Abstract
Sorghum bicolor is a genetically diverse C4 monocotyledonous species, encompassing varieties capable of producing high grain yields as well as sweet types which accumulate soluble sugars (predominantly sucrose) within their stems to high concentrations. Sucrose produced in leaves (sources) enters the phloem and is transported to regions of growth and storage (sinks). It is likely that sucrose transporter (SUT) proteins play pivotal roles in phloem loading and the delivery of sucrose to growth and storage sinks in all Sorghum ecotypes. Six SUTs are present in the published Sorghum genome, based on the BTx623 grain cultivar. Homologues of these SUTs were cloned and sequenced from the sweet cultivar Rio, and compared with the publically available genome information. SbSUT5 possessed nine amino acid sequence differences between the two varieties. Two of the remaining five SUTs exhibited single variations in their amino acid sequences (SbSUT1 and SbSUT2) whilst the rest shared identical sequences. Complementation of a mutant Saccharomyces yeast strain (SEY6210), unable to grow upon sucrose as the sole carbon source, demonstrated that the Sorghum SUTs were capable of transporting sucrose. SbSUT1, SbSUT4, and SbSUT6 were highly expressed in mature leaf tissues and hence may contribute to phloem loading. In contrast, SbSUT2 and SbSUT5 were expressed most strongly in sinks consistent with a possible role of facilitating sucrose import into stem storage pools and developing inflorescences.
INTRODUCTION
The storage of organic carbon as non-structural carbohydrates by plants is of biological and commercial interest. In this context, many varieties exist within the genetically diverse Sorghum bicolor species ranging from grain Sorghum types which store large amounts of starch within their grains to sweet Sorghum types which accumulate sucrose/hexoses within their stems. Sweet Sorghum cultivars are capable of accumulating soluble sugars up to 60% of their internode dry weight (). The Rio cultivar can accumulate three times the amount of sugar (total glucose, fructose, and sucrose g/kg stem tissue) in mature stems compared to grain Sorghum cv. BTx623 (). For these reasons, sweet Sorghum, a C4 monocotyledonous plant with high yield potential, is regarded as an ideal feedstock to provide sugar for bioethanol production. Higher sugar lines are preferred for the production of “first generation” bioethanol. A high sugar variety may yield 500 g of sugar per kg of stem dry weight, and total soluble sugar yields can reach 10 t ha-1 (). These yields equate to theoretical ethanol yields of up to 5414 L ha-1 (). However, higher sugar, and hence ethanol yields per hectare may be achievable through selective breeding and/or genetic transformation of Sorghum.
During sugar accumulation within stems, sucrose produced in photosynthetic source leaves is transported within phloem sieve element-companion cell (SE-CC) complexes to an array of sinks (non-photosynthetic organs) comprising developing vegetative and reproductive organs (growth sinks) as well as the stem storage sink. Within growth sinks carbohydrates are invested primarily into the biosynthesis of cellular structures. In contrast, elongating and mature internodes of cv. Rio accumulate sucrose within vacuoles, cytosols, and apoplasmic spaces of their storage parenchyma cells ().
In the C4 species maize (Zea mays), closely related to Sorghum, sucrose loading of SE-CC complexes occurs apoplasmically (). It is assumed that a similar pathway of phloem loading of sucrose is followed in Sorghum. In stems of sugarcane and Sorghum, sucrose is transferred radially from their SE-CC complexes into storage parenchyma cells. Intracellular compartmentation of stored sucrose in Sorghum is presumed to be similar to that of sugarcane. Here, the bulk of sucrose accumulates within vacuoles of their storage parenchyma cells to concentrations that equal or exceed sucrose concentrations of the phloem sap. Thus the possibility of a concentrating step is invoked. Since the pathway of phloem unloading follows a symplasmic pathway in sugarcane stems (), any concentrating step must be localized to tonoplasts of their storage parenchyma vacuoles. Inconsistent with this conclusion is the finding that sucrose transport into isolated vacuoles of sugarcane stems occurs by facilitated diffusion (; ). However, whether an energy-dependent transport step operates in parallel with facilitated diffusion into vacuoles, as reported for sugar beet (), remains to be resolved for sugarcane. In the case of Sorghum, the phloem unloading pathway of sucrose into stem storage parenchyma cells appears to include an apoplasmic component () and hence an additional reliance on movement across plasma membranes arranged in series with tonoplast transport.
Import of sucrose into cells across their plasma membranes is mediated by sucrose transporters (SUTs). SUTs are energy-dependent trans-membrane proteins which co-transport sucrose and protons in the same direction, in a 1:1 stoichiometric ratio (). Therefore, Sorghum SUTs are of interest because they may play key roles in apoplasmic phloem loading of sucrose in source leaves and apoplasmic unloading of sucrose into stem storage sinks (see above). SUTs are known to function in phloem loading of maize source leaves () but the role of SUTs in stem storage is less certain. Here the final sucrose concentration within stems can be a balance between import and remobilization to provide a supplementary source of organic carbon to support grain filling when leaf photosynthesis has been depressed by stressful conditions (, ). However, remobilization of stem reserves in a number of Sorghum cultivars has been reported to be minimal under favorable environmental conditions ().
