ORIGINAL RESEARCH article

Front. Plant Sci., 25 April 2025

Sec. Plant Breeding

Volume 16 - 2025 | https://doi.org/10.3389/fpls.2025.1527866

Development of genome-wide SSR markers through in silico mining of guava (Psidium guajava L.) genome for genetic diversity analysis and transferability studies across species and genera

  • 1. Division of Fruits and Horticultural Technology, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • 2. Division of Genomic Resources, ICAR- National Bureau of Plant Genetic Resources, New Delhi, India

  • 3. Agricultural Knowledge Management Unit, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • 4. Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi, India

  • 5. Division of Biochemistry, ICAR- Indian Agricultural Research Institute, New Delhi, India

  • 6. Division of Agricultural Statistics, ICAR- Indian Agricultural Statistics Research Institute, New Delhi, India

  • 7. Division of Molecular Biology and Biotechnology, ICAR- Indian Agricultural Research Institute, New Delhi, India

  • 8. Department of Horticulture, PGCA, Dr. Rajendra Prasad Central Agricultural University, Pusa, Bihar, India

Abstract

Guava (Psidium guajava L.) is one of the economically major fruit crops, abundant in nutrients and found growing in tropical-subtropical regions around the world. Ensuring sufficient genomic resources is crucial for crop species to enhance breeding efficiency and facilitate molecular breeding. However, genomic resources, especially microsatellite or simple sequence repeat (SSR) markers, are limited in guava. Therefore, novel genome-wide SSR markers were developed by utilizing chromosome assembly (GCA_016432845.1) of the “New Age” cultivar through GMATA, a comprehensive software. The software evaluated about 397.8 million base pairs (Mbp) of the guava genome sequence, where 87,372 SSR loci were utilized to design primers, ultimately creating 75,084 new SSR markers. After in silico analysis, a total of 75 g-SSR markers were chosen to screen 35 guava genotypes, encompassing wild Psidium species and five jamun genotypes. Of the 72 amplified novel g-SSR markers (FHTGSSRs), 53 showed polymorphism, suggesting significant genetic variation among the guava genotypes, including wild species. The 53 polymorphic g-SSR markers had an average of 3.04 alleles per locus for 35 selected guava genotypes. Besides, in this study, the mean values recorded for major allele frequency, gene diversity, observed heterozygosity, and polymorphism information content were 0.73, 0.38, 0.13, and 0.33, respectively. Among the wild Psidium species studied, the transferability of these novel g-SSR loci across different species was found to be 45.83% to 90.28%. Furthermore, 17 novel g-SSR markers were successfully amplified in all the selected Syzygium genotypes, of which only four markers could differentiate between two Syzygium species. A neighbour-joining (N-J) tree was constructed using 53 polymorphic g-SSR markers and classified 35 guava genotypes into four clades and one outlier, emphasizing the genetic uniqueness of wild Psidium species compared to cultivated genotypes. Model-based structure analysis divided the guava genotypes into two distinct genetic groups, a classification that was strongly supported by Principal Coordinate Analysis (PCoA). In addition, the AMOVA and PCoA analyses also indicated substantial genetic diversity among the selected guava genotypes, including wild Psidium species. Hence, the developed novel genome-wide genomic SSRs could enhance the availability of genomic resources and assist in the molecular breeding of guava.

Introduction

Guava (Psidium guajava L.), a member of the Psidium genus, is an economically important fruit crop commercially cultivated in pan-tropical regions. It possesses a diploid chromosome number of 2n = 22 and a genome size of around 450 Mbp (Coser et al., 2012; Feng et al., 2021). Guava fruit contains substantial amounts of Vitamin A, Vitamin C, and Vitamin B complex, and mineral nutrients like iron, calcium, zinc, potassium, dietary fibres, and pectin (Hassimotto et al., 2005; Vijaya et al., 2020; Jamieson et al., 2022). Additionally, it also contains phenolic fractions viz., caffeic, catechin, ellagic, p-coumaric, rutin, and trans-cinnamic acids in different developmental stages and serves as bioactive compounds that have anti-diabetic, antioxidant, anti-cancer, and anti-inflammatory properties (Flores et al., 2015; Dos Santos et al., 2017; Shukla et al., 2021). Moreover, its seeds contain around 5-13% oil, which consists of a substantial amount of omega-3 and omega-6 fatty acids (Adsule and Kadam, 1995). Though it was brought to India by the Portuguese in the 17th century, guava has naturalized under Indian conditions due to its wider edaphic and climatic adaptability, and today India is a major guava-producing country globally, with an annual production of 5.35 million metric tons on approximately 358 thousand hectares of land (Ministry of Agriculture & Farmers Welfare (MoA&FW), 2024-25).

Due to the rising demand for guava fruit among health-conscious people, varietal developmental programs in guava have set different features viz., good fruit size with uniform shape, thick pulp with a small seed core that is embedded with fewer seeds having soft seed coats, good storage life, attractive peel and pulp colours, dwarf stature, high yielding efficiency, and tolerance/resistance to wilt and nematodes (Ray, 2002; Dinesh and Iyer, 2005; Dinesh and Vasugi, 2010; Kumar et al., 2020). Moreover, it is one of the perennial fruit trees and due to its allogamous nature (41% cross-pollination), its genetic background remains mostly heterozygous (Morton, 1987). Therefore, the trait-specific genetic improvement of guava is tedious and time-consuming through classical breeding (Thakur et al., 2021). These challenges in traditional breeding can be surmounted by utilizing biotechnological approaches, especially genomics such as genomic-assisted breeding (GAB) and marker-assisted breeding (MAB) which expedites guava improvement programs through the selection of genotypes at the seedling stage for traits of interest (Varshney et al., 2005; Kole et al., 2015; Baumgartner et al., 2016; Thakur et al., 2021). Molecular markers are key genomic tools in genetics and breeding that have been explored and utilized at every step of varietal development programs, including the evaluation of germplasm (Valdes-Infante et al., 2003; Rodriguez et al., 2007), trait-specific association mapping studies (Sheetal, 2010), hybridity estimation (Rao et al., 2008), QTL identification, linkage map construction, and marker-assisted breeding (Ritter, 2012; Maan et al., 2023). Among the two types of molecular markers (dominant and co-dominant), co-dominant markers can differentiate between homozygous and heterozygous individuals (Zhao and Kochert, 1993). Therefore, they are preferred in genetics and breeding studies of many crop species. Among the co-dominant DNA-based markers, SSR or microsatellite markers are the most accepted robust markers in crop species due to their easy scoring, high reproducibility, and high cross-species transferability (Collard et al., 2008; Kumar et al., 2020). While EST-SSR markers are valuable for genetic analysis, they come with certain limitations like low polymorphism levels and a tendency to concentrate in gene-rich regions of the genome, which may restrict their utility, especially in constructing linkage maps (Temnykh et al., 2000). Here, the importance of genome-wide SSR markers (g-SSR) increases in such analyses due to their whole genome coverage (Powell et al., 1996). Despite these advantages, only a limited number of g-SSR markers are reported in guava, and barely a small set of validated g-SSR markers are present in the public domain (Kumar et al., 2020; Thakur et al., 2021; Kumar et al., 2023).

Previously, microsatellite markers were developed by constructing microsatellite-enriched libraries involving selective hybridization including standard procedures for identifying microsatellite sequences using biotin-labelled probes (Edwards et al., 1996; Kumar et al., 2020). This method is robust and reproducible, but time-consuming and costly (Santana et al., 2009; Luo et al., 2020). Nowadays, next-generation sequencing (NGS) helps uncover the complete genome structure of various crops, improving our understanding of developing molecular markers. NGS has been used for sequencing many fruit trees like Vitis vinifera (Jaillon et al., 2007), Carica papaya (Ming et al., 2008), Malus × domestica (Velasco et al., 2010), Fragaria vesca (Shulaev et al., 2011; Hirakawa et al., 2014), Prunus mume (Zhang et al., 2012), Prunus persica (Verde et al., 2013), Pyrus bretschneideri (Wu et al., 2013; Chagné et al., 2014), and Mangifera indica (Wang et al., 2020). The genome sequence information is also available for Myrtaceae family members, including Eucalyptus grandis (Myburg et al., 2014), Leptospermum scoparium (Thrimawithana et al., 2019), Chinese guava cultivar “New Age” (Feng et al., 2021) and Indian guava cultivar “Allahabad Safeda” (Thakur et al., 2021) in the NCBI database. The genomic resources in guava are available in the form of chromosome assembly, draft sequences, RNA sequences, etc., in the NCBI database, which could serve as a basis for the identification and development of microsatellite markers. Moreover, various bioinformatical softwares have been developed for automated SSRs detection and the development of microsatellite markers using these sequences viz., TRF (Benson, 1999), MISA (Beier et al., 2017), and SciRoko (Kofler et al., 2007). But these tools often have long runtimes or cannot handle whole-genome analyses (Sharma, 2007). Furthermore, the statistical analyses provided by software like TROLL (Castelo et al., 2002) are very limited. Some tools, such as SSRLocator (Maia et al., 2008), are platform-specific and only run on Microsoft Windows, which is not ideal for handling large datasets. Command-line tools like MISA (Beier et al., 2017) lack graphical interfaces, posing difficulties for non-bioinformaticians. Moreover, CandiSSR (Xia et al., 2016) and SSRPoly (Duran et al., 2013) are inefficient for marker design due to their slow performance and reliance on existing primer design tools. Despite the availability of many tools, none provide a complete set of operations for identifying “SSRs”, analysing these “SSRs” ‘ distribution across the entire genome, designing SSR primer pairs, and polymorphism screening of developed markers through e-PCR algorithm like GMATA (Wang and Wang, 2016). Therefore, mining these genomic sequences, identifying the microsatellite sites, developing genome-wide microsatellite markers, and validation through diversity studies including their cross-species and genus transferability is targeted in the present study.

