Material for this article can be found online at: http://journal.frontiersin.org/article/10.3389/fpls.2017.00824/full#supplementary-material
Footnotes
2.^http://signal.salk.edu/tdnaprimers.2.html
3.^http://www.ebi.ac.uk/interpro/
6.^http://www.zeiss.com.cn/microscopy/zh_cn/downloads/zen.html
References
1
AcharyaB. R.JeonB. W.ZhangW.AssmannS. M. (2013). Open Stomata 1 (OST1) is limiting in abscisic acid responses of Arabidopsis guard cells.New phytol.2001049–1063. 10.1111/nph.12469
2
ChoK. M.NguyenH. T.KimS. Y.ShinJ. S.ChoD. H.HongS. B.et al (2015). CML10, a variant of calmodulin, modulates ascorbic acid synthesis.New Phytol.209664–678. 10.1111/nph.13612
3
CloughS. J.BentA. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J.16735–743. 10.1046/j.1365-313x.1998.00343.x
4
CoussonA.VavasseurA. (1998). Putative involvement of cytosolic Ca < sup > 2+ < /sup > and GTP-binding proteins in cyclic-GMP-mediated induction of stomatal opening by auxin in Commelina communis L.Planta206308–314. 10.1007/s004250050405
5
DavidC.AnthonyR. M. (2000). Calmodulin: a prototypical calcium sensor.Trends Cell Biol.10322–328. 10.1016/S0962-8924(00)01800-6
6
DelkN. A.JohnsonK. A.ChowdhuryN. I.BraamJ. (2005). CML24, regulated in expression by diverse stimuli, encodes a potential Ca2+ sensor that functions in responses to abscisic acid, daylength, and ion stress.Plant Physiol.139240–253. 10.1104/pp.105.062612
7
FabienneM.BenoitR.MartineC.BrunoS.JeanphilippeG.DidierA. (2008). Mutations in AtCML9, a calmodulin-like protein from Arabidopsis thaliana, alter plant responses to abiotic stress and abscisic acid.Plant J.56575–589. 10.1111/j.1365-313X.2008.03622.x
8
FryerM. J.BallL.OxboroughK.KarpinskiS.MullineauxP. M.BakerN. R. (2003). Control of ascorbate peroxidase 2 expression by hydrogen peroxide and leaf water status during excess light stress reveals a functional organisation of Arabidopsis leaves.Plant J.33691–705. 10.1046/j.1365-313X.2003.01656.x
9
GarrigosM.DeschampsS.VielA.LundS.ChampeilP.MollerJ. V.et al (1991). Detection of Ca2+-binding proteins by electrophoretic migration in the presence of Ca2+ combined with 45Ca2+ overlay of protein blots.Anal. Biochem.19482–88. 10.1016/0003-2697(91)90154-L
10
GeigerD.ScherzerS.MummP.MartenI.AcheP.MatschiS.et al (2010). Guard cell anion channel SLAC1 is regulated by CDPK protein kinases with distinct Ca2+ affinities.Proc. Natl. Acad. Sci. U.S.A.1078023–8028. 10.1073/pnas.0912030107
11
GongM.ChenS.SongY.LiZ. (1997). Effect of calcium and calmodulin on intrinsic heat tolerance in relation to antioxidant systems in maize seedlings.Funct. Plant Biol.24371–379. 10.1071/pp96118
12
HelenT.MarcR. K. (2002). Calmodulin as a potential negative regulator of Arabidopsis COR Gene Expression.Plant Physiol.1281169–1172. 10.1104/pp.010814
13
HongtaoL.BingL.ZhonglinS.LiX.RuilingM.DayeS.et al (2003). Calmodulin is involved in heat shock signal transduction in wheat.Plant Physiol.1321186–1195. 10.1104/pp.102.018564
14
JeffersonR. A.KavanaghT. A.BevanM. W. (1987). GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.EMBO J.63901–3907.