Here we investigate the expression of Sorghum SUTs in source and sink organs during vegetative growth and at anthesis in two cultivars of Sorghum, cv. BTx623 and cv. Rio. These two cultivars exhibit very different phenotypes, with cv. BTx623 being of short stature and producing a large grain head. In contrast, cv. Rio produces a small panicle with fewer grains, but may grow to a height of 3 m with a stout culm for sugar storage. Differences in SUT expression between cultivars may correlate with phloem loading, long distance transport, and ultimately partitioning of sucrose to reproductive sinks in cv. BTx623 or stem sinks in cv. Rio. Complementation of the deficient Saccharomyces cerevisiae SEY6210 strain by Sorghum SUTs is also explored as a first step toward detailed functional characterization of these transporters.
MATERIALS AND METHODS
PLANT GROWTH CONDITIONS
Seeds of the Sorghum cultivars Rio and BTx623 were germinated and grown in 10 L pots containing a soil mixture consisting of two parts coarse sand, one part coco peat, and one part perlite, under glass house conditions with temperatures maintained at 25.5 ± 1.5°C during the day, and 15.5 ± 0.5°C during the night. Plants were exposed to a photoperiod of 14-h light and 10-h dark cycle with supplementary lighting provided by tungsten incandescent lamps. Seedlings were thinned to one per pot at 1-week post germination. Pot water levels were maintained at field capacity with a programmable drip irrigation system delivering water to each pot for two min, three times per day. Osmocote exact slow release fertilizer (Scotts Australia Pty Ltd, Sydney, NSW, Australia) was applied at a rate of 20 g per pot 2-weeks post germination and was supplemented with liquid fertilizer (Wuxal Liquid Foliar Nutrients; AgNova Technologies Pty Ltd, Eltham, VIC, Australia) at fortnightly intervals. Nitrogen (N), phosphorus (P), and potassium (K) ratios for Osmocote exact were 15N, 3.9P, and 9.1K.
HARVESTING PLANT MATERIAL
All plant samples were snap frozen in liquid nitrogen immediately following harvest. During the vegetative growth phase, cv. BTx623 (grain) and cv. Rio (sweet) were destructively harvested approximately 60 and 90 days after germination, respectively. Material harvested for analysis was a sink leaf (expanding leaf fully enclosed within leaf sheaths); source leaf (youngest fully expanded leaf), internode 2 (elongated internode; numbered acropetally), and internode 5 (elongating). At anthesis, cv. BTx623 and cv. Rio were harvested approximately 103 and 140 days after germination, respectively. The flag leaf and leaf 7 (numbered acropetally), the flag internode, internode 2 and whole inflorescences were harvested. Additional samples were taken for detailed analysis of SUT expression. These were upper portion (5 cm) of the flag internodes and inflorescences separated into spikelets, anthers, and rachis branches.
ISOLATION OF TOTAL RNA
Tissue samples were cryogenically ground in stainless steel grinding jars cooled on dry ice with a cooled stainless steel ball bearing agitated for 1 min at 30 Hz using a Retsch TissueLyser II (QIAGEN, Chadstone Centre, VIC, Australia). Total RNA was isolated from 100 mg of ground material. Leaves were extracted using the plant RNeasy® kit (QIAGEN) whilst stems and inflorescences were extracted using the plant RNA reagent (Life Technologies, Mulgrave, VIC, Australia). Digestion of contaminating genomic DNA was performed post RNA isolation using the Ambion® TURBOTM DNase kit (Life Technologies). RNA isolation and genomic DNA digestions were performed according to the manufacturer’s instructions.
SYNTHESIS OF cDNA
Complementary DNA (cDNA) was synthesized from 1 μg of RNA using the Thermoscript® first strand cDNA synthesis kit (Life technologies) with an oligo d(T) primer, at an extension temperature of 60°C, according to the manufacturer’s instructions.
CLONING FULL-LENGTH GENES
Full-length coding DNA fragments of each SorghumSUT was cloned from cDNA by polymerase chain reaction (PCR) using Fermentas 2xMM (ThermoFisher, Scoresby, VIC, Australia) spiked with 1 μL Fermentas Pfu polymerase (ThermoFisher) using gene specific primers (Table 1). PCR cycling conditions were 95°C for 10 min followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 2 min (2 min 20 s for SbSUT2). Amplified products were cloned into the pGEM-t easy vector (Promega, Sydney, NSW, Australia) and at least three clones were sequenced from separate cDNA samples. SUTs were then amplified from plasmids using the Stratagene Pfu Ultra II polymerase (Integrated Sciences, Chatswood, NSW, Australia) by primers incorporating restriction sites at the start and stop codons as shown in Table 1 and recommended cycling profile using a 55°C annealing temperature. Products were digested with corresponding FastDigest® Fermentas restriction enzymes (ThermoFisher), as were the yeast expression vectors. SUTs were then ligated into pDR195 (SbSUT5 and SbSUT6) or pDR196 ().