Materials and methods

SSR mining and statistical analysis of identified SSRs

For genome-wide SSR mining, the chromosome assembly of Psidium guajava cultivar “New Age” (Feng et al., 2021) - GCA_016432845.1 was used as a reference database, and it was downloaded from the NCBI database in FASTA format (https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_016432845.1/). This sequence was used as an input for GMATA (Genome-wide Microsatellite Analysing Toward Application) software (Wang and Wang, 2016). To enhance SSR mining, GMATA implemented a technique that entailed partitioning the sequence (which had a default length exceeding 2 Mbp) into smaller segments to expedite the operation. To ensure accurate identification of SSRs at the sequence borders, a brief overlapping region of 20 base pairs (bp) was added to the end of each segment by default. The SSR units, consisting of nucleotides G, C, A, and T, were calculated dynamically as a motif library of specified lengths using metacharacters and a regular expression patterning method in Perl version 5. Perl’s pattern-matching method was utilized to identify recurring patterns, and the obtained data was then employed to generate information regarding SSR loci. After identifying SSRs in the genomic DNA sequence, a separate output file was generated. It provided detailed information on the SSR loci, including their start and finish positions, the number of repetitions, and the motif on each chromosome. Using this file, the statistical module of this software generated a new file that provides statistical information about motif type, motif composition, grouped complementary motifs, SSR distribution, and SSR length. This study specifically focused on motif type, motif composition, and SSR length for in silico analysis.

Designing of markers and in silico polymorphism scoring

The primer designing module of GMATA used the SSR loci along with their original DNA sequences to generate primer pairs. The marker was mapped digitally with simulated PCR using e-PCR in GMATA to generate the amplicon and identify allele sizes. This e-mapping module required the presence of a DNA sequence file of Psidium guajava and a marker file as inputs. Upon executing the application, a report file was generated, which includes detailed information regarding the e-PCR findings of markers for each chromosome. Polymorphism was evaluated by assigning scores to amplified fragments from each marker in the genome according to their size. Furthermore, a summary report was also generated, offering a detailed analysis of allele distribution for all markers, the total sequences with mapped markers, the overall number of mapped markers, the total number of amplified fragments, and the average number of fragments per mapped marker.

Synthesis of primer pairs

After in silico analysis, a total of 75 markers were selected from 11 chromosomes of guava for further analysis. At least five primer pairs (forward & reverse primers) from each chromosome were selected. Some important factors were considered during the selection of primer pairs viz., the microsatellite regions should have at least five or more motif repeats, the GC content of the selected primers should be between 40 to 60%, and the annealing temperature (Ta) of the primer pairs should range from 56 to 60°C. After synthesizing the novel g-SSR (FHTGSSRs) primer pairs, a stock solution of 100 pmol was also prepared based on their molecular weight by adding the required amount of TE buffer. To prepare a working sample, 10μl of each forward and reverse primer stock solution was mixed with 90μl of Milli-Q® lab water separately in a 1.5 ml centrifuge tube. Finally, the diluted and stock samples were stored at 4°C and -20°C respectively.

Plant materials

A total of 35 guava genotypes, including commercial guava cultivars, exotic varieties, and wild Psidium species, were selected for diversity and cross-species transferability studies. Besides this, three accessions of Syzygium cumini and two accessions of Syzygium fruticosum species were also chosen to confirm the cross-genera transferability of newly designed genome-wide SSRs (Table 1). The leaf samples from the selected guava genotypes were collected from the guava field gene bank at the Division of Fruits and Horticultural Technology, ICAR-IARI, New Delhi (28°38’54”N,77°09’12”E), whereas leaves of five jamun genotypes were collected from the plantation area of the IARI campus, New Delhi (28°38’25.0”N, 77°09’54.2”E).

Table 1

S. No.GenotypeType
1Allahabad SafedaCommercial Cultivar
2Allahabad Safeda VariantCultivar
3Hisar SafedaCommercial Cultivar
4L-49Commercial Cultivar
5ShwetaCommercial Cultivar
6ThaiCommercial Cultivar
7Pusa PratikshaCultivar
8Pant PrabhatCultivar
9Red SelectionCultivar
10LalitCommercial Cultivar
11Punjab PinkCultivar
12Hisar SurkhaCommercial Cultivar
13Red DiamondCultivar
14Arka KiranCommercial Cultivar
15Pusa AarushiCultivar
16Purple GuavaCultivar
17Guava Seedling-1Unknown seedling
18Guava Seedling-2Unknown seedling
19Guava Seedling-3Unknown seedling
20Guava Seedling-4Unknown seedling
21Guava Seedling-5Unknown seedling
22Seedling of Hong Kong WhiteExotic cultivar
23Seedling of Pink AcidExotic cultivar
24Seedling of Thailand SeedlessExotic cultivar
25Seedling of PearExotic cultivar
26Seedling of 138-TExotic cultivar
27Seedling of Gushiken SweetExotic cultivar
28Seedling of Klom AmpornExotic cultivar
29Psidium quadrangularisWild species
30Psidium cattleianumWild species
31Psidium cattleianum variantWild species
32Psidium pumilumWild species
33Psidium pumilum variantWild species
34Psidium molleWild species
35Psidium guineenseWild species
36Syzygium cumini Seedling-1Jamun Seedling
37Syzygium cumini Seedling-2Jamun Seedling
38Syzygium cumini Seedling-3Jamun Seedling
39Syzygium fruticosum Seedling-1Jamun Seedling
40Syzygium fruticosum Seedling-2Jamun Seedling

List of selected genotypes.

Genomic DNA extraction and quality check

Three to four fresh, young, tender, and disease-free leaves were collected from each selected guava and jamun genotype. After that, the leaves were cleaned with 70% alcohol, wiped with tissue paper, wrapped in aluminium foil, and brought to the laboratory in cold boxes. The samples were properly labelled and stored at –80°C in a deep freezer until DNA extraction. DNA extraction of genotypes was done through the CTAB method with slight modification (Doyle and Doyle, 1987), where the DNA extraction buffer consisted of 2.5% w/v CTAB, 1M Tris HCl (pH 8.0), 0.5 M EDTA (pH 8.0), 4M NaCl, 3% PVP w/v, and 0.3% Beta-mercaptoethanol. A NanoDrop™ spectrophotometer (Thermo Fisher, USA) was used to measure the DNA concentration of genotypes. DNA samples with an A260/280 ratio between 1.7 to 1.9 and a concentration >250 ng/µL were selected for this investigation. Besides, the quality of the isolated genomic DNA was checked on 0.8% agarose gel. After assessing the quantity and quality of each DNA sample of the selected genotypes, the DNA concentration was diluted with TE buffer to achieve a working concentration of 20 ng/µl. The diluted samples were kept at 4°C for immediate use, while the stock of primers was stored at -20°C until further use.

SSR profiling

A ready-to-use reaction mixture-OnePCR™ (GeneDireX, Inc), which contains Taq DNA polymerase, PCR buffer, dNTPs, and loading dye, was utilized to optimize the PCR conditions. The annealing temperature for each g-SSR primer pair was determined using a gradient PCR process where the annealing temperature was kept between 50 to 60°C for one minute. Then PCR conditions for SSR profiling were set on an initial denaturation at 94°C for five minutes, followed by 36 cycles of denaturation at 94°C for 30 seconds, annealing at a temperature specific to each SSR primer (determined by gradient PCR), extension at 72°C for one minute, and a final extension at 72°C for 10 minutes. The final reaction mixture for the PCR process was maintained at 16μl, comprising 2.5μl of genomic DNA, 6μl Master Mix (1x), 1μl each forward and reverse primers, and 5.5μl nuclease-free double-distilled water. The resulting PCR amplified products and a DNA ladder (DNAmark™ 100 bp) were loaded onto a 2.5% agarose gel containing ethidium bromide (18μl/500 ml) in 1x TAE buffer. The gel electrophoresis was run at a steady voltage of 5 V/cm for about three hours. The DNA profiles were then visualized under a gel documentation system (Gel Luminax, Zenith).

Data scoring and analyses

The amplicon of each SSR was scored visually among the selected genotypes. All SSRs were assessed for clear, reproducible, and distinct monomorphic and polymorphic bands. Genetic diversity indices, including major allele frequency (MAF), allele frequency, allele count (An), gene diversity (GD) or expected heterozygosity (He), observed heterozygosity (Ho), and polymorphism information content (PIC) for each g-SSR, were calculated with Power Marker v3.25 (Liu and Muse, 2005). A Neighbor-Joining (NJ) tree was also generated using Power Marker v3.25 (Liu and Muse, 2005). Additionally, the population structure analysis of guava genotypes was performed by Structure v2.3.4 (Pritchard et al., 2000). Population structure was determined through Structure Harvester (Earl and VonHoldt, 2012) using the Evano method. Moreover, GenAlEx v6.5 (Peakall and Smouse, 2006) was used for the Analysis of Molecular Variance (AMOVA) and Principal Coordinate Analysis (PCoA) of the guava genotypes.

