Abstract
Vitis vinifera vinifera is a hermaphrodite subspecies, while its ancestor, Vitis vinifera sylvestris, is dioecious. We have identified two genes that together allow the discrimination between male, female and hermaphrodite Vitis plants. The sex locus region on chromosome 2 was screened resulting in the discovery of a new gene, VviFSEX. The same screening revealed another gene, VviAPRT3, located in the sex region, that be used as a sex marker. Both genes are good candidates to be involved in flower sex differentiation in grapevine. To assess their role in sex specification, spatial and temporal expression analysis was performed. The expression of VviFSEX is detected in petals, stamens and carpel primordia of all flower types, making its putative function unclear; however, female plants display a single allele for this gene, while male and hermaphrodites display two alleles. On the other hand, the specific expression of VviAPRT3 in the carpel primordial of male plants suggests a possible role in the abortion of pistil structures. We propose a model to explain the carpel abortion in male flowers and the absence of stamen viability in female flowers. In addition, this work reinforces the presence of a sex locus on Vitis chromosome 2.
Introduction
The cultivated grapevine (Vitis vinifera subs vinifera) is a self-pollinating hermaphrodite subspecies and it co-exists naturally with its ancestor (Vitis vinifera subs sylvestris) in many habitats throughout the Mediterranean area. V. v. sylvestris is dioecious with male plants producing flowers with erect stamens and fertile pollen, but also display a reduced pistil with no style or stigma (but with nectaries), whereas the female flowers have a perfect formed pistil (with style and stigma) but reflexed stamens with infertile pollen (). Nevertheless, at early developmental stages, male and female flowers are morphologically indistinguishable from a hermaphrodite flower, becoming unisexual only at later development stages, due to organ ().
In grapevine the sex locus responsible for sexual dimorphism has been identified in previous genetic mapping studies (; ; ), and is located close to the genetic marker VviS3 () on chromosome 21. The genetic marker VviIB23, which was used essentially in mapping populations, is also associated to the sex locus (). More recently, a region of 143 kb on chromosome 2 (12x_v0), between 4,907,434 and 5,050,616 bp, was identified as being responsible for sex specification in V. v. vinifera (). Although several genes in this region were good candidates to be involved in flower sex differentiation, only one of them, ADENINE PHOSPHORIBOSYILTRANSFERASE (VviAPRT), was identified as a marker able to discriminate female from male/hermaphrodite plants (). VviAPRT gene was located on chromosome 2 of the V. v. vinifera physical map based on the reference genome PN40024 8x version2, but is absent from the current Vitis genome annotation1 (12x_v2.1). Another study reported a 158 kb region, containing the previous 143 kb with linkage disequilibrium and genes exhibiting XY type polymorphism, such as VviAPRT (). The latest annotation places this marker (VIT_200s1847g00010) on a set of unassigned scaffolds, referred in the Vitis database as “unknown chromosome.”
A chromosome 2 region (scaffold _154) was also identified as having homology with a section of the unknown chromosome (scaffold _233) in the 12x_v0 genome version (; ). It was hypothesized that this sequence on chromosome 2 corresponds to the female allele and the scaffold_233 sequence on the unknown chromosome corresponds to the hermaphrodite allele (). Therefore, the reference genome PN40024 would be heterozygous regarding the sex locus ().
APRT homologues in other species work as a key metabolic enzymes participating in cytokinin metabolism (; ). In addition to auxins, cytokinins have been shown to be important contributors for flower sex specification in Mercurialis (,). In Arabidopsis thaliana, AtAPRT1 mutants develop male sterility due to atypical pollen formation (; ). In V. v. sylvestris male plants, the exogenous application of a synthetic cytokinin [6-benezylamino-9-(2-tetrahy- dropyranyl)-purine] induces the development of hermaphrodite flowers and the production of viable pollen and normal fruits (). Therefore, VviAPRT could be a possible candidate gene involved in sex specification in V. v. sylvestris, potentially through its influence in cytokinin metabolism.