15
JooJ.WangS.ChenJ.JonesA. M.FedoroffN. V. (2005). Different signaling and cell death roles of heterotrimeric G protein α and β subunits in the Arabidopsis oxidative stress response to ozone.Plant Cell17957–970. 10.1105/tpc.104.029603
16
JulietteA.PhilippeN.AnnaC.StephanieD.ChristineC.NardjisA.et al (2008). Arabidopsis TONNEAU1 proteins are essential for preprophase band formation and interact with centrin.Plant Cell202146–2159. 10.1105/tpc.107.056812
17
KaritaE.YamakawaH.MitsuharaI.KuchitsuK.OhashiY. (2004). Three types of tobacco calmodulins characteristically activate plant NAD kinase at different Ca2+ concentrations and pHs.Plant Cell Physiol.451371–1379. 10.1093/pcp/pch158
18
KenichiroS.ToshinoriK.MitsuoN. (1992). Involvement of calmodulin and calmodulin-dependent myosin light chain kinase in blue light-dependent H+ pumping by guard cell protoplasts from Vicia faba L.Plant Physiol.991416–1421. 10.1104/pp.99.4.1416
19
KimY.ParkS.GilmourS. J.ThomashowM. F. (2013). Roles of CAMTA transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis.Plant J.75364. 10.1111/tpj.12205
20
KimuraS.KayaH.KawarazakiT.HiraokaG.SenzakiE.MichikawaM.et al (2012). Protein phosphorylation is a prerequisite for the Ca2+-dependent activation of Arabidopsis NADPH oxidases and may function as a trigger for the positive feedback regulation of Ca2+ and reactive oxygen species.Biochim. Biophys. Acta1823398–405. 10.1016/j.bbamcr.2011.09.011
21
KöhlerB.HillsA.BlattM. R. (2003). Control of guard cell ion channels by hydrogen peroxide and abscisic acid indicates their action through alternate signaling pathways.Plant Physiol.131385–388. 10.1104/pp.016014
22
KwakJ.MaserP.SchroederJ. (2008). The clickable guard cell, version II: interactive model of guard cell signal transduction mechanisms and pathways.Arabidopsis Book6:e0114. 10.1199/tab.0114
23
KwakJ.MoriI.PeiZ.LeonhardtN.TorresM.DangJ.et al (2003). NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.EMBO J.222623–2633. 10.1093/emboj/cdg277
24
LiC. L.WangM.MaX. Y.ZhangW. (2014). NRGA1, a putative mitochondrial pyruvate carrier, mediates ABA regulation of guard cell ion channels and drought stress responses in Arabidopsis.Mol. Plant71508–1521. 10.1093/mp/ssu061
25
LiC. L.WangM.WuX. M.ChenD. H.LvH. J.ShenJ. L.et al (2016). THI1,a thiamine thiazole synthase, interacts with Ca2+-dependent protein kinase CPK33 and modulates the S-Type anion channels and stomatal closure in Arabidopsis.Plant Physiol.1701090–1104. 10.1104/pp.15.01649
26
LinH.WangR.QianQ.YanM.MengX.FuZ.et al (2009). DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth.Plant Cell211512–1525. 10.1105/tpc.109.065987
27
MaF.LuR.LiuH.ShiB.ZhangJ.TanM.et al (2012). Nitric oxide-activated calcium/calmodulin-dependent protein kinase regulates the abscisic acid-induced antioxidant defence in maize.J. Exp. Bot.634835–4847. 10.1093/jxb/ers161
28
McAinshM. R.BrownleeC.HetheringtonA. M. (1990). Abscisic acid-induced elevation of guard cell cytosolic Ca2+ precedes stomatal closure.Nature343186–188. 10.1038/343186a0
29
McAinshM. R.BrownleeC.HetheringtonA. M. (1997). Calcium ions as second messengers in guard cell signal transduction.Physiol. Plant.10016–29. 10.1111/j.1399-3054.1997.tb03451.x
30
McAinshM. R.WebbA. A. R.TaylorJ. E.HetheringtonA. M. (1995). Stimulus-induced oscillations in guard cell cytosolic free calcium.Plant Cell71207–1219. 10.1105/tpc.7.8.1207
31
McCormackE.TsaiY.-C.BraamJ. (2005). Handling calcium signaling: Arabidopsis CaMs and CMLs.Trends Plant Sci.10383–389. 10.1016/j.tplants.2005.07.001
32
MunirS.LiuH.XingY. Z.HussainS.OuyangB.ZhangY.et al (2016). Overexpression of calmodulin-like (ShCML44) stress-responsive gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses.Sci Rep.6:31772. 10.1038/srep31772