Results

SSR mining and statistical analysis of SSRs

A total of 397.8 Mbp of the guava genome sequence was analysed using the GMATA software, and 92,404 SSR loci were identified (Supplementary Table 1). The number of chunking sites varied from 11 (chromosome 9) to 17 (chromosomes 3 and 4), while the total number of SSR loci per chromosome varied from 6696 (chromosome 9) to 10475 (chromosome 3). The dimer-type motifs (>75%) were found to be the highest, followed by trimer-type motifs (>15%) in every chromosome of the guava genome (Figure 1). Among dimers, mostly “TC” (~13.5%) motif compositions were identified in every chromosome except chromosome-1 and chromosome-11, where the most common type motif was “GA” (~13.7%) and “AG” (~12.9%), respectively. Among trimers, mostly “AAT” (~1.4%) motif compositions were found in every chromosome (Supplementary Figure 2).

Figure 1

Selection of primer pairs through in silico analysis

A total of 87,372 SSR loci were used by GMATA software for SSR markers designing, resulting in 75,084 novel SSR markers mined, spanning the genome of guava. Using the e-PCR algorithm, the average number of alleles was 2.78 per locus for the 75,084 SSRs. The highest and lowest numbers of markers were observed in chromosome 3 (8613) and chromosome 9 (5489), respectively (Supplementary Table 2). The highest average number of alleles per SSR marker was registered in chromosome 4 (3.20 alleles/SSR marker). After in silico analysis and genome-wide SSR mining, 75 novel g-SSR markers were selected for this study where trimer motif repeats were mostly used (Figure 2; Supplementary Figure 3).

Figure 2

Screening of novel g-SSR markers

Of the 75-novel g-SSR markers, 72 showed reliable amplification in gradient PCR and were considered suitable for molecular profiling of guava genotypes due to their consistent amplification patterns. The amplification size of alleles varied between 110 to 620 bp amongst the selected g-SSR primer pairs (Table 2). However, three g-SSR markers showed no satisfactory amplification, even after repetitive PCR reaction optimisation attempts. All the selected wild species showed cross-species transferability for 28 g-SSR markers (FHTGSSR-3.1, FHTGSSR-3.2, FHTGSSR-2.3, FHTGSSR-3.4, FHTGSSR-3.5, FHTGSSR-3.8, FHTGSSR-4.4, FHTGSSR-4.5, FHTGSSR-4.6, FHTGSSR-5.1, FHTGSSR-5.4, FHTGSSR-5.5, FHTGSSR-5.6, FHTGSSR-5.8, FHTGSSR-6.2, FHTGSSR-6.7, FHTGSSR-6.9, FHTGSSR-7.1, FHTGSSR-7.4, FHTGSSR-7.5, FHTGSSR-7.9, FHTGSSR-8.2, FHTGSSR-8.4, FHTGSSR-9.1, FHTGSSR-9.2, FHTGSSR-10.3, FHTGSSR-11.3, FHTGSSR-11.5). In contrast, a total of 55, 43, 33, 64, 65, 62 and 63 novel g-SSR markers were amplified in P. quadrangularis, P. cattleianum, P. cattleianum variant, P. pumilum, P. pumilum variant, P. molle and P. guineense respectively (Supplementary Table 3).