This work is an attempt to understand the role of VviAPRT3 gene in Vitis flower sex specification. Through in situ hybridization, in male, female and hermaphrodite flower tissues we determined the developmental stages and flower organs in which this gene is expressed. Additionally, a screening of the V. v. vinifera chromosome 2 allowed the identification of a new marker gene, VIT_202s0154g00200, (referred here as VviFSEX) that, in combination with VviAPRT3, allows the discrimination between male, female and hermaphrodite V. vinifera plants.
Material and Methods
Plant Sampling
For in situ hybridization and RT-qPCR, inflorescences at phenological developmental stages B, D, G, and H () were collected from all V. v. sylvestris parental individuals of a collection, composed by 22 female (F) and 11 male (M) individuals. The same developmental stages were sampled from 12 hermaphrodites V. v. vinifera cv. Touriga Nacional (Her) (Figure 1) in Dois Portos (Lisbon district, Portugal) developmental stages B–D could not be used due to the woody nature of their tissues. However, at later stages (D and subsequent) stages the plants have several developmental flower stages within the same inflorescence.
FIGURE 1
Individual closed and open flowers (without flower cap) were collected from the three flower types at the later stage H, and carpels were dissected from open flowers and used in RT-qPCR (Figure 1). Additionally, leaves from V. v. sylvestris and V. v. vinifera, were collected for DNA extraction. Samples were collected during April (2014 and 2015).
Nucleic Acids Extraction, cDNA Synthesis and Fragments Amplification
The DNA was extracted with the DNeasy® Plant Mini Kit (Quiagen, USA) following the manufacturer’s instructions. Total RNA was extracted with the SpectrumTMTotal RNA Kit (Sigma–Aldrich, Inc, USA) following the manufacturer’s instructions. The obtained DNA was stored at 4°C and the extracted RNA stored at -80°C between handling. The DNA and RNA concentration was determined using a Synergy HT Nanodrop system (Biotek, Germany), with the software Gen5TM (Biotek, Germany).
cDNA from male, female and hermaphrodite inflorescences from the four flower developmental stages, as well as cDNA from closed flowers, open flowers and from carpels (Figure 1), was synthesized with the RETROscript® kit (Ambion, Life Technologies, Spain), following the manufacturer’s protocol and amplified by PCR with specific primers (Table 1).
Table 1
| Target | Used | Orientation | Sequence (5′-3′) | Tm | |
|---|---|---|---|---|---|
| Intron | VviAPRT3 | Sex | Forward (F3) | TCTTTAGTATGAATGAATGTGC | 55°C |
| distinction | Reverse (R3) | AAACTCAGCCCTCCCTCA | 55°C | ||
| Exon | VviAPRT3 | RT-qPCR | Forward (F2) | GCATAGAAGCACGGGGTT | 55°C |
| In situ | Reverse (R1) | CATCAACTACCAAAGCACG | 55°C | ||
| Gene | Forward (F1) | AACCAGGGATTATGTTTCAAGA | 55°C | ||
| sequence | Reverse (R2) | CTTGCCATTCAATCGGTCACG | 55°C | ||
| Exon | VviFSEX | RT-qPCR In situ | Forward | GCCCAGTATGTTATTGATTTAG | 55°C |
| Sex distinction | Reverse | TTCTTGGTGAGCAGATTATT | 55°C |
Primers used for VviAPRT3 and VviFSEX (VIT_202s0154g00200) gene amplification.
Genomic VviAPRT3 primers, targeting an intron covering the 2x repeat were used to discriminate between flower types. cDNA VviAPRT3 primers, targeting four exons in total, were used in RT-qPCR analysis (F1 + R2), in situ probe synthesis (F1 + R2) and to determine the structure of the sequence (F1 + R1, F2 + R2, and F2 + R1, see Supplementary Figure 2). VviFSEX primers were used to discriminate between flower types, RT-qPCR analysis and in situ probe synthesis.