Table 1
| Gene | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| Full-length primers | ||
| SbSUT1 | GTCGTCCCGTACGTGTGC | ATCTTGCACGGTTGGGTTT |
| SbSUT2 | CCGCAGCGACACCTACAC | AATGGCAAAATGGGGCTAAGT |
| SbSUT3 | CTCCACACCTCTCCGGTTT | CGACAGTAGTGGTTGATCG |
| SbSUT4 | TCAAAGCAACTCAGCGATTC | AGCTGCAACTCTTCCAAAGC |
| SbSUT5 | GTAGCCATGGACGGTGGTG | CCGCCTGGCGATAGATAGAT |
| SbSUT6 | CGTTCCTGCTCCTCTCACTC | TGGATTTCCGATCATCCACT |
| Restriction cloning primers | ||
| SbSUT1 | CTCGCGGAATTCATGGCTCGCGGCGA | GGCCGTGTCGACTCAGTGGCCGCCCG |
| EcoRI | sall | |
| SbSUT2 | GGCGCGGTCGACATGGACGCCGGCACC | TTGGGCAGTCGACTCAGCCAAATCCATGG |
| sall | XhoI | |
| SbSUT3 | CCGGTTGAATTCATGGCTGCTGATGGC | CTGGACCTCGAGTCAATGGCCTCCTC |
| EcoRI | XhoI | |
| SbSUT4 | CCGTGAGAATTCATGCCGCCGCGCAC | GTAATGGTCGACATTATCGGTGCGTGC |
| EcoRI | sall | |
| SbSUT5 | AATTCGAGCGGCCGCATGGACGGTGGTGAC | GCGATAGGATCCTCAGTGGCCGCCGC |
| NotI | BamHI | |
| SbSUT6 | GCCCGGCGGCCGCATGGACGACGGTGAC | CCTGGAGGATCCTCAACAGTGGCCGC |
| NotI | BamHI | |
| qPCR primers | ||
| SbSUT1 | GTGCTCCTGTAATCTTTGTGTCC | ACTATACTGCACATTGATTGATCG |
| SbSUT2 | GCACATGCATTGAATGAACC | TTCGCATTTGGAAATTCCTC |
| SbSUT3 | GGCCGGATCAAACAAGAT | GGCATTGCGAAGGAATGA |
| SbSUT4 | CGATCCATGATGATGTCCAG | GTTCCAGGCCTTGCTGTC |
| SbSUT5 | CCCGTAGTGTTGCGGAGTC | CCAATGGATCGGAAAATAAAG |
| SbSUT6 | GCACAACAGCACAAAGAAGG | AGGCAGAAGAGGCTGAGATG |
| SbGAPDH | AGGGTATCATGGGCTACGTG | AGTTGTCGTTCAGGGCAATC |
| SbEF1a | CATGGTGGTGGAGACCTTCT | TCCTTCTTCTCCACGCTCTT |
Primer sets used for PCR amplification of SorghumSUTs. Restriction site sequences are underlined.
YEAST TRANSFORMATION
SorghumSUT-yeast expression vector constructs were introduced into the Saccharomyces cerevisiae yeast strain SEY6210 (MATα leu2–3, 112 ura3–52 his3–Δ200 trpl-Δ901 lys2–801 suc2- Δ9 GAL; ) using the 40% PEG1000 transformation method (). Yeast transformants harboring one of each of the cv. Rio SUTs, the cv. BTx623 SbSUT5 (SbSUT5G) and empty pDR196 vector were identified. Media lacking uracil was used for selection as the pDR yeast expression vectors contain the uracil synthesis gene. DNA was extracted from yeast post transformation, then plasmids were transformed into Escherichia coli (strain DH5α), and were harvested using a Plasmid Mini Kit (QIAGEN). Plasmids were sequenced to confirm that the SUT sequences were correct. In short, 1.5mL yeast culture was pelleted, washed with MilliQ water then resuspended in lysis buffer [50 mM Tris-HCl pH 8, 100mM NaCl, 1% SDS, 2% Triton X-100, 1mM ethylenediaminetetraacetic acid (EDTA)]. Glass beads were added (0.3g, 425–600 μm diameter) along with 200 μL phenol:chloroform:isoamyl alcohol (25:24:1; Sigma-Aldrich, Castle Hill, NSW, Australia) and vortexed for 10 min followed by micro-centrifugation for 5 min at maximum speed. The upper extract layer was then removed and DNA precipitated in 1 mL ethanol prior to pelleting and resuspension in 50 μL TE.
YEAST COMPLEMENTATION
Transformed yeast strains harboring Sorghum SUTs, empty pDR196 and PsSUT1 were grown in liquid culture to an OD600 of 0.8 in synthetic dropout media lacking uracil. Untransformed yeast was cultured in synthetic complete media. Yeast were streaked (2 μL) on solid media lacking uracil and supplemented with either sucrose (25 mM) or glucose (100 mM) as the sole carbon source. This was repeated three times and plates were photographed using a ChemiDocTM XRS system (Bio-Rad, Gladesville, NSW, Australia). SuSy7 yeast harbouring PsSUT1-pDR196 was kindly provided by for use as a positive control.
SUT TRANSCRIPT QUANTIFICATION BY qPCR
Primers used for quantitative PCR (qPCR; Table 1) were designed to amplify regions of the 3′ UTR of each SUT due to high sequence homology within coding regions, with the exception of SbSUT2 where a region from the coding sequence was amplified. Products from standard PCR were sequenced to ensure that correct gene fragments were amplified. Quantitative PCR was carried out on a Rotor-Gene Q (QIAGEN) using the QuantiFast SYBR green PCR kit (QIAGEN) and a two-step cycling program according to the manufacturer’s instructions. The green channel was used for data acquisition. Gene expression was measured relative to the housekeeper, Sorghum bicolor elongation factor 1-alpha (SbEF-1α).