Table 2

S.
No
Marker NameC.NMarker SequenceTa(°C)MotifRepetitionsExpected Product Size (bp)Observed Product Size(bp)Remark
1FHTGSSR-1.21F-GCAAAAGGTGGGATCTAGCA
R-CAGTCTTCCAGGGACACCAT
59AAG6277290-300Polymorphic
2FHTGSSR-1.31F-GGGAGAGGGAGAGAAAATGG
R-CAAATGAGCCAAAACAGCAA
55AG25364290Monomorphic
3FHTGSSR-1.41F- AAAACAGTCGGGTGCATTTC
R-CAGGAGGCAGTCACCTTAGC
59TC5367360-380Polymorphic
4FHTGSSR-1.51F-GTGAAGGAAGCTTGGATGGA
R-TGATGCTTGAAAATGCGAAC
52.6AATAT7395380-440Polymorphic
5FHTGSSR-2.12F-ATGAAACAGCGGATGAACCT
R-TCACCCAGCGAAACCTTATC
59.2GA20157140-200Polymorphic
6FHTGSSR-2.22F-CCGACACGCCATTAGAAGAT
R-TAGCGTGCACAGAATTACGG
52.6GAG5360350-370Polymorphic
7FHTGSSR-2.32F-TCGAAACCACAACCAACAAA
R-ACCTGCATGTGGCTTTTACC
55CAA5139140Monomorphic
8FHTGSSR-2.42F-ACGAATCGAGTCTTGGCATT
R-CGCAATTGGATTGATGTTTG
50.7TC32338250-370Polymorphic
9FHTGSSR-2.52F-TCAGGCATTCTGGTGATGAA
R-TCGATGAACCCAAAGTGAAA
59.2TTTA6288290Monomorphic
10FHTGSSR-2.62F-GACGAAGGCGAAGATGAAGA
R-GCGACAAATCACACAAAAGG
65GAAGAT5273280-380Polymorphic
11FHTGSSR-3.13F-GTCGAAGAGATCAGGGCATC
R-AAACAGCCCAGCAATTCATC
50.7AGC5378350-380Polymorphic
12FHTGSSR-3.23F-ACACCCGTGCAAGAAGAAGT
R-GATGGGCTTTAGTGGGTTGA
59.2CAG5309300-400Polymorphic
13FHTGSSR-3.33F-GGAAAGAGTGCGAATTACGG
R-GCTGGAGAATTGGATTGGAA
59.2CCT8342360-370Polymorphic
14FHTGSSR-3.43F-CTCCCATCCTCTGTCTCTGC
R-CACGAGAAGGGGCTTTACTG
58.3CTCCCT5330340-350Polymorphic
15FHTGSSR-3.53F-CGACTTTTGGGTGAAAGGAA
R-ACTTTGCTTGGTGAGGGAAA
58.3GA10340360-380Polymorphic
16FHTGSSR-3.63F-TTCCGACAGCGTCAAGAATA
R-CATGCAATCAGGCAGAGAGA
59.2AG16214190-210Polymorphic
17FHTGSSR-3.73F-CAAAGGGTAGGTGGGGAAAT
R-ATCAGGAAGGACGCTGAAGA
59.2TC21398380-420Polymorphic
18FHTGSSR-3.83F-GGGTTAGAGCGTCGTGACAT
R-GCTGTTGATGCAAGTGGAGA
59.2TAA14226210-280Polymorphic
19FHTGSSR-3.93F-AGCGGCAACATCAAGAAGAT
R-CCTTCTATTCGGTTCCGTGA
45.7AAT13367360Monomorphic
20FHTGSSR-4.14F-CCCATTCTCTTGCATCGAGT
R-GCAATGTTCTTACGCCAACA
59.2GCCAGTT5366340-380Polymorphic
21FHTGSSR-4.24F-CAAATCAGCGACTCAACCAA
R-AAATGTCGTCGTCCTCTTCG
59.2GCA6395400-440Polymorphic
22FHTGSSR-4.34F-GCTTAGGTGTGCTCCTGGTC
R-GGTCTCGGATGCAATCAACT
58.3TGTA6200210Monomorphic
23FHTGSSR-4.44F-TTCAATTTCGGGTTGACACA
R-AACCCACTTTCTAGGCAGCA
58.3CT11279280-340Polymorphic
24FHTGSSR-4.54F-TCATCGGACATTCCAAGACA
R-TTGCACCAAAGACAGTTTGC
59.2GA28259200-280Polymorphic
25FHTGSSR-4.64F-CGTGCCCTTTATGACCCTTA
R-ATGCCACTAAGGTCCACGTC
59.2TC15169170-190Polymorphic
26FHTGSSR-4.74F-CCTCTGACCTCGAGCTTGTC
R-GACAACCTTGCTGGACCTGT
50ATA11318300-380Polymorphic
27FHTGSSR-4.84F-CAACCGGCCAGAGGTATAGA
R-GCCAAAGGAGGAAGAAGAGG
59.2TTTC9363350-360Polymorphic
28FHTGSSR-5.15F-CCTGGCTCAAAGTTGGGATA
R-ACAAGGCTGTGGGATGTTTC
51.5TC28339360-400Polymorphic
29FHTGSSR-5.25F-CCATCTCCATCTCCATCTCC
R-TTGTTCCCTCCTCAATCTCG
64.7AAG6386400Monomorphic
30FHTGSSR-5.45F-CAGCGCATTCGACAGAAATA
R-TGCTTGGAAGGCAATTATCC
51.5AAT5397400Monomorphic
31FHTGSSR-5.55F-CGATCATCTACACCCGAACC
R-CTACGTGAGGCCATTCAACA
50ATTT5298300Monomorphic
32FHTGSSR-5.65F-TTTTACTGTTTGGGCCTTGG
R-GCGCTCCTAATTGCATCTCT
45.7AG15319300-320Polymorphic
33FHTGSSR-5.75F-GTTGCCACTACCCCAAGAGA
R-ATCCAGGTTGTGAAGGATGC
50GA15330300-390Polymorphic
34FHTGSSR-5.85F-TTCTCATTCAGGTGGGGTTC
R-CTCCTCTTTCGATCGTCCAG
59.7GAA11354360Monomorphic
35FHTGSSR-5.95F-GCGCAACAAGAATGGATGTA
R-CCTCCTTGTGCTTTCTCCAC
59.7TTA12360320-380Polymorphic
36FHTGSSR-6.16F-CGGATGCAACCTTTCATTTT
R-CGGTTCAAAATCGGCACTAT
55AAAT5154120-240Polymorphic
37FHTGSSR-6.26F-CTCCATCCCCACTCCAAGTA
R-GCATTGGCGAAGTCCACTAT
50AAT6388390 = 410Polymorphic
38FHTGSSR-6.36F-AAGCGGAGAAACCCTACGAT
R-TGTTGGTGACGTTCTTTCCA
52.6CT16358320-380Polymorphic
39FHTGSSR-6.46F-TACATGCCGTCAAGGTTTCA
R-GCTTGCACGTTGGTTTCTCT
52.6TC12257340-360Polymorphic
40FHTGSSR-6.56F-AGCCCATCGTCTCCTACCTT
R-ACGGTCAGAACCCACAAGTC
57.2AGG7354380Monomorphic
41FHTGSSR-6.66F-TAGCGAAGCAAGAGCATTGA
R-ATGGCACGGTTTGGCTTACT
54AT11247210-280Polymorphic
42FHTGSSR-6.76F-TGGGCTGAAGAAATCCACTC
R-TTTTATTGTGGGCCCTTGAC
54AG10331340-360Polymorphic
43FHTGSSR-6.86F-CTAGGTCAATTGCGGGGATA
R-ACAGAAGACGAATGCCTGGA
57.2TTA11319300-360Polymorphic
44FHTGSSR-6.96F-GGAAAGGCATTTTCGTCCTT
R-CAACCTCTCGGAAGATTTGC
57.2CTCCC7198180-600Polymorphic
45FHTGSSR-7.17F-TGCGACGGTATCGATGTAAG
R-CCTGCCCGAATATAAAGCAA
52.6TTC7176180-190Polymorphic
46FHTGSSR-7.27F-ACGATTTTAGATGCGCTCGT
R-GGCTAGTTCATTTCGGCATC
57.2AAT6266280Monomorphic
47FHTGSSR-7.37F-GGTGATCTACGTTCCGCATT
R-CCTTTGCCATCCATGTCTTT
52.6GT7384380-400Polymorphic
48FHTGSSR-7.47F-TTCGACACTCTTCGACATGC
R-TGTGACACGACACGACACAT
52.6AAG6379180-400Polymorphic
49FHTGSSR-7.57F-TGAAATCCCCATGACCTGTT
R-ATGTGCAGGCATTTTGAGTG
50.7CATCAA5394110-390Polymorphic
50FHTGSSR-7.67F-GACTAAGGACGTCGCGTTTC
R-CCCGTTCAATCGACATTTCT
54TA17238220-270Polymorphic
51FHTGSSR-7.77F-GGCTCAAGGAAGCACTGAAC
R-GCGCGTCGATCTCTTTCTAC
54GA15208180-200Polymorphic
52FHTGSSR-7.87F-GAAAGCGAACCTGGACTCAC
R-TTCGTGGAATTCACCATTGA
57.2TTA15308280-320Polymorphic
53FHTGSSR-7.97F-CTCCGATCGAAACCCTATCA
R-CACACCTACGTCTGCTTGGA
57.2CTT7313310Monomorphic
54FHTGSSR-8.18F-GCCAATTCCACTCGAAAATC
R-CTCAACCACCTTTTGCTGCT
50.7TC7351360-380Polymorphic
55FHTGSSR-8.28F-GGTTGCTTCCTGCATGATTT
R-GAAAACCCCAACAGGACTGA
55.7AAG5194190-200Polymorphic
56FHTGSSR-8.38F-CAAACCGACCCAATTTGAAG
R-GGGTCAAACCAATGAATGTG
55.7AAT17334330Monomorphic
57FHTGSSR-8.48F-CAGGATGCATGGTTTGACAG
R-TCCAGACCAAACAGCAGAGA
52.6TTA5388400-600Polymorphic
58FHTGSSR-8.58F-GGTAAGTTGCCGAAGGTTGA
R-TGCGCAGCTTGATTTATTTG
52.6CGG8357360-380Polymorphic
59FHTGSSR-9.19F-GCTGGGCGCTATTACTTGAG
R-GTGACACGTGGCTTGTTGAC
59.2TTA14128100-140Polymorphic
60FHTGSSR-9.29F-ACCAGTCGTGTTCCCTAACG
R-CTAGGACGACCCCTGCATAA
55.7TCT5376380-400Polymorphic
61FHTGSSR-9.39F-TCTGGCCAAAGAAAATCTGC
R-GCCCATTATCACGCCTTAGA
54AAT5364370Monomorphic
62FHTGSSR-9.49F-TGTCGGTGAAGAGCTTCCTT
R-TTACTGTGCGACGTCCTCCT
55.7GAA5214220Monomorphic
63FHTGSSR-9.59F-CGGACCTCGTGTCACCTTAT
R-GGGAGGTAAATGAGTGGGCTA
59.2TC5303305Monomorphic
64FHTGSSR-10.210F-ATGGGCTTGACTTTGACTGG
R-GAGGGTGCGTTTATTCGAGA
59.7TAA5341350Monomorphic
65FHTGSSR-10.310F-GAAAGGGGTCCAAGTTCCTC
R-CCGCAGGCTTCTACTGTTTC
59.7AAG5366360-380Polymorphic
66FHTGSSR-10.410F-GAGATTGGAACGCACCTGAT
R-TACATAATGCCCATGGATGC
59.7AAT8380380-450Polymorphic
67FHTGSSR-10.510F-GGTGCTTCTTCTTCGACCTG
R-AAGCTCGTCCTCTCGACTTG
59.7GAA5134130Monomorphic
68FHTGSSR-11.111F-CCCTAAACCCTAAACCCTAAACC
R-GGAGAACATGTGTTTGGCTTATC
57.2ACCCTAA9372200-320Polymorphic
69FHTGSSR-11.211F-CTTGGCAGTGTTACGTGTCG
R-GGATGATAGCGCAGCCATAG
54AG6303280-350Polymorphic
70FHTGSSR-11.311F-CTATGCCGGAGGTCATGTCT
R-TTTTGGTGGAAACTCCATGTC
55.7GA8400400Monomorphic
71FHTGSSR-11.411F-TAGGAGCGGTAGGTTTCACG
R-TCGTTGACGTGCTAATCGTC
57.2AAG6355370-380Polymorphic
72FHTGSSR-11.511F-TCCGGTGTTACAGGTCCTTC
R-CATGCCGCTCACTTCAAATA
52.6TTA6140150-180Polymorphic

Information about 72 novel amplified g-SSR markers.

Here, C.N., Chromosome Number; Ta, Annealing Temperature

Diversity analysis

Out of 72 amplified novel g-SSRs, 53 markers were able to produce polymorphic amplicons (Figure 3; Supplementary Figure 4), while 19 markers were found monomorphic among the selected 35 guava genotypes. The guava genotypes were thoroughly molecularly characterised, and genetic diversity was analyzed using these 53 polymorphic g-SSRs. A total of 161 alleles were amplified by 53 g-SSR markers among the selected 35 guava genotypes. Each primer pair yielded 3.04 alleles on average, with the allele number ranging from 2 to 7 per locus. In this study, the highest PIC value was found 0.774 for FHTGSSR-4.5, though the average PIC for 53 polymorphic g-SSR markers was 0.331. Furthermore, average major allele frequency expected heterozygosity, and observed heterozygosity were measured at 0.725, 0.375, and 0.128 respectively (Table 3).