To determine the most efficient cDNA concentration to be used for RT-qPCR, a serial of decimal dilutions was tested. Amplification reactions were performed with two biological samples per phenological stage in triplicates containing 5 μL of master mix (SsoFast_EvaGreen Supermix, Bio- Rad, USA), 0.4 μM of specific primers and 0.21 μg of cDNA in a 20 μL reaction, according to
Identification of Gene Sequences
The sequence of ADENINE PHOSPHORIBOSYILTRANSFERASE (VviAPRT) gene was first obtained from Genoscope 8x genome version (GSVIVT00007310001)3. Since a blast with this gene sequence against Arabidopsis thaliana database (TAIR4) revealed great homology with AtAPRT3 (
Genomic DNA and cDNA sequences of VviAPRT3 and VviFSEX genes from the three flower types (male, female and hermaphrodite) were cloned into pGEM® T-easy vector system (Promega, Leiden, The Netherlands) and transformed into Escherichia coli DH5α competent cells. After plasmid isolation (PureLinkTM Quick Plasmid Miniprep Kit, Invitrogen, Carlsband, CA, USA) and sequencing, the sequences were aligned using Clustal Omega (
RNA In situ Hybridization
Plant tissue fixation, clearing, and in situ hybridization experiments were performed as previously described (
RT-qPCR Statistic Analysis
For the statistical analysis, expression values of VviAPRT3 and VviFSEX were transformed into log2 and tested through ANOVA using the program Graphpad Prism 5 (GraphPad Software, Inc.).
The samples with a p-value of the ANOVA lower than 0.05 were submitted to an additional Tukey test. The statistically significant differences were accepted when Tukey’s test p-value was lower than 0.05.
Results and Discussion
Vitis vinifera species display dioecious and hermaphrodite sexual systems, in which three types of flowers are observed: males and females in V. v. sylvestris and hermaphrodites in the cultivated subspecies V. v. vinifera. Male flowers are characterized by having long erect stamens and a reduced carpel without style or stigma, but with nectaries and ovaries (Figure 1). Female flowers have a complete carpel with style and stigma but short and reflex stamens (Figure 1) with infertile pollen (
VviFSEX: a New Female Sex Marker
Previous work suggests the existence of two alleles on chromosome 2 of V. v. vinifera due to the high homology of this region with one of the unknown chromosome (
FIGURE 2

Genomic amplification of VviFSEX and VviAPRT3 genes in a Vitis population. (A)VviFSEX male plants (M) and the hermaphrodite (Her) display two fragments of 449 bp (blue arrow) and 413 bp (red arrow). Female (F) plants display a 449 bp fragment. (B)VviAPRT3 in male plants (M) display two fragments, one of 611 bp (blue arrow) and another of 541 bp (red arrow). The hermaphrodite (Her) and the female plants (F) display a 542 bp fragment. These amplifications were performed in all 45 plants (22 female; 11 male and 12 hermaphrodites V. v. vinifera cv. Touriga Nacional). Fragments size was determined by sequencing. 1 Kb+, genetic molecular marker.
It is important to note that the existence of an unknown chromosome in the reference genome (PN40024) indicates that the annotation is not concluded and it requires an additional effort to improve gene chromosome assignment (
Spatial and Temporal Expression of VviFSEX
After establishing VviFSEX as a marker gene for flower sex in grapevine, its spatial and temporal expression was analyzed during the development of male, female and hermaphrodite flowers. We cloned and sequenced the cDNAs from the three flower types and we found that they are identical (data not shown). RT-qPCR analysis of VviFSEX in flower developmental stages B, D, G, and H showed constant abundance of transcripts in all the developmental stages with no significant variation between the three flower types (Figure 3A). All the flower types follow a bisexual development pattern during the three early stages of floral development sampled (B, D, and G), but unisexuality arises by organ abortion in late stage H, when the maturity of all flower organs takes place.
FIGURE 3

Absolute quantification by RT-qPCR of VviFSEX and VviAPRT3 transcripts during flower development. Expression of VviFSEX(A,B) and VviAPRT3(C,D) genes in all three flower types in four development stages (A,C) and in closed flowers, mature flowers (open flowers) and carpels (B,D). M, male (dark green); F, female (light green); Her, hermaphrodite (brown) in log2 (absolute quantification). Error bars represent standard error. Significant differences were tested through ANOVA and the samples with a p-value lower than 0.05 were submitted to an additional Tukey test. Differences were accepted when Tukey’s test p-value was lower than 0.05. Statistical differences were found in G developmental stage when comparing with the previous stage, in all flower types and are represented by a square box. (∗) represents significant differences (p < 0.05) when comparing the developmental stages between the three flower types.