SELECTION OF HOUSEKEEPING GENE FOR qPCR
The expression stability of two widely used housekeeping genes, Sorghum bicolor glyceraldehyde-6-phosphate dehydrogenase (SbGAPDH) and SbEF-1α from cv. Rio, were assessed prior to measuring expression levels of Sorghum SUTs. Comparison of cycle threshold values (Ct) and absolute expression levels (data not shown) revealed both housekeeping genes were quite stably expressed within each organ examined. However, differences in expression of SbGAPDH were greater than those for SbEF-1α. Hence SbEF-1α was chosen to normalize SUT expression in subsequent experiments. The stability of SbEF-1α was compared between cv. BTx623 and cv. Rio (Figure 1). Expression of SbEF-1α was least stable in cv. Rio during vegetative growth (Source leaf and Inter 2 – Figure 1A) and cv. BTx623 at anthesis (Inter 2 – Figure 1E). However, in all cases this variation was insignificant relative to the observed genotypic differences in the relative expression levels of the genes of interest and hence had no impact on the conclusions drawn.
FIGURE 1
RESULTS
SbSUT SEQUENCES
Full-length coding sequences of each SUT from both Sorghum cultivars were amplified by PCR, cloned, and then sequenced. Twelve trans-membrane domains were predicted for each SUT using the TMHMM (Hidden Markov model-based transmembrane) predictive algorithm, and a graphical representation of the membrane topology of SbSUT5 is shown (Figure 2). Cytoplasmic N- and C-termini were predicted along with a central loop domain. Sequence analysis (not shown) revealed that a number of conserved features are present in Sorghum SUTs. A conserved histidine residue is present in the first loop domain corresponding to His-65 () and amino acids which correspond to the G-X-X-X-D/E-R/K-X-G-[X]-R/K-R/K motif reside in the second and eighth loop domains (; ). Only SbSUT4 contained an LXXLL motif in the N-terminal domain, indicating it may be targeted to the tonoplast ().
FIGURE 2
A number of amino acid differences were noted between cv. Rio SUTs and the published cv. BTx623 genomic sequence. To examine this further, SUTs from cv. BTx623 were cloned and sequences verified. SbSUT1 and SbSUT2 possessed single amino acid sequence differences, whereas SbSUT3, SbSUT4, and SbSUT6 were identical when sequences from cv. Rio and cv. BTx623 were aligned. SbSUT1 from cv. Rio had a valine (V) at position 381, whereas cv. BTx623 had an isoleucine (I) in this position. In SbSUT2 at amino acid 41, a threonine (T) was present in the sequence from cv. Rio, but absent in the cv. BTx623 sequence. SbSUT5 exhibited the most variation between the two cultivars with nine amino acid differences. Five amino acids out of a string of six differed between cv. BTx623 and cv. Rio SUT5, and were predicted to lie in the N-terminal region of the transporter (Figure 2). Starting at amino acid 32, the cv. Rio sequence predicted GAGEKA whilst the cv. BTx623 sequence predicted AGEKKG. Single amino acid differences between the cv. Rio and cv. BTx623 sequences occurred at amino acid 272, 355, 396, and 426 as shown in Figure 2 (V272L; M355V; M396T, and R426K, respectively). These amino acid sequence differences in the SUTs between the two cultivars are summarized in Table 2.
Table 2
| SUT | No. of variations (BTx623 vs Rio) | Amino acid variations |
|---|---|---|
| SbSUT1 | 1 | I381V |
| SbSUT2 | 1 | T41 insertion (Rio) |
| SbSUT3 | 0 | – |
| SbSUT4 | 0 | – |
| SbSUT5 | 9 | A32G, G33A, E34G, K35E, G37A,L272V, V355M, T396M, K426R |
| SbSUT6 | 0 | – |
Summary of SUT sequence variation between BTx623 and Rio cultivars.
PHYLOGENETIC ANALYSIS OF MONOCOTYLEDONOUS SUTs
A phylogenetic analysis demonstrated that the Sorghum SUTs clustered into four clear groups (Figure 3). This is consistent with phylogenetic analyses of other grass species including the C3, Lolium perenne (
FIGURE 3

Phylogenetic analysis of SUTs from monocotyledonous species. SUTs displayed fit into Groups 1, 3, 4, 5 (
EXPRESSION OF SUTs IN YEAST
SUTs from cv. Rio were cloned and expressed in yeast using pDR195 or pDR196 yeast expression vectors (
FIGURE 4

Complementation of the SEY6210 yeast strain by Sorghum SUTs. All Sorghum SUTs were expressed in the yeast strain SEY6210 and grown on media containing (A) 100 mM glucose or (B) 25 mM sucrose as the sole carbon source. SuSy7 containing PsSUT1 was used as a positive control. The SuSy7 PsSUT1-pDR195 (
TRANSCRIPT LEVELS OF SUTs
All SUTs were expressed at measurable levels in all organs examined apart from SbSUT3, consistent with previous observations (
FIGURE 5

Sorghum SUT transcript levels during vegetative growth. Relative expression during vegetative growth of Sorghum SUTs. (A)SbSUT1; (B)SbSUT2; (C)SbSUT4; (D)SbSUT5; (E)SbSUT6. Levels of SUT expression were measured relative to SbEF-1α. Organs examined were a Sink leaf (expanding); Source leaf (youngest fully expanded); Internode 5 (Inter 5, elongating); and Internode 2 (Inter 2, fully elongated). Columns with vertical bars represent mean ± SE from five biological replicates.