Figure 3

Table 3

MarkerMAFAllele No.HeHoPIC
FHTGSSR-1.20.9702.00.0590.0000.057
FHTGSSR-1.40.5612.00.4930.8790.371
FHTGSSR-1.50.8133.00.3200.1250.294
FHTGSSR-2.10.6884.00.4800.2810.435
FHTGSSR-2.20.8532.00.2510.0000.219
FHTGSSR-2.40.6185.00.5710.1760.534
FHTGSSR-2.60.5763.00.5490.6060.468
FHTGSSR-3.10.8573.00.2510.0570.231
FHTGSSR-3.20.8713.00.2300.0860.213
FHTGSSR-3.30.9382.00.1170.0630.110
FHTGSSR-3.40.6572.00.4510.0000.349
FHTGSSR-3.50.8862.00.2020.1140.182
FHTGSSR-3.60.4523.00.6200.3870.541
FHTGSSR-3.70.6883.00.4770.1250.427
FHTGSSR-3.80.4574.00.6390.1140.567
FHTGSSR-4.10.7583.00.3890.0000.347
FHTGSSR-4.20.9382.00.1170.0000.110
FHTGSSR-4.40.5434.00.6160.0000.559
FHTGSSR-4.50.2716.00.8020.1140.774
FHTGSSR-4.60.6572.00.4510.0000.349
FHTGSSR-4.70.3447.00.7580.1250.720
FHTGSSR-4.80.7502.00.3750.0000.305
FHTGSSR-5.10.7433.00.3890.0860.324
FHTGSSR-5.60.9292.00.1330.0860.124
FHTGSSR-5.70.4715.00.6550.1470.595
FHTGSSR-5.90.6564.00.5020.0630.443
FHTGSSR-6.10.9703.00.0590.0610.058
FHTGSSR-6.20.5292.00.4980.0290.374
FHTGSSR-6.30.6364.00.5450.1820.503
FHTGSSR-6.40.8592.00.2420.0940.212
FHTGSSR-6.60.8974.00.1910.0590.183
FHTGSSR-6.70.7573.00.3970.1710.363
FHTGSSR-6.80.5154.00.6140.2730.546
FHTGSSR-6.90.5156.00.6580.5000.614
FHTGSSR-7.10.9412.00.1110.0000.105
FHTGSSR-7.30.8532.00.2510.0000.219
FHTGSSR-7.40.9413.00.1120.0590.109
FHTGSSR-7.50.3714.00.7230.2000.673
FHTGSSR-7.60.4553.00.6220.3640.543
FHTGSSR-7.70.8183.00.3120.0000.288
FHTGSSR-7.80.6522.00.4540.6970.351
FHTGSSR-8.10.5152.00.5000.0000.375
FHTGSSR-8.20.7652.00.3600.0000.295
FHTGSSR-8.40.9573.00.0830.0290.081
FHTGSSR-8.50.9062.00.1700.0000.155
FHTGSSR-9.10.6913.00.4690.2350.418
FHTGSSR-9.20.9122.00.1610.0000.148
FHTGSSR-10.30.9432.00.1080.0000.102
FHTGSSR-10.40.9713.00.0580.0590.057
FHTGSSR-11.10.8063.00.3290.1290.302
FHTGSSR-11.20.5305.00.5620.0300.472
FHTGSSR-11.40.8752.00.2190.0000.195
FHTGSSR-11.50.9142.00.1570.0000.144
Mean0.7253.0380.3750.1280.331

Information about different diversity parameters of the 53 Polymorphic FHTGSSR loci.

Here, MAF, Major Allele Frequency; He, Expected Heterozygosity; Ho, Observed Heterozygosity; PIC, Polymorphism Information Content

Phylogenetic relationship

The Neighbor joining (N-J) tree was constructed using the genotypic data from 53 polymorphic g-SSR markers, which grouped 35 selected guava genotypes into two major clusters (Figure 4). These were further simplified into four clades and one outlier. The clade-1 contained the guava genotypes viz., Punjab Pink, Lalit, Pant Prabhat, Red Diamond, Hisar Surkha, Pusa Aarushi, Purple Guava, Arka Kiran, Guava Seedling-1, Guava Seedling-2 and Pusa Pratiksha. The clade-2 comprised Thai, Shweta, and Red Selection genotypes. The clade-3 included the wild guava species and four exotic genotypes viz., Psidium pumilum, Psidium pumilum variant, Psidium cattleianum, Psidium cattleianum variant, Psidium quadrangularis, Psidium molle, Psidium guineense, Seedling of Gushiken Sweet, Seedling of Klom Amporn, Seedling of Pear, and Seedling of 138-T. The clade-4 contained Hisar Safeda, Allahabad Safeda, Allahabad Safeda variant, Seedling of Hong Kong White, Seedling of Pink Acid, Seedling of Thailand Seedless, Guava Seedling-3, Guava Seedling-4, and Guava Seedling-5. Although L-49 considered outliers, as it didn’t group with any other guava genotypes. In this study, genetic distance was also calculated between the Allahabad Safeda & Allahabad Safeda variant, Psidium cattleianum & Psidium cattleianum variant, and Psidium pumilum & Psidium pumilum variant, which were 28, 39, and 42, respectively (Supplementary Figure 5). The minimum genetic distance was found between the Allahabad Safeda variant and Hisar Safeda (19), whereas the maximum genetic distance was recorded between the Red Diamond and Psidium cattleianum variant (186).

Figure 4

Population structure analysis

The structure software v.2.3.4 inferred the population structure of the 35 guava genotypes based on genotypic data of 53 polymorphic g-SSR markers and grouped them into two sub-populations. Here, the Evano method (ΔK value) identified two distinct sub-populations (Figure 5). These populations were further classified into pure and admixture types based on membership fractions. When the membership fraction of the genotype is more than 0.8, it is considered a pure type. Otherwise, it is considered an admixture type. The two identified populations, Population I and Population II, encompassed various guava genotypes. Population I consisted of Psidium cattleianum, Psidium cattleianum Variant, Psidium guineense, Psidium molle, Psidium quadrangularis and Seedling of Gushiken Sweet, with Gushiken Sweet seedling classified as an admixture type. Population II contained the remaining guava genotypes, with Seedling of Klom Amporn, Guava Seedling-1, and Psidium pumilum variant classified as admixture types. The population-level allelic frequency divergence between the two populations was 0.1706. The mean values of alpha, Fst_1, and Fst_2 were 0.0695, 0.1400, and 0.4403, respectively.

Figure 5

AMOVA & PCoA analysis

The analysis of molecular variance (AMOVA) analysis deciphered the molecular variation among populations, among individuals within the population, and within individuals, which were 25%, 52%, and 23%, respectively (P<0.01) (Table 4; Supplementary Figure 6). The selected guava genotypes demonstrated moderate to high genetic diversity, evident from the first three axes of the principal coordinate analysis (PCoA), which explained 38.63% of the cumulative variance (Table 5). The two colours (blue & orange) denote the distinct groupings of guava genotypes in the PCoA that corresponded to the classification of guava genotypes as determined by the model-based population structure approach (Figure 6).

Table 4

SourcedfSSMSEst. Var.%
Among Population187.38987.3893.51125%
Among Individuals33579.49717.5617.15952%
Within Individuals35113.5003.2433.24323%
Total69780.38613.913100%

AMOVA for 53 polymorphic g-SSR markers among 35 selected guava genotypes.

Here, df, Degrees of Freedom; SS, Sum of Squared Deviation; MS, Mean Squared Deviation; Est. Var., Estimated Variance

Table 5

Axis123
%22.409.386.86
Cum %22.4031.7738.63

Percentage of variation explained by the first 3 axes among 35 selected guava genotypes.

Figure 6

Cross-genera transferability

In this current study, 75 novel g-SSR markers were also screened for five selected jamun (Syzygium sp.) genotypes. Of these, only 17 markers (FHTGSSR-3.1, FHTGSSR-3.5, FHTGSSR-4.4, FHTGSSR-4.6, FHTGSSR-4.7, FHTGSSR-5.4, FHTGSSR-5.5, FHTGSSR-5.7, FHTGSSR-5.8, FHTGSSR-5.9, FHTGSSR-6.2, FHTGSSR-6.6, FHTGSSR-6.7, FHTGSSR-6.9, FHTGSSR-7.4, FHTGSSR-7.8, FHTGSSR-7.9) were amplified among selected jamun genotypes. Although FHTGSSR-4.4, FHTGSSR-5.7, FHTGSSR-5.9, and FHTGSSR-6.7 were found polymorphic among selected jamun genotypes and were able to differentiate between two jamun species (Figure 7). The amplicon size varied between 280bp (FHTGSSR-4.4) and 1200bp (FHTGSSR-5.4) for selected jamun genotypes.

Figure 7

Discussion

In India, the majority of the guava genotypes were named based on their fruit’s shape, colour, and pulp, while many other types were named after the regions they originated from. Though identifying and selecting superior guava varieties through the observation of phenotypic traits linked to commercially valuable characteristics remains a favoured method for crop improvement, the phenotypic variation in guava crops is frequently affected by environmental factors, which are challenging to manage (Srivastava and Narasimhan, 1967; Thaipong et al., 2005). Thus, the importance of molecular markers is not only for the diversity analysis of guava genotypes but also for genetic improvement programs. Among molecular markers, SSR markers are valued for their high efficiency, ease of use, reproducibility, co-dominance, and moderate-to-high resolution of alleles polymorphism in agarose gels (Collard et al., 2005; Collard and Mackill, 2008). In the case of guava, limited genomic resources, such as SSR markers and partial genome information, have hindered progress in molecular analysis, genetic improvement, and breeding programs.

Development of novel g-SSR markers through in silico analysis

Using the genome sequence of the cultivar “New Age” (GCA_016432845.1), we analysed 397.8 Mbp of the guava genome and identified 92,404 SSR loci (Supplementary Table 1). Although in previous studies, 1,88,183 (Thakur et al., 2021) and 88,941 (Kumar et al., 2023) SSR loci were recognized using MISA (Beier et al., 2017) and Krait software (Du et al., 2018) respectively. However, Thakur et al., 2021 and Kumar et al., 2023 used the genome sequence of “Allahabad Safeda” (GCA_019787385.1) and “Zhenshu” (GCA_002914565.1) as reference genomes for SSR loci identification respectively. Both reported that monomers were the most abundant motif type, followed by dimers and trimers. However, in the present investigation, during SSR identification, the most abundant motif type was found to be dimers (>75%), followed by trimers (>15%) (Figure 1). Earlier, a high frequency of dimer motifs was also reported in date palm (Al-Faifi et al., 2016) and pistachio nut (Ziya et al., 2016) among other fruit crops. Within dimers, the “TC” (~13.5%) motif composition was abundant in every chromosome except chromosome-1 and chromosome-11, where the most common motif compositions were “GA” (~13.7%) and “AG” (~12.9%), respectively. Moreover, among trimers, the “AAT” (~1.4%) motif composition was found to be the highest in every chromosome (Supplementary Figure 2). However, in 2023, Kumar et al. reported that the most abundant dimer motif and trimer motif were AG and AAG, respectively. In the current study, the highest and lowest number of SSR loci were found on chromosome-3 (10,475) and chromosome-9 (6,696), respectively (Supplementary Table 1). Similarly, in the previous study, the highest and lowest number of SSR loci were found on chromosome 3 (10,536) and chromosome 8 (6,293), respectively (Kumar et al., 2023). In this investigation, a total of 87,372 SSR loci were used for SSR primer designing, leading to a total of 75,084 novel genomic SSR markers being generated at a genome-wide level. Conversely, Thakur et al. (2021) obtained 152,367 SSR primer pairs from 188,183 SSR loci using Primer3_core, while Kumar et al. (2023) identified flanking primer pairs for 86,426 out of 88,941 SSR loci using the same software. After in silico analyses, a total of 75 novel g-SSR markers at a genome-wide level were selected for genetic diversity, cross-species and cross-genera transferability studies.