33
MurashigeT.SkoogF. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures.Physiol. Plant.15473–497. 10.1111/j.1399-3054.1962.tb08052.x
34
MurataY.MoriI. C.MunemasaS. (2015). Diverse stomatal signaling and the signal integration mechanism.Annu. Rev. Plant Biol.66369–392. 10.1146/annurev-arplant-043014-114707
35
MustilliA.MerlotS.VavasseurA.FenziF.GiraudatJ. (2002). Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production.Plant Cell143089–3099. 10.1105/tpc.007906
36
OgasawaraY.KayaH.HiraokaG.YumotoF.KimuraS.KadotaY.et al (2008). Synergistic activation of the Arabidopsis NADPH oxidase AtrbohD by Ca2+ and phosphorylation.J. Biol. Chem.2838885–8892. 10.1074/jbc.M708106200
37
OliverB.JorgK. (2012). Analysis of calcium signaling pathways in plants.Biochim. Biophys. Acta18201283–1293. 10.1016/j.bbagen.2011.10.012
38
PandeyN.RanjanA.PantP.TripathiR. K.AteekF.PandeyH. P.et al (2013). CAMTA1 regulates drought responses in Arabidopsis thaliana.BMC Genomics14:216. 10.1186/1471-2164-14-216
39
PandeyS.ZhangW.AssmannS. M. (2007). Roles of ion channels and transporters in guard cell signal transduction.FEBS Lett.5812325–2336. 10.1016/j.febslet.2007.04.008
40
PeiZ. M.MurataY.BenningG.ThomineS.KlusenerB.AllenG. J.et al (2000). Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells.Nature406731–734. 10.1038/35021067
41
RentelM. C.KnightM. R. (2004). Oxidative stress-induced calcium signaling in Arabidopsis.Plant Physiol.1351471–1479. 10.1104/pp.104.042663
42
SakamotoH.MaruyamaK.SakumaY.MeshiT.IwabuchiM.ShinozakiK.et al (2004). Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions.Plant Physiol.1362734–2746. 10.1104/pp.104.046599
43
SchroederJ.KwakJ.AllenG. (2001). Guard cell abscisic acid signalling and engineering drought hardiness in plants.Nature410327–330. 10.1038/35066500
44
SchroederJ. I.RaschkeK.NeherE. (1987). Voltage dependence of K+ channels in guard-cell protoplasts.Proc. Natl. Acad. Sci. U.S.A.844108–4112. 10.1073/pnas.84.12.4108
45
ShangY.DaiC.LeeM. M.KwakJ. M.NamK. H. (2016). BRI1-associated receptor kinase 1 regulates guard cell ABA signaling mediated by open stomata 1 in Arabidopsis.Mol. Plant9447–460. 10.1016/j.molp.2015.12.014
46
SheenJ. (2001). Signal transduction in maize and Arabidopsis mesophyll protoplasts.Plant Physiol.1271466–1475. 10.1104/pp.010820
47
SiegelR. S.XueS.MurataY.YangY.NishimuraN.WangA.et al (2009). Calcium elevation-dependent and attenuated resting calcium-dependent abscisic acid induction of stomatal closure and abscisic acid-induced enhancement of calcium sensitivities of S-type anion and inward-rectifying K channels in Arabidopsis guard cells.Plant J.59207–220. 10.1111/j.1365-313X.2009.03872.x
48
SierlaM.WaszczakC.VahisaluT.KangasjarviJ. (2016). Reactive oxygen species in the regulation of stomatal movements.Plant Physiol.1711569–1580. 10.1104/pp.16.00328
49
SirichandraC.GuD.HuH.DavantureM.LeeS.DjaouiM.et al (2009). Phosphorylation of the Arabidopsis AtrbohF NADPH oxidase by OST1 protein kinase.FEBS Lett.5832982–2986. 10.1016/j.febslet.2009.08.033
50
TakahashiF.MizoguchiT.YoshidaR.IchimuraK.ShinozakiK. (2011). Calmodulin-dependent activation of MAP kinase for ROS homeostasis in Arabidopsis.Mol. Cell.41649–660. 10.1016/j.molcel.2011.02.029
51
ThorK.PeiterE. (2014). Cytosolic calcium signals elicited by the pathogen-associated molecular pattern flg22 in stomatal guard cells are of an oscillatory nature.New Phytol.204873–881. 10.1111/nph.13064
52
TurnerW. L.WallerJ. C.VanderbeldB.SneddenW. A. (2004). Cloning and characterization of two NAD kinases from Arabidopsis. Identification of a calmodulin binding isoform.Plant Physiol.1351243–1255. 10.1104/pp.104.040428