FIGURE 6

Sorghum SUT transcript levels at anthesis.Relative expression at anthesis of Sorghum SUTs (A)SbSUT1; (B)SbSUT2; (C)SbSUT4; (D)SbSUT5; (E)SbSUT6. Levels of SUT expression were measured relative to SbEF-1α. Organs examined were the Flag leaf; Leaf 7; flag internode (Flag inter); Internode 2 (Inter 2) and the inflorescence (Infl). Columns with vertical bars represent mean ± SE from five biological replicates.
FIGURE 7

Sorghum SUT transcript levels at anthesis in the upper portion of the flag internode and within the inflorescence. Relative expression at anthesis of the Sorghum SUTs (A)SbSUT1; (B)SbSUT2; (C)SbSUT4; (D)SbSUT5; (E)SbSUT6. Levels of SUT expression were measured relative to SbEF-1α. Organs examined were the Rachis and Spikelet as well as the upper portion of the flag internode (Upper flag inter). Columns with vertical bars represent mean ± SE from five biological replicates.
During vegetative growth, SbSUT4 exhibited a similar pattern of expression in the two cultivars. SbSUT4 expression was highest in fully expanded leaves, with at least twofold lower levels in other organs examined and especially so for stems (Figure 5C). In contrast, at anthesis, transcript levels of SbSUT4 in source leaves were two to threefold greater in cv. Rio compared to cv. BTx623. Within inflorescences, SbSUT4 transcripts were equally high in rachis branches but for spikelets, expression levels in cv. BTx623 exceeded those of cv. Rio by fourfold (Figure 7C). The cultivar difference was reflected, but to a lesser extent, in upper portions of their flag internodes (Figure 7C).
There was a clear trend in SbSUT5 expression during the vegetative stage of development and at anthesis, and expression levels differed between cv. Rio and cv. BTx623 at both developmental stages. During vegetative growth, SbSUT5 was strongly and exclusively expressed in elongating Internode 5 of cv. Rio (Figure 5D). At anthesis, the dominant level of expression switched to inflorescences with cv. BTx623 expression levels exceeding those of cv. Rio by ca 50% (Figure 6D). Within inflorescences, SbSUT5 was expressed primarily in spikelets with threefold higher levels in cv. BTx623 compared to cv. Rio (Figure 7D). Transcripts were present in the flag internode of cv. Rio and absent in the same organ of cv. BTx623 (Figure 6D).
Transcripts of SbSUT6 were only detected in sink and source leaves during vegetative growth with levels in cv. BTx623 being threefold greater than those of cv. Rio (Figure 5E). At anthesis, leaf expression dominance was retained with cultivar differences declining with leaf age (compare flag and leaf 7 – Figure 6E). However, low transcript levels were detected in stems and inflorescences (Figure 6E). Within inflorescences, SbSUT6 was strongly expressed in cv. BTx623 spikelets and either weakly expressed or absent from rachis branches and upper portions of flag internodes (Figure 7E).
DISCUSSION
The full genomic sequence of Sorghum has allowed identification of all SbSUT sequences in this model cereal monocot. Examination of SbSUT transcript levels in source leaves versus stem and inflorescence sinks provides a strong indication of the role each transporter may play in transporting sucrose from source leaves to these sinks. To further highlight these roles, two phenotypically different cultivars were used, BTx623 and Rio. BTx623 preferentially partitions sucrose to developing inflorescences and hence an emphasis on grain yield whilst cv. Rio stores sucrose in stem parenchyma cells similar to sugarcane. Collectively these analyzes begin to identify which SUTs may participate in phloem loading, axial phloem transport, and phloem unloading.
All six SbSUTs demonstrated complementation of the deficient yeast strain, SEY6210 (Figure 4), indicating they are sucrose transport competent, and likely to be functional in planta. The single amino acid sequence differences in SbSUT2 sequence between cultivars is predicted to lie in its N-terminal domain, as does the string of amino acids which vary in the SbSUT5 (see Figure 2 andTable 2). The N-terminal domain has been shown to alter SUT affinity for sucrose (
In terms of phloem loading, based on their relative expression levels in source leaves, identified SbSUT4, SbSUT1, and SbSUT6 as potential candidates during vegetative and reproductive growth (see Figures 5, 6, 8, and 9). For SbSUT4, this assertion is consistent with a high source leaf expression observed for OsSUT2 (
FIGURE 8

Predicted source–transport–sink pathway in Sorghum during vegetative growth. Sucrose is released from source vacuoles (V) by SbSUT4. SbSUT1 and SbSUT6 load the phloem. SbSUT1 and SbSUT2 may act to retrieve sucrose leaked from the transport phloem. SbSUT2 and SbSUT5 load sucrose into stem sinks. SWEETs (SW) efflux sucrose to the apoplasm and tonoplast monosaccharide transporters (TMT) move sucrose into vacuoles. Comparison of relative expression of each SUT is color coded.