PCR amplifications and visibility of amplified products on simple agarose gel

In the present investigation, out of 75 novel g-SSR (FHTGSSR) markers, a total of 72 markers showed reliable amplifications in gradient PCR. The genotyping process for the novel g-SSR markers developed in this study utilized standard PCR protocols and resolved amplicons on a simple 2.5% agarose gel. Unlike previous methods that used a touchdown PCR program followed by capillary electrophoresis and gene scan analysis for allele sizing (Kanupriya et al., 2011; Kidaha et al., 2015; Kherwar et al., 2018), these new markers streamline the process by significantly reducing PCR runtime and improving allele size precision, with allelic variations easily visible on agarose gel (Singh et al., 2010). However, in this study, three g-SSR markers showed no satisfactory amplification, even after repetitive attempts to optimize the PCR reactions and conditions.

Molecular diversity studies

In the present study, out of 72 g-SSR markers, 53 markers were polymorphic while 19 markers were monomorphic. The monomorphic patterns observed in this investigation suggest that guava accessions shared similar alleles, supporting earlier findings of genetic diversity studies using microsatellite markers (Risterucci et al., 2005; Kanupriya et al., 2011; Kumar et al., 2020, Kumar et al., 2023). These shared allelic configurations were likely inherited from common ancestors and have remained stable without slippages during recombination, a major factor in the evolution of SSR regions (Selvam et al., 2015). In this current study, the amplified allele size was between 110-620bp for 72 g-SSR markers (Table 2). Some markers produced amplicon sizes smaller than the expected size while some SSR markers produced larger amplification sizes than expected allele sizes. Smaller and larger amplicons from g-SSR markers indicate deletion of the genomic region and insertion of the intronic region, respectively (Selvam et al., 2015). This study was also found 3 g-SSR markers (FHTGSSR-2.6, FHTGSSR-6.9, FHTGSSR-11.1) to be multi-allelic. This dispersion of SSRs may be due to slippage events during recombination and multiple crossovers at specific loci (Kumar et al., 2023). Genetic diversity indices are crucial for evaluating the effectiveness of the newly developed g-SSR markers in guava. In this study, 161 alleles were amplified altogether for 53 polymorphic FHTGSSR markers. On average, each primer pair yielded 3.04 alleles, with the number of alleles per primer pair ranging from 2 to 7 among the studied guava genotypes (Table 3). Previously, Sitther et al. (2014) reported 178 alleles from 20 mPgCIR markers in 35 guava genotypes; Kumar et al. (2020) amplified 90 alleles using 26 newly developed g-SSR markers in 40 genotypes; and Kumar et al. (2023) found 46 alleles from 21 novel g-SSR markers in 19 genotypes. Moreover, in the present investigation, 22 unique alleles were found using 53 polymorphic g-SSR markers, which indicates that the selected 35 genotypes maintained considerable genetic diversity among them (Potts et al., 2012). In this study, the PIC values of the novel g-SSR markers ranged from 0.057 (FHTGSSR-1.2 & FHTGSSR-10.4) to 0.774 (FHTGSSR-4.5) among the selected 35 guava genotypes. Furthermore, SSR markers are considered highly informative or possess strong discriminatory ability between genotypes when their PIC value is greater than 0.5 (Botstein et al., 1980). Among developed g-SSR markers, 12 (FHTGSSR-2.4, FHTGSSR-3.6, FHTGSSR-3.8, FHTGSSR-4.4, FHTGSSR-4.5, FHTGSSR-4.7, FHTGSSR-5.7, FHTGSSR-6.3, FHTGSSR-6.8, FHTGSSR-6.9, FHTGSSR-7.5 and FHTGSSR-7.6) had PIC values more than 0.5 (Table 3). Hence, these novel SSR markers have high discrimination power. Previously, high average PIC viz. 0.56 (Kherwar et al., 2018) and 0.46 (Kumar et al., 2020) had reported for 24 and 26 SSR markers among Indian guava genotypes. But, in our current study, we also got 15 g-SSR markers with PIC values between 0.06-0.2, which might be the reason the average PIC value for 53 polymorphic g-SSR markers was 0.331, lower than in previous studies. The guava genotypes analysed in this study showed moderate levels of expected heterozygosity (0.375), while observed heterozygosity was comparatively low (0.128), which indicating a moderate discrepancy between expected and observed values. Sitther et al. (2014) suggested that substantial differences between these two values in guava accessions may point to a strong inbreeding depression effect occurring throughout the crop’s domestication process. Model-based population structure analysis is valuable for conserving and optimizing collected genotypes (Uddin and Boerner, 2008). Recently, it has been used to differentiate the genetic structure of guava genotypes. For example, Kherwar et al. (2018) categorized 36 guava varieties, including wild species, into five genetic groups in India. Similarly, Sitther et al. (2014) utilized this structural model to differentiate guava germplasm at Hawaii’s USDA National Plants Germplasm System. The current study applied model-based population structure analysis to categorize 35 selected guava genotypes, including wild Psidium species, into two distinct genetic groups or sub-populations, viz. Population I and Population II (Figure 5). Generally, two populations are called highly divergent when allele frequency divergence between two populations is more than 0.05 (Kumar et al., 2020). In this investigation, high allele-frequency divergence (0.217) was observed between two population groups, which indicates significant genetic diversity among them. Besides, an alpha value approaching zero signifies that individuals belonging to distinct populations are mostly pure type (Li et al., 2014), whereas an alpha value greater than one indicates that all individuals in a population are admixtures (Ostrowski et al., 2006). In this study, the small alpha value (0.089) suggests a very low number of admixture genotypes in two populations. Besides, AMOVA further demonstrated considerable genetic diversity across populations, among individuals within populations, and within individual genotypes. Earlier, Kherwar et al. (2018) reported a low level of variation (6%) among populations, whereas Kumar et al. (2020) have seen moderate and significant level of genetic variation among population (19%) and among individuals (50%) respectively. Although, in this study, genetic variation was found highest among individuals (55%), whereas moderate level (23%) variation was found among populations (Supplementary Figure 6). Additionally, the PCoA also confirmed the genetic clustering of the guava genotypes, including the wild species. In population II, all genotypes were scattered, indicating their genetic distinctiveness from others (Figure 6).

Phylogenetic relationship studies

Phylogenetic studies were conducted in this investigation by constructing an N-J tree that placed the selected 35 guava accessions into two major clusters. The major clusters were further simplified into four distinct clades and one outgroup, indicating a substantial level of genetic diversity among the selected guava genotypes (Figure 4). It was elucidated that the studied wild Psidium species were grouped into clade-3. Additionally, Seedling of Gushiken Sweet, Klom Amporn, Pear, and 138-T also fell under clade 3, indicating that these exotic varieties are closely phylogenetically related to wild Psidium species. The constructed N-J tree also indicated that the Allahabad Safeda variant is closely related to the cultivar Allahabad Safeda, similar to the Psidium cattleianum variant being closely connected with Psidium cattleianum, and the Psidium pumilum variant with Psidium pumilum, respectively. Therefore, the newly developed g-SSR loci effectively distinguished the distinctiveness of genetically diverse guava genotypes and species. However, these genomic SSR loci did not categorize the guava genotypes based on their pulp colour. Earlier, Kanupriya et al. (2011); Kherwar et al. (2018), and Kumar et al. (2023) also grouped Indian guava genotypes into two phylogenetic clusters. In 2020, Kumar et al. grouped Indian guava genotypes into two phylogenetic clusters and six clades, which is similar to the findings of the present study.

Cross-species transferability studies

Among 72 novel validated genome-wide SSR markers, 28 markers were amplified to all the selected Psidium wild species. Although in this current study, cross-species transferability was varied from 45.83% (P. Cattleianum variant) to 90.28% (P pumilum variant). Whereas Kumar et al. (2020) and Kumar et al. (2023) reported that cross-species transferability for their developed novel SSR markers were 38.46-80.77% and 35%, respectively, among selected wild Psidium species. In 1998, Peakall et al. noted that the cross-transferability of SSRs among species within the same genus can range from 50% to 100%. In this investigation, the moderate to high cross-species transferability rate for the newly developed g-SSRs indicated that studied wild Psidium species are evolutionarily related to the cultivated guava genotypes (P. guajava L.). These novel g-SSR markers efficiently identified species-specific and cultivar-specific alleles, serving as unique molecular signatures for each species or cultivar. Although cp-DNA markers were generally found effective for species-level discrimination (Yan et al., 2018), the newly developed g-SSR markers could also differentiate between wild Psidium species successfully. Thus, these markers could be used to verify interspecific hybrids and aid in selecting scions and rootstocks for breeding programs.