The expression of VviFSEX was also analyzed in samples of later flowering stages ((closed flowers, open flowers and carpels (dissected from open flowers)) by RT-qPCR (Figure 1). We found that the expression level of VviFSEX is similar between female, male and hermaphrodite samples (Figure 3B). To evaluate the spatial expression pattern of VviFSEX in the different flower types, the transcript accumulation was analyzed in male, female and hermaphrodite flower sections by in situ hybridization. VviFSEX transcript was detected at early flower developmental stages in petal primordia and flower meristems in the three flower types (Figures 4A–C). When stamen primordia become evident, VviFSEX expression is observed in petals, stamens and in the carpel in all flower types (Figures 4D–F). Later in development, the expression remains in stamens and carpels but is no longer present in the petals (Figures 4G–I). The abundance and localization of VviFSEX transcripts is similar in the different flowers types of V. vinifera species. The analysis of VviFSEX protein sequence by the HMMER web server6 did not reveal significant homology with known proteins. However, we do not rule out a putative role of this gene in sex specification processes of grapevine due to its strong specific expression in the reproductive structures at later developmental stages. In fact, VviFSEX transcript is present in early stages in whorl 2, 3 and 4 but later in development it is retained in whorl 3 and 4 and excluded from whorl 2 (Figure 4). This may indicate that VviFSEX acts redundantly to form petals in early stages and stamens and carpels in late stages (Figure 4).
FIGURE 4

In situ hybridization of the VviFSEX gene in several flower developmental stages in three Vitis flower types. The transcript of VviFSEX gene is present in early flower developmental stages in male (A), female (B) and hermaphrodite (C) plants when the floral primordia display emerging sepals and/or petals. When stamens are visible VviFSEX is expressed in petals, stamens and carpel region, throughout the three flower types (D–F). Later, the gene transcript remains in stamens and in the carpel but seems to be absent from petals (G–I). Cutting planes are represented in (J–L) with the respective slide section outlined. Cuts were performed with 7 μm thick. Flowers structures: se, sepals; pt, petals; st, stamens; c, carpel. Scale bar = 100 μm.
VviAPRT3: a Maker for Male Plants
According to
VviAPRT3: a Putative Player in Vitis Sex Specification
To determine the spatio-temporal expression of VviAPRT3, the accumulation of transcripts was analysed in the four stages of flower development used in this work (B, D, G, and H) in male, female and hermaphrodite flowers of grapevine, by RT-qPCR and in situ hybridization (Figures 3 and 5).
FIGURE 5

Analysis of VviAPRT3 expression during early flower development by in situ hybridization in three Vitis flower types. Expression of VviAPRT3 in early developmental stages in male (A,D), female (B,E) and hermaphrodite (C,F) flowers. VviAPRT3 expression is visible in male flowers (in blue/pink) in the center of flower meristem where the carpel will emerge (A). When stamen primordia become distinguishable, the expression expands to the internal side of the stamens (D). Expression of VviAPRT3 could not be detected in female and hermaphrodite flowers in early flower development (C,D), although it becomes visible when stamens begin to emerge (E,F). Cutting planes are represented in (G–I) with the respective section outlined. Cuts were performed with 7 μm thick. Flowers structures: se, sepals; pt, petals; st, stamens; c, carpel. Scale bar = 100 μm.