53
TzahiA.RamanjuluS.BoazK.HillelF. (1999). A tobacco plasma membrane calmodulin-binding transporter confers Ni2+ tolerance and Pb2+ hypersensitivity in transgenic plants.Plant J.20171–182. 10.1046/j.1365-313x.1999.00588.x
54
VadasseryJ.ReicheltM.HauseB.GershenzonJ.BolandW.MithoferA. (2012). CML42-mediated calcium signaling coordinates responses to spodoptera herbivory and abiotic stresses in Arabidopsis.Plant Physiol.1591159–1175. 10.1104/pp.112.198150
55
VahisaluT.KollistH.WangY. F.NishimuraN.ChanW. Y.ValerioG.et al (2008). SLAC1 is required for plant guard cell S-type anion channel function in stomatal signalling.Nature452487–491. 10.1038/nature06608
56
VersluesP. E.AgarwalM.Katiyar-AgarwalS.ZhuJ.ZhuJ. K. (2006). Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status.Plant J.45523–539. 10.1111/j.1365-313X.2005.02593.x
57
WangG.ZengH.HuX.ZhuY.ChenY.ShenC.et al (2015). Identification and expression analyses of calmodulin-binding transcription activator genes in soybean.Plant Soil386205–221. 10.1007/s11104-014-2267-6
58
WuH.LuoD.VignolsF.JinnT. (2012). Heat shock-induced biphasic Ca2+ signature and OsCaM1-1 nuclear localization mediate downstream signalling in acquisition of thermotolerance in rice (Oryza sativa L.).Plant Cell Environ.351543–1557. 10.1111/j.1365-3040.2012.02508.x
59
XingT.HigginsV. J.BlumwaldE. (1997). Race-specific elicitors of Cladosporium fulvum promote translocation of cytosolic components of NADPH oxidase to the plasma membrane of tomato cells.Plant Cell9249–259. 10.1105/tpc.9.2.249
60
XuG.RochaP. S. C. F.WangM.XuM.CuiY.LiL.et al (2011). A novel rice calmodulin-like gene, OsMSR2, enhances drought and salt tolerance and increases ABA sensitivity in Arabidopsis.Planta23447–59. 10.1007/s00425-011-1386-z
61
YamaguchiT.AharonG. S.SottosantoJ. B.BlumwaldE. (2005). Vacuolar Na+/H+ antiporter cation selectivity is regulated by calmodulin from within the vacuole in a Ca2+- and pH-dependent manner.Proc. Natl. Acad. Sci. U.S.A.10216107–16112. 10.1073/pnas.0504437102
62
Yamaguchi-shinozakiK.ShinozakiK. (2006). Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses.Annu. Rev. Plant Biol.57781–803. 10.1146/annurev.arplant.57.032905.105444
63
YangT.PoovaiahB. W. (2002). Hydrogen peroxide homeostasis: activation of plant catalase by calcium/calmodulin.Proc. Natl. Acad. Sci. U.S.A.994097–4102. 10.1073/pnas.052564899
64
ZhangW.JeonB. W.AssmannS. M. (2011). Heterotrimeric G-protein regulation of ROS signalling and calcium currents in Arabidopsis guard cells.J. Exp. Bot.622371–2379. 10.1093/jxb/erq424
65
ZhangW.NilsonS. E.AssmannS. M. (2008). Isolation and whole-cell patch clamping of Arabidopsis guard cell protoplasts.CSH Protoc.2008pdp.prot5014. 10.1101/pdb.prot5014
Summary
Keywords
CML20, drought stress, guard cell, stomatal movement, abscisic acid
Citation
Wu X, Qiao Z, Liu H, Acharya BR, Li C and Zhang W (2017) CML20, an Arabidopsis Calmodulin-like Protein, Negatively Regulates Guard Cell ABA Signaling and Drought Stress Tolerance. Front. Plant Sci. 8:824. doi: 10.3389/fpls.2017.00824
Received
27 January 2017
Accepted
02 May 2017
Published
23 May 2017
Volume
8 - 2017
Edited by
Girdhar Kumar Pandey, University of Delhi, India
Reviewed by
Girish Mishra, University of Delhi, India; Kai Shu, Sichuan Agricultural University, China
Updates
Copyright
© 2017 Wu, Qiao, Liu, Acharya, Li and Zhang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Chunlong Li, lichunlong216@126.com Wei Zhang, weizhang@sdu.edu.cn
†These authors have contributed equally to this work.
This article was submitted to Plant Physiology, a section of the journal Frontiers in Plant Science
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.