Cross-genera transferability studies

In 2013, Rai et al. (2013) investigated the applicability of 23 SSR primer pairs, which were originally developed for Psidium guajava, to Eucalyptus citriodora, Eucalyptus camaldulensis, Callistemon lanceolatus, and Syzygium aromaticum, all belonging to the Myrtaceae family. Out of the examined loci, over 78.2% of the 23 SSR loci were shown to amplify across different genera in Eucalyptus citriodora, 60.8% in Eucalyptus camaldulensis, and 73.9% in both Callistemon lanceolatus and Syzygium aromaticum. All four chosen species showed transferability for eight markers. However, the cross-genera transferability of SSR markers developed from the guava genome to jamun has not been reported earlier. This investigation also studied cross-genera transferability among selected two jamun species viz., S. cumini, S. fruticosum, using FHTGSSR markers. A total of 17 novel g-SSR markers were amplified among both jamun species, of which only four markers (FHTGSSR-4.4, FHTGSSR-5.7, FHTGSSR-5.9, and FHTGSSR-6.7) were able to differentiate between the two jamun species, explicitly demonstrating the cross-genera transferability.

Conclusion

GMATA software offers comprehensive benefits for rapid SSR mining, SSR analysis, graphical result visualization, primer pair development by flanking identified SSRs, and polymorphism screening using the e-PCR algorithm. Using GMATA, 397.8 Mbp of the guava genome sequence was analysed, and 92,404 SSR loci were identified. The present set of 53 polymorphic g-SSR markers has proven informative and valuable for guava diversity studies. Among these markers, 12 markers demonstrated high discrimination power with PIC values exceeding 0.5, while 19 additional markers showed moderate informativeness with PIC values ranging from 0.3 to 0.5. These markers are not only useful for hybridity confirmation and marker-assisted selection but also exhibit cross-species transferability within Psidium spp. and cross-genera transferability among Syzygium spp., making them valuable resources for genetics and breeding studies for both guava and jamun.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/, GCA_016432845.1.

Author contributions

KP: Conceptualization, Data curation, Formal Analysis, Investigation, Methodology, Software, Validation, Writing – original draft. AG: Conceptualization, Formal Analysis, Funding acquisition, Resources, Supervision, Writing – review & editing. CK: Conceptualization, Formal Analysis, Resources, Supervision, Writing – review & editing. RS: Formal Analysis, Methodology, Supervision, Visualization, Writing – review & editing. RP: Conceptualization, Formal Analysis, Software, Writing – review & editing. SJ: Resources, Writing – review & editing. MT: Writing – review & editing. SG: Formal Analysis, Writing – review & editing. KA: Writing – review & editing. AM: Software, Writing – review & editing. SC: Investigation, Writing – review & editing. PM: Writing – review & editing. SS: Writing – review & editing. AK: Writing – review & editing.

Funding

The author(s) declare that no financial support was received for the research and/or publication of this article.

Acknowledgments

KP acknowledge ICAR for ICAR-PG fellowship which help to complete this research work without any hurdles during his M.Sc. Besides, KP, AG and CK are grateful to the USDA for providing exotic genotypes. Last but not least, KP also acknowledge The Graduate School of ICAR-IARI, New Delhi for their continuous support.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be constructed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2025.1527866/full#supplementary-material

Abbreviations

AMOVA, Analysis of Molecular Variance; >Ta, Annealing Temperature; df, Degrees of Freedom; bp, Base Pairs, CTAB, Cetyl Trimethyl Ammonium Bromide; C.N, Chromosome No.; DNA, Deoxyribonucleic Acid; °C, Degree Celsius; dNTP, 2 Deoxyribonucleotide 5’ Triphosphate; EDTA, Ethylene Diamine Tetra Acetic acid; FASTA, Fast Approximation of Smith & Waterman Algorithm; MSS, Mean Sum of Square; NCBI, National Center for Biotechnology Information; N-J, Neighbor Joining Tree; PCoA, Principal Coordinate Analysis; PCR, Polymerase Chain Reaction; SS, Sum of Square.

References

  • 1

    AdsuleR. N.KadamS. S. (1995). “Guava,” in Handbook of fruit science and technology: production, composition, storage, and processing. Eds. SalunkheD. K.KadamS. S. (CRC Press, Boca Raton), 435450.

  • 2

    Al-FaifiS. A.MigdadiH. M.AlgamdiS. S.KhanM. A.AmmarM. H.Al-ObeedR. S.et al. (2016). Development, characterization, and use of genomic SSR markers for assessment of genetic diversity in some Saudi date palm (Phoenix dactylifera L.) cultivars. Electronic J. Biotechnol.21, 1825. doi: 10.1016/j.ejbt.2016.01.006

  • 3

    BaumgartnerI. O.KellerhalsM.CostaF.DondiniL.PagliaraniG.GregoriR.et al. (2016). Development of SNP-based assays for disease resistance and fruit quality traits in apple (Malus x domestica Borkh.) and validation in breeding pilot studies. Tree Genet. Genomes12, 121. doi: 10.1007/s11295-016-0994-y

  • 4

    BeierS.ThielT.MünchT.ScholzU.MascherM. (2017). MISA-web: a web server for microsatellite prediction. Bioinformatics33, 25832585. doi: 10.1093/bioinformatics/btx198

  • 5

    BensonG. (1999). Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res.27, 573580. doi: 10.1093/nar/27.2.573

  • 6

    BotsteinD.WhiteR. L.SkolnickM.DavisR. W. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet.32, 314331.

  • 7

    CasteloA. T.MartinsW.GaoG. R. (2002). TROLL—Tandem repeat occurrence locator. Bioinformatics18, 634636. doi: 10.1093/bioinformatics/18.4.634

  • 8

    ChagnéD.CrowhurstR. N.PindoM.ThrimawithanaA.DengC.IrelandH.et al. (2014). The draft genome sequence of European pear (Pyrus communis L. ‘Bartlett’). PloS One9, e92644. doi: 10.1371/journal.pone.0092644

  • 9

    CollardB. C. Y.GramsR. A.BovillW. D.PercyC. D.JolleyR.LehmensiekA.et al. (2005). Development of molecular markers for crown rot resistance in wheat: mapping of QTLs for seedling resistance in a ‘2-49’×’Janz’ population. Plant Breed.124, 532537. doi: 10.1111/j.1439-0523.2005.01163.x

  • 10

    CollardB. C. Y.MackillD. J. (2008). Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philos. Trans. R. Soc. B: Biol. Sci.363, 557572. doi: 10.1098/rstb.2007.2170

  • 11

    CollardB. C.Vera CruzC. M.McNallyK. L.VirkP. S.MackillD. J. (2008). Rice molecular breeding laboratories in the genomics era: current status and future considerations. Int. J. Plant Genomics524847. doi: 10.1155/2008/524847

  • 12

    CoserS. M.FontesM. M. P.FerreiraM. F. S. (2012). Assessment of pollen viability in guava genotypes. In III Int. Symposium Guava other Myrtaceae959, 141144. doi: 10.17660/ActaHortic.2012.959.17

  • 13

    DineshM. R.IyerC. P. A. (2005). Significant research achievement in guava improvement and future needs. in: KishunRMishraAKSinghGChandraR (eds). Proceedings of first international guava symposium. Lucknow: CISH716.

  • 14

    DineshM. R.VasugiC. (2010). Phenotypic and genotypic variations in fruit characteristics of guava (Psidium guajava). Indian J. Agric. Sci.80, 998999.

  • 15

    Dos SantosW. N. L.da Silva SauthierM. C.dos SantosA. M. P.de Andrade SantanaD.AzevedoR. S. A.da Cruz CaldasJ. (2017). Simultaneous determination of 13 phenolic bioactive compounds in guava (Psidium guajava L.) by HPLC-PAD with evaluation using PCA and Neural Network Analysis (NNA). Microchemical J.133, 583592. doi: 10.1016/j.microc.2017.04.029

  • 16

    DoyleJ. J.DoyleJ. L. (1987). A rapid DNA isolation procedure from small quantities of fresh leaf tissues. Phytochemical Bull.19, 1115.