The expression pattern of VviAPRT3, previously found in the transcriptomic analysis of grapevine flowers (
The spatio-temporal analysis of VviAPRT3 expression by in situ hybridization during early flower developmental stages, when floral meristems emerge, showed that this gene is expressed in the center of the male flower meristem, where the carpel primordia would arise (Figure 5A). The transcript accumulation of VviAPRT3 could not be detected in similar developmental stages of hermaphrodite and female flowers (Figures 5B,C). When male stamens primordia start to emerge, the expression of VviAPRT3 spans from the center of the flower to the inner sides of stamens (Figure 5D). At the same stage, in female and hermaphrodite flowers, the expression is very faint (Figures 5E,F), which is in agreement with the RT-qPCR results (Figures 3C,D). Later in development, when petals start to enclose the stamens and carpels, it is possible to visualize VviAPRT3 expression in carpel and stamens of male flowers (Figure 6A). At a similar stage, the mRNA of VviAPRT3 is almost undetectable in female and hermaphrodite flowers (Figures 6B,C). When sepals fully encapsulate the stamens and the carpels, VviAPRT3 expression is maintained in male stamens and carpels (Figure 6D). However, no detection of VviAPRT3 transcripts was observed in any flower organs of the female and hermaphrodite flowers, at the same stages (Figures 6E,F). Transversal sections of flowers show unambiguously the presence of VviAPRT3 transcript in male stamens and its absence in female and hermaphrodite flowers (Figures 6G–I).
FIGURE 6

Analysis of VviAPRT3 expression during late flower development by in situ hybridization in three Vitis flower types. Expression of VviAPRT3 in late developmental stages of male (A,D,G), female (B,E,H) and hermaphrodite (C,F,I) flowers. VviAPRT3 expression is visible (in blue/pink) in carpels and stamens of male plants (A,D). VviAPRT3 expression in the stamens is confined to the internal side (G). When petals start to enclose the sepals, VviAPRT3 expression is almost undetectable in female and hermaphrodite flowers (B,C, respectively) but completely disappears in later stages (E,H: female; F,I: hermaphrodite). Longitudinal sections (A–F); Transversal sections (G–I). The cut plane of transversal sections is on bud top above the carpel. Cutting planes are represented in (J–L) with the respective longitudinal section outlined. Cuts were performed with 7 μm thick. Flowers structures: se, sepals; pt, petals; st, stamens; c, carpel. Scale bar = 100 μm.
The apparent differences between RT-qPCR and in situ hybridization results at early stages B and D are due to the type of sample used and the nature of the technique. Each inflorescence phenological stage (
In Arabidopsis thaliana an homologous gene of VviAPRT3, AtAPRT1, is involved in reproductive development by playing an essential role during pollen development (
FIGURE 7

Schematic representation of VviAPRT3 expression in three developmental stages of Vitis flower development.VviAPRT3 is highly expressed in male plants in the 3rd and 4th whorl with a possible role in the arrest of carpel formation. Its absence in female and hermaphrodite flowers point for the presence of a gene (X) that inhibit VviAPRT3 in these flowers allowing the correct carpel formation. Additionally, the correct stamens development in male and hermaphrodite flowers and the reflexed stamens in female leads us to anticipate the possibility of another gene acting in the 3rd whorl that in female flowers make reflexed stamens (with unviable pollen).
Conclusion
In this work, we found two genes that when analyzed simultaneously can be a valuable resource in a breeding program, since they allow the distinction between V. vinifera individuals with different flower types, male, female or hermaphrodite. Although the molecular pathways leading to dioecy in grapevine are yet to be clarified, the information provided by this work suggests that VviAPRT3 may be a player in male sex specification. The presence of VviAPRT3 transcripts in the carpel primordia of male plants indicates a possible function in the arrest of this organ in male flowers. Its function in the third whorl of male flowers is unclear; however, the absence of its expression in the female and hermaphrodite flowers rules out a role in anther development, since its presence would be necessary in hermaphrodite flowers for proper stamen development. Additionally, the phenotype of female flowers suggests the activity of another gene that causes the abnormal stamen development of stamens.
Statements
Author contributions
JC, MR, and MC were involved in experimental design and interpretation of data; JC establish V. v. sylvestris collection and collected morphologic data; JC and HS performed experiments; JC wrote the manuscript; MR, MNR, HS, MC and SA reviewed and edited the manuscript; MR supervised experiments. All authors contributed to editing and approving the final version of the manuscript.
Funding
This work was supported by the funded project PTDC/AGR-GPL/119298/2010 from Fundação para a Ciência e Tecnologia, LEAF, Linking Landscape, Environment, Agriculture and Food (UID_AGR/04129/2013) and MMRCosta, MRocheta, JLCoito and MRamos by the fellowships SFRH/BSAB/113781/2015, SFRH/BPD/111249/2015, SFRH/BD/85824/2012 and SFRH/BD/110274/2015, respectively.