FIGURE 9

Predicted source–transport–sink pathway in Sorghum at anthesis.Sucrose is released from source vacuoles (V) by SbSUT4. SbSUT1 and SbSUT6 load the phloem. SbSUT1 and SbSUT2 may act to retrieve sucrose leaked from the transport phloem. SbSUT2 and SbSUT5 load sucrose into stem sinks. SbSUT5 and SbSUT6 load sucrose into reproductive sinks. SWEETs (SW) efflux sucrose to the apoplasm and tonoplast monosaccharide transporters (TMT) move sucrose into vacuoles. Comparison of relative expression of each SUT is color coded.
SbSUT1 may play a role in apoplasmic phloem loading (Figures 8 and 9) as found for the closely related maize ZmSUT1 which also belongs to the C4 NADP-ME subgroup (
In sweet Sorghum, sucrose is radially transferred from the phloem into stem storage parenchyma cells through a post-sieve element unloading pathway that likely includes an apoplasmic step (
Twofold greater expression of SbSUT2 was observed in internodes of cv. Rio as opposed to those from cv. BTx623 at anthesis (Figure 6D), suggesting this SUT may play an enhanced role in directing sucrose to stem storage parenchyma cells in cv. Rio. SbSUT2 has a predicted protein sequence of 594 amino acids, which is at least 60 amino acids longer than the five other Sorghum SUTs. Similarly, OsSUT4 has an extended central loop domain of around 90 amino acids and an extended N-terminal domain (
Cultivar differences in expression profiles of SbSUT5 were accompanied by the highest number of amino acid difference in SbSUT5 sequences (9 amino acids, Table 2). Little information is available about transporters belonging to Group 5 apart from OsSUT5. This gene exhibited broad expression across source and sink leaves as well as in developing grains of rice (
In conclusion, the six Sorghum SUTs were cloned from two cultivars that differ in carbohydrate partitioning. Expression analysis revealed that three of the SUTs were expressed strongly in source leaves (SbSUT1, SbSUT4, SbSUT6) and are likely to play roles in phloem loading. Two SUTs were expressed strongly in sinks (SbSUT2, SbSUT5) and are more likely to play roles in sink development and photoassimilate storage. SbSUT3 was not detected in most organs examined. All of the Sorghum SUTs complemented the deficient yeast system, indicating they are sucrose transport competent. A number of amino acid sequence variations were identified between the SUTs from the two cultivars, and future functional characterization will determine if these variations result in alteration of their sucrose transport properties.
Statements
Acknowledgments
We thank the Australian Research Council (ARC) for financial support under ARC's Linkage Projects funding scheme (Project Number LP0883808).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
REFERENCES
1
AokiN.HiroseT.ScofieldG. N.WhitfeldP. R.FurbankR. T. (2003) The sucrose transporter gene family in rice.Plant Cell Physiol.44223–232. 10.1093/pcp/pcg030
2
AokiN.WhitfieldP.HoerenF.ScofieldG.NewellK.PatrickJ.et al (2002) Three sucrose transporter genes are expressed in the developing grain of hexaploid wheat.Plant Mol. Biol.50453–462. 10.1023/A:1019846832163
3
BarthI.MeyerS.SauerN. (2003) PmSUC3: characterization of a SUT2/SUC3-type sucrose transporter from Plantago major.Plant Cell151375–1385. 10.1105/tpc.010967
4
BerthierA.DesclosM.AmiardV.Morvan-BertrandA.Demmig-AdamsB.AdamsW. W.et al (2009) Activation of sucrose transport in defoliated Lolium perenneL.:an example of apoplastic phloem loading plasticity.Plant Cell Physiol.501329–1344. 10.1093/pcp/pcp081
5
BlumA.SinmenaB.MayerJ.GolanG.ShpilerL. (1994) Stem reserve mobilization supports wheat-grain filling under heat-stress.Aust. J. Plant Physiol.21771–781. 10.1071/PP9940771
6
BlumA.GolanG.MayerJ.SinmenaB. (1997) The effect of dwarfing genes on sorghum grain filling from remobilized stem reserves, under stress.Field Crops Res.5243–54. 10.1016/S0378-4290(96)03462-4
7
BraunD. M.SlewinskiT. L. (2009) Genetic control of carbon partitioning in grasses: roles of sucrose transporters and tie-dyed loci in phloem loading.Plant Physiol.14971–81. 10.1104/pp.108.129049
8
DereeperA.GuignonV.BlancG.AudicS.BuffetS.ChevenetF.et al (2008) Phylogeny.fr: robust phylogenetic analysis for the non-specialistNucleic Acids Res.36W465–W469. 10.1093/nar/gkn180
9
DohmenR. J.StrasserA. W. M.HonerC. B.HollenbergC. P. (1991) An efficient transformation procedure enabling long-term storage of competent cells of various yeast genera.Yeast7691–692. 10.1002/yea.320070704
10
EndlerA.MeyerS.SchelbertS.SchneiderT.WeschkeW.PetersS. W.et al (2006) Identification of a vacuolar sucrose transporter in barley and Arabidopsis mesophyll cells by a tonoplast proteomic approach.Plant Physiol.141196–207. 10.1104/pp.106.079533
11
EomJ. S.ChoJ. I.ReindersA.LeeS. W.YooY.TuanP. Q.et al (2011) Impaired function of the tonoplast-localized sucrose transporter in rice, OsSUT2, limits the transport of vacuolar reserve sucrose and affects plant growth.Plant Physiol.157109–119. 10.1104/pp.111.176982
12
GutjahrS.VaksmannM.DingkuhnM.TheraK.TroucheG.BraconnierS.et al (2013) Grain, sugar and biomass accumulation in tropical sorghums.I. Trade-offs and effects of phenological plasticity.Funct. Plant Biol.40342–354. 10.1071/FP12269
13
Hoffmann-ThomaG.HinkelK.NicolayP.WillenbrinkJ. (1996) Sucrose accumulation in sweet sorghum stem internodes in relation to growth.Physiol. Plant.97277–284. 10.1034/j.1399-3054.1996.970210.x
14
HusonD. H.RichterD. C.RauschC.DezulianT.FranzM.RuppR. (2007) Dendroscope: an interactive viewer for large phylogenetic trees.BMC Bioinformatics 8: 460. 10.1186/1471-2105-8-460
15
IshimaruK.HiroseT.AokiN.TakahashiS.OnoK.YamamotoS.et al (2001) Antisense expression of a rice sucrose transporter OsSUT1 in rice (Oryza sativa L.). Plant Cell Physiol.421181–1185. 10.1093/pcp/pce148
16
JacobsenK. R.FisherD. G.MaretzkiA.MooreP. H. (1992) Developmental changes in the anatomy of the sugarcane stem in relation to phloem unloading and sucrose storage.Bot. Acta10570–80.
17
LalondeS.WipfD.FrommerW. B. (2004) Transport mechanisms for organic forms of carbon and nitrogen between source and sink.Annu. Rev. Plant Biol.55341–372. 10.1146/annurev.arplant.55.031903.141758
18
LemoineR. (2000) Sucrose transporters in plants: update on function and structure.Biochim. Biophys. Acta1465246–262. 10.1016/S0005-2736(00)00142-5
19
LingleS. E. (1987) Sucrose metabolism in the primary culm of sweet sorghum during development.Crop Sci.271214–1219. 10.2135/cropsci1987.0011183X002700060025x
20
LuJ. M. Y.BushD. R. (1998) His-65 in the proton-sucrose symporter is an essential amino acid whose modification with site-directed mutagenesis increases transport activity.Proc. Natl. Acad. Sci. U.S.A.959025–9030. 10.1073/pnas.95.15.9025
21
McCormickA. J.CramerM. D.WattD. A. (2006) Sink strength regulates photosynthesis in sugarcane.New Phytol.171759–770. 10.1111/j.1469-8137.2006.01785.x
22
MinchinP. E. H.ThorpeM. R.FarrarJ. F.KorolevaO. A. (2002) Source–sink coupling in young barley plants and control of phloem loading.J. Exp. Bot.531671–1676. 10.1093/jxb/erf003
23
MurrayS. C.RooneyW. L.MitchellS. E.SharmaA.KleinP. E.MulletJ. E.et al (2008) Genetic improvement of Sorghum as a biofuel feedstock: II. QTL for stem and leaf structural carbohydrates.Crop Sci.482180–2193. 10.2135/cropsci2008.01.0068
24
Okubo-KuriharaE.HigakiT.KuriharaY.KutsunaN.YamaguchiJ.HasezawaS. (2011) Sucrose transporter NtSUT4 from tobacco BY-2 involved in plant cell shape during miniprotoplast culture.J. Plant Res.124395–403. 10.1007/s10265-010-0377-7
25
PayyavulaR. S.TayK. H. C.TsaiC. J.HardingS. A. (2011) The sucrose transporter family in Populus: the importance of a tonoplast PtaSUT4 to biomass and carbon partitioning.Plant J.65757–770. 10.1111/j.1365-313X.2010.04463.x
26
PazdernikN. J.MatzkeE. A.Jessen-MarshallA. E.BrookerR. J. (2000) Roles of charged residues in the conserved motif, G-X-X-X-D/E-R/K-X-G-[X]-R/K-R/K, of the lactose permease of Escherichia coli.J. Membr. Biol.17431–40. 10.1007/s002320001029
27
PreisserJ.KomorE. (1991) Sucrose uptake into vacuoles of sugarcane suspension cells.Planta186109–114. 10.1007/BF00201505
28
QaziH. A.ParanjpeS.BhargavaS. (2012) Stem sugar accumulation in sweet sorghum – activity and expression of sucrose metabolizing enzymes and sucrose transporters.J. Plant Physiol.169605–613. 10.1016/j.jplph.2012.01.005
29
ReindersA.SivitzA. B.StarkerC. G.GanttJ. S.WardJ. M. (2008) Functional analysis of LjSUT4, a vacuolar sucrose transporter from Lotus japonicus.Plant Mol. Biol.68289–299. 10.1007/s11103-008-9370-0
30
ReindersA.SunY.KarvonenK. L.WardJ. M. (2012) Identification of amino acids important for substrate specificity in sucrose transporters using gene shuffling.J. Biol. Chem.28730296–30304. 10.1074/jbc.M112.372888
31
RentschD.LaloiM.RouharaI.SchmelzerE.DelrotS.FrommerW. B. (1995) NTR1 encodes a high-affinity oligopeptide transporter in Arabidopsis.FEBS Lett.370264–268. 10.1016/0014-5793(95)00853-2
32
RobinsonJ. S.KlionskyD. J.BantaL. M.EmrS. D. (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases.Mol. Cell. Biol.84936–4948.