Acknowledgments
We are also grateful to Eng. Eiras-Dias from Instituto Nacional de Investigação Agrária e Veterinária, Dois Portos, for the collaboration in this work allowing the access to the Vitis collection.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The reviewer MC and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review.
Supplementary material
The Supplementary Material for this article can be found online at: http://journal.frontiersin.org/article/10.3389/fpls.2017.00098/full#supplementary-material
Footnotes
1.^http://genomes.cribi.unipd.it/grape/
2.^http://www.genoscope.cns.fr/externe/GenomeBrowser/Vitis/entry_ggb.html
3.^http://www.genoscope.cns.fr/externe/GenomeBrowser/Vitis/
4.^https://www.arabidopsis.org/
5.^http://genomes.cribi.unipd.it/gb2/gbrowse/public/vitis_vinifera_v2/
References
1
AllenM.QinW.MoreauF.MoffattB. (2002). Adenine phosphoribosyltransferase isoforms of Arabidopsis and their potential contributions to adenine and cytokinin metabolism.Physiol. Plant.11556–68. 10.1034/j.1399-3054.2002.1150106.x
2
BaggioliniM. (1952). Les stades repères dans le developpement annuel de la vigne et leur utilisation pratique.Rev. Rom. Agric. Vitic. Arbor.84–6.
3
CaporaliE.SpadaA.MarzianiG.FaillaO.ScienzaA. (2003). The arrest of development of useless reproductive organs in the unisexual flower of Vitis vinifera ssp silvestris.Acta Hortic.603225–228. 10.1007/s00497-003-0169-5
4
CarmonaM. J.ChaïbJ.Martínez-ZapaterJ. M.ThomasM. R. (2008). A molecular genetic perspective of reproductive development in grapevine.J. Exp. Bot.592579–2596. 10.1093/jxb/ern160
5
CoenE. S.RomeroJ.DoyleS.ElliottR.MurphyG.CarpenterR. (1990). Floricaula: a homeotic gene required for flower development in antirrhinum majus.Cell631311–1322. 10.1016/0092-8674(90)90426-F
6
DalbóM. A.YeG. N.WeedenN. F.SteinkellnerH.SefcK. M.ReischB. I. (2000). A gene controlling sex in grapevines placed on a molecular marker-based genetic map.Genome43333–340. 10.1139/g99-136
7
DurandB.DurandR. (1991a). Male sterility and restored fertility in annual mercuries, relations with sex differentiation.Plant Sci.80107–118. 10.1016/0168-9452(91)90276-E
8
DurandB.DurandR. (1991b). Sex determination and reproductive organ differentiation in Mercurialis.Plant Sci.8049–65. 10.1016/0168-9452(91)90272-A
9
FechterI.HausmannL.DaumM.SörensenT. R.ViehöverP.WeisshaarB.et al (2012). Candidate genes within a 143 kb region of the flower sex locus in Vitis.Mol. Genet. Genomics287247–259. 10.1007/s00438-012-0674-z
10
GaillardC.MoffattB. A.BlackerM.LaloueM. (1998). Male sterility associated with APRT deficiency in Arabidopsis thaliana results from a mutation in the gene APT1.Mol. Gen. Genet257348–353. 10.1007/s004380050656
11
GallardoA.OceteR.LópezM. ÁLaraM.RiveraD. (2009). Assessment of pollen dimorphism in populations of Vitis vinifera L. subsp. sylvestris (Gmelin) Hegi in Spain.Vitis J. Grapevine Res.4859–62.
12
IizukaM.HashizumeT. (1968). Induction of female organs in staminate grape by 6-substituted adenine derivatives.Japan. J. Genet.43393–394. 10.1266/jjg.43.393
13
JaillonO.AuryJ.-M.NoelB.PolicritiA.ClepetC.CasagrandeA.et al (2007). The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla.Nature449463–467. 10.1038/nature06148
14
LiW.CowleyA.UludagM.GurT.McWilliamH.SquizzatoS.et al (2015). The EMBL-EBI bioinformatics web and programmatic tools framework.Nucleic Acids Res.43W580–W584. 10.1093/nar/gkv279
15
MargueritE.BouryC.ManickiA.DonnartM.ButterlinG.NémorinA.et al (2009). Genetic dissection of sex determinism, inflorescence morphology and downy mildew resistance in grapevine.Theor. Appl. Genet.1181261–1278. 10.1007/s00122-009-0979-4
16
McWilliamH.LiW.UludagM.SquizzatoS.ParkY. M.BusoN.et al (2013). Analysis Tool Web Services from the EMBL-EBI.Nucleic Acids Res.41597–600. 10.1093/nar/gkt376
17
MoffattB.SomervilleC. (1988). Positive selection for male-sterile mutants of Arabidopsis lacking adenine phosphoribosyl transferase activity.Plant Physiol.861150–1154. 10.1104/pp.86.4.1150
18
MokD. W.MokM. C. (2001). Cytokinin metabolism and action.Annu. Rev. Plant Physiol. Plant Mol. Biol.5289–118. 10.1146/annurev.arplant.52.1.89
19
NegiS.OlmoH. (1966). Sex conversion in a male Vitis vinifera L. by a Kinin.Science1521624–1625. 10.1126/science.152.3729.1624
20
NegiS. S.OlmoH. P. (1971). Conversion and determination of sex in Vitis vinifera L. (sylvestris).Vitis9265–279.
21
PicqS.SantoniS.LacombeT.LatreilleM.WeberA.ArdissonM.et al (2014). A small XY chromosomal region explains sex determination in wild dioecious V. vinifera and the reversal to hermaphroditism in domesticated grapevines.BMC Plant Biol.14:229. 10.1186/s12870-014-0229-z
22
RamosM. J.CoitoJ. L.SilvaH. G.CunhaJ.CostaM. M.RochetaM. (2014). Flower development and sex specification in wild grapevine.BMC Genomics15:1095. 10.1186/1471-2164-15-1095
23
RiazS.KrivanekA. F.XuK.WalkerM. A. (2006). Refined mapping of the Pierce’s disease resistance locus, PdR1, and Sex on an extended genetic map of Vitis rupestris x V. arizonica.Theor. Appl. Genet.1131317–1329. 10.1007/s00122-006-0385-0
24
SieversF.WilmA.DineenD.GibsonT. J.KarplusK.LiW.et al (2011). Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega.Mol. Syst. Biol.7539. 10.1038/msb.2011.75
25
ValleauW. D. (1916). Inheritance of Sex in the Grape.Am. Nat.50554. 10.1086/279565
26
WhelanJ. A.RussellN. B.WhelanM. A. (2003). A method for the absolute quantification of cDNA using real-time PCR.J. Immunol. Methods278261–269. 10.1016/S0022-1759(03)00223-0
27
ZhangX.ChenY.LinX.HongX.ZhuY.LiW.et al (2013). Adenine phosphoribosyl transferase 1 is a key enzyme catalyzing cytokinin conversion from nucleobases to nucleotides in arabidopsis.Mol. Plant61661–1672. 10.1093/mp/sst071
Summary
Keywords
Vitis, hermaphrodite, dioecious, flower, gene marker, sex
Citation
Coito JL, Ramos MJN, Cunha J, Silva HG, Amâncio S, Costa MMR and Rocheta M (2017) VviAPRT3 and VviFSEX: Two Genes Involved in Sex Specification Able to Distinguish Different Flower Types in Vitis. Front. Plant Sci. 8:98. doi: 10.3389/fpls.2017.00098
Received
05 November 2016
Accepted
17 January 2017
Published
31 January 2017
Volume
8 - 2017
Edited by
Changbin Chen, University of Minnesota, USA
Reviewed by
Kashmir Singh, Panjab University, Chandigarh, India; Matthew Clark, University of Minnesota, USA
Updates

Check for updates
Copyright
© 2017 Coito, Ramos, Cunha, Silva, Amâncio, Costa and Rocheta.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Margarida Rocheta, rocheta@isa.ulisboa.pt
This article was submitted to Plant Genetics and Genomics, a section of the journal Frontiers in Plant Science
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.