33
SaftnerR. A.DaieJ.WyseR. E. (1983) Sucrose uptake and compartmentation in sugar-beet taproot tissue.Plant Physiol.721–6. 10.1104/pp.72.1.1
34
SchneiderS.HulpkeS.SchulzA.YaronI.HollJ.ImlauA.et al (2012) Vacuoles release sucrose via tonoplast-localised SUC4-type transporters.Plant Biol.14325–336. 10.1111/j.1438-8677.2011.00506.x
35
SchulzA.BeyhlD.MartenI.WormitA.NeuhausE.PoschetG.et al (2011) Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2.Plant J.68129–136. 10.1111/j.1365-313X.2011.04672.x
36
SchulzeW.WeiseA.FrommerW. B.WardJ. M. (2000) Function of the cytosolic N-terminus of sucrose transporter AtSUT2 in substrate affinity.FEBS Lett.485189–194. 10.1016/S0014-5793(00)02180-3
37
ScofieldG. N.HiroseT.GaudronJ. A.UpadhyayaN. M.OhsugiR.FurbankR. T. (2002) Antisense suppression of the rice sucrose transporter gene, OsSUT1, leads to impaired grain filling and germination but does not affect photosynthesis.Funct. Plant Biol.29815–826. 10.1071/PP01204
38
SlewinskiT. L.MeeleyR.BraunD. M. (2009) Sucrose transporter1 functions in phloem loading in maize leaves.J. Exp. Bot.60881–892. 10.1093/jxb/ern335
39
SpyropoulosI. C.LiakopoulosT. D.BagosP. G.HamodrakasS. J. (2004) TMRPres2D: high quality visual representation of trans-membrane protein models.Bioinformatics203258–3260. 10.1093/bioinformatics/bth358
40
SunY.LinZ.ReindersA.WardJ. M. (2012) Functionally important amino acids in rice sucrose transporter OsSUT1.Biochemistry513284–3291. 10.1021/bi201934h
41
TarpleyL.VietorD. M. (2007) Compartmentation of sucrose during radial transfer in mature sorghum culm.BMC Plant Biol. 7: 33. 10.1186/1471-2229-7-33
42
WeschkeW.PanitzR.SauerN.WangQ.NeubohnB.WeberH.et al (2000) Sucrose transport into barley seeds: molecular characterization of two transporters and implications for seed development and starch accumulation.Plant J.21455–467. 10.1046/j.1365-313x.2000.00695.x
43
WilliamsL.ThomM.MaretzkiA. (1990) Characterization of a proton translocating ATPase and sucrose uptake in a tonoplast-enriched vesicle fraction from sugarcane.Physiol. Plant.80169–176. 10.1111/j.1399-3054.1990.tb04392.x
44
YamadaK.OsakabeY.MizoiJ.NakashimaK.FujitaY.ShinozakiK.et al (2010) Functional analysis of an Arabidopsis thaliana abiotic stress-inducible facilitated diffusion transporter for monosaccharides.J. Biol. Chem.2851138–1146. 10.1074/jbc.M109.054288
45
ZhaoY. L.DolatA.SteinbergerY.WangX.OsmanA.XieG. H. (2009) Biomass yield and changes in chemical composition of sweet sorghum cultivars grown for biofuel.Field Crops Res.11155–64. 10.1016/j.fcr.2008.10.006
46
ZhouY. C.QuH. X.DibleyK. E.OfflerC. E.PatrickJ. W. (2007) A suite of sucrose transporters expressed in coats of developing legume seeds includes novel pH-independent facilitators.Plant J.49750–764. 10.1111/j.1365-313X.2006.03000.x
Summary
Keywords
expression profiling, Sorghum, source–sink pathway, sucrose transporters, sucrose storage
Citation
Milne RJ, Byrt CS, Patrick JW and Grof CPL (2013) Are sucrose transporter expression profiles linked with patterns of biomass partitioning in Sorghum phenotypes?. Front. Plant Sci. 4:223. doi: 10.3389/fpls.2013.00223
Received
03 April 2013
Accepted
08 June 2013
Published
26 June 2013
Volume
4 - 2013
Edited by
Yong-Ling Ruan, The University of Newcastle, Australia
Reviewed by
Totte Niittylae, Swedish University of Agricultural Sciences, Sweden; Thomas L. Slewinski, Cornell Univeristy, USA
Copyright
© Milne, Byrt, Patrick and Grof.
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in other forums, provided the original authors and source are credited and subject to any copyright notices concerning any third-party graphics etc.
*Correspondence: Christopher P. L. Grof, School of Environmental and Life Sciences, University of Newcastle, University Drive, Callaghan, NSW, Australia e-mail: chris.grof@newcastle.edu.au
This article was submitted to Frontiers in Plant Physiology, a specialty of Frontiers in Plant Science.
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.