  • 17

    DuL.ZhangC.LiuQ.ZhangX.YueB. (2018). Krait: an ultrafast tool for genome-wide survey of microsatellites and primer design. Bioinformatics34, 681683. doi: 10.1093/bioinformatics/btx665

  • 18

    DuranC.SinghaniaR.RamanH.BatleyJ.EdwardsD. (2013). Predicting polymorphic EST-SSR s in silico. Mol. Ecol. Resour.13, 538545. doi: 10.1111/1755-0998.12078

  • 19

    EarlD. A.VonHoldtB. M. (2012). STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour.4, 359361. doi: 10.1007/s12686-011-9548-7

  • 20

    EdwardsK. J.BarkerJ. H.DalyA.JonesC.KarpA. (1996). Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques20, 758760. doi: 10.2144/96205bm04

  • 21

    FengC.FengC.LinX.LiuS.LiY.KangM. (2021). A chromosome-level genome assembly provides insights into ascorbic acid accumulation and fruit softening in guava (Psidium guajava). biotechnology journal. Plant19, 717730. doi: 10.1111/pbi.13498

  • 22

    FloresG.WuS. B.NegrinA.KennellyE. J. (2015). Chemical composition and antioxidant activity of seven cultivars of guava (Psidium guajava) fruits. Food Chem.170, 327335. doi: 10.1016/j.foodchem.2014.08.076

  • 23

    HassimottoN. M. A.GenoveseM. I.LajoloF. M. (2005). Antioxidant activity of dietary fruits, vegetabl es, and commercial frozen fruit pulps. J. Agric. Food Chem.53, 29282935. doi: 10.1021/jf047894h

  • 24

    HirakawaH.ShirasawaK.KosugiS.TashiroK.NakayamaS.YamadaM.et al. (2014). Dissection of the octoploid strawberry genome by deep sequencing of the genomes of. Fragaria species. DNA Res.21, 169181. doi: 10.1093/dnares/dst049

  • 25

    JaillonO.AuryJ. M.NoelB.PolicritiA.ClepetC.CasagrandeA.et al. (2007). The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature449, 463467. doi: 10.1038/nature06148

  • 26

    JamiesonS.WallaceC. E.DasN.BhattacharyyaP.BishayeeA. (2022). Guava (Psidium guajava L.): a glorious plant with cancer preventive and therapeutic potential. Crit. Rev. Food Sci. Nutr.63, 192223. doi: 10.1080/10408398.2021.1945531

  • 27

    KanupriyaL.P.M.AswathC.ReddyL.PadmakarB.VasugiC.DineshM. R. (2011). Cultivar identification and genetic fingerprinting of guava (Psidium guajava) using microsatellite markers. Int. J. Fruit Sci.11, 184196. doi: 10.1080/15538362.2011.578521

  • 28

    KherwarD.UshaK.MithraS. A.SinghB. (2018). Microsatellite (SSR) marker-assisted assessment of population structure and genetic diversity for morpho-physiological traits in guava (Psidium guajava L.). J. Plant Biochem. Biotechnol.27, 284292. doi: 10.1007/s13562-018-0438-4

  • 29

    KidahaL. M.AlakonyaA. E.NyendeA. B. (2015). Morphological characters of guava landraces in western and coastal Kenya. Am. J. Exp. Agric.9, 111. doi: 10.9734/AJEA/2015/12674

  • 30

    KoflerR.SchlöttererC.LelleyT. (2007). SciRoKo: a new tool for whole genome microsatellite search and investigation. Bioinformatics23, 16831685. doi: 10.1093/bioinformatics/btm157

  • 31

    KoleC.MuthamilarasanM.HenryR.EdwardsD.SharmaR.AbbertonM.et al. (2015). Application of genomics-assisted breeding for generation of climate-resilient crops: progress and prospects. Front. Plant Sci.6. doi: 10.3389/fpls.2015.00563

  • 32

    KumarC.KumarR.SinghS. K.GoswamiA. K.NagarajaA.PaliwalR.et al. (2020). Development of novel g-SSR markers in guava (Psidium guajava L.) cv. Allahabad Safeda and their application in genetic diversity, population structure, and cross-species transferability studies. PloS One15, e0237538. doi: 10.1371/journal.pone.0237538

  • 33

    KumarS.SinghA.YadavA.BajpaiA.SinghN. K.RajanS.et al. (2023). Identification and validation of novel genomic SSR markers for molecular characterization of guava (Psidium guajava L.). South Afr. J. Bot.155, 7989. doi: 10.1016/j.sajb.2023.02.005

  • 34

    LiF. P.LeeY. S.KwonS. W.LiG.ParkY. J. (2014). Analysis of genetic diversity and trait correlations among Korean landrace rice (Oryza sativa L.). Genet. Mol. Res.13, 63166331. doi: 10.4238/2014.April.14.12

  • 35

    LiuK.MuseS. V. (2005). PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics21, 21282129. doi: 10.1093/bioinformatics/bti282

  • 36

    LuoW.WuQ.YangL.ChenP.YangS.WangT.et al. (2020). SSREnricher: a computational approach for large-scale identification of polymorphic microsatellites based on comparative transcriptome analysis. PeerJ8, e9372. doi: 10.7717/peerj.9372

  • 37

    MaanS. S.BrarJ. S.MittalA.GillM. I. S.AroraN. K.SohiH. S.et al. (2023). Construction of a genetic linkage map and QTL mapping of fruit quality traits in guava (Psidium guajava L.). Front. Plant Sci.14. doi: 10.3389/fpls.2023.1123274

  • 38

    MaiaL. C.PalmieriD. A.de SouzaV. Q.KoppM. M.de CarvalhoF. I.Costa de OliveiraA. (2008). SSR Locator: Tool for simple sequence repeat discovery integrated with primer design and PCR simulation. Int. J. Plant Genomics2008, 412696. doi: 10.1155/2008/412696

  • 39

    MingR.HouS.FengY.YuQ.Dionne-LaporteA.SawJ. H.et al. (2008). The draft genome of the transgenic tropical fruit tree papaya (Carica papaya L.). Nature452, 991996. doi: 10.1038/nature06856

  • 40

    Ministry of Agriculture & Farmers Welfare (MoA&FW) (2024-25). Annual report on horticultural statistics (Government of India). Available online at: https://agriwelfare.gov.in/en/StatHortEst.

  • 41

    MortonJ. F. (1987). “Guava,” in Fruits of warm climates (ECHO Inc, Miami, FL, USA), 766784.

  • 42

    MyburgA. A.GrattapagliaD.TuskanG. A.HellstenU.HayesR. D.GrimwoodJ.et al. (2014). The genome of Eucalyptus grandis. Nature510, 356362. doi: 10.1038/nature13308

  • 43

    OstrowskiM. F.DavidJ.SantoniS.McKhannH.ReboudX.Le CorreV.et al. (2006). Evidence for a large-scale population structure among accessions of Arabidopsis thaliana: possible causes and consequences for the distribution of linkage disequilibrium. Mol. Ecol.15, 15071517. doi: 10.1111/j.1365-294X.2006.02865.x

  • 44

    PeakallR.SmouseP. E. (2006). GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes6, 288295. doi: 10.1111/j.1471-8286.2005.01155.x

  • 45

    PottsS. M.HanY.KhanM. A.KushadM. M.RayburnA. L.KorbanS. S. (2012). Genetic diversity and characterization of a core collection of Malus germplasm using simple sequence repeats (SSRs). Plant Mol. Biol. Rep.30, 827837. doi: 10.1007/s11105-011-0399-x

  • 46

    PowellW.MachrayG. C.ProvanJ. (1996). Polymorphism revealed by simple sequence repeats. Trends Plant Sci.1, 215222. doi: 10.1016/1360-1385(96)86898-1

  • 47

    PritchardJ. K.StephensM.DonnellyP. (2000). Inference of population structure using multilocus genotype data. Genetics155, 945959. doi: 10.1093/genetics/155.2.945

  • 48

    RaiM. K.PhulwariaM.ShekhawatN. S. (2013). Transferability of simple sequence repeat (SSR) markers developed in guava (Psidium guajava L.) to four Myrtaceae species. Mol. Biol. Rep.40, 50675071. doi: 10.1007/s11033-013-2608-1

  • 49

    RaoH. X.PattersonB.PottsB.VaillancourtR. (2008). A microsatellite study on outcrossing rates and contamination in an Eucalyptus globulus breeding arboretum. J. Forestry Res.19, 136140. doi: 10.1007/s11676-008-0023-6

  • 50

    RayP. K. (2002). “Guava,” in Breeding tropical and subtropical fruits (New Delhi: Narosa Publishing House), 106128.

  • 51

    RisterucciA. M.DuvalM. F.RohdeW.BillotteN. (2005). Isolation and characterization of microsatellite loci from Psidium guajava L. Mol. Ecol. Notes5, 745748. doi: 10.1111/j.1471-8286.2005.01050.x

  • 52

    RitterE. (2012). Guava biotechnologies, genomic achievements, and future needs. Acta Horticulture959, 131140. doi: 10.17660/ActaHortic.2012.959.16

  • 53

    RodriguezN.Valdes-InfanteJ.BeckerD.VelázquezB.GonzálezG.SourdD.et al. (2007). “Characterization of guava accessions by SSR markers, extension of the molecular linkage map, and mapping of QTLs for vegetative and reproductive characters,” in I international guava symposium, 201216. doi: 10.17660/ActaHortic.2007.735.27

  • 54

    SantanaQ. C.CoetzeeM. P.SteenkampE. T.MlonyeniO. X.HammondG. N.WingfieldM. J.et al. (2009). Microsatellite discovery by deep sequencing of enriched genomic libraries. Biotechniques46, 217223. doi: 10.2144/000113085

  • 55

    SelvamJ. N.MuthukumarM.RahmanH.SenthilN.RaveendranM. (2015). Development and validation of SSR markers in finger millet (Eleusine coracana Gaertn). Int. J. Trop. Agric.33, 20552066.

  • 56

    SharmaP. C. (2007). Mining microsatellites in eukaryotic genomes. Trends Biotechnol.25, 490. doi: 10.1016/j.tibtech.2007.07.013

  • 57

    SheetalN. (2010). Development of molecular marker for pulp colour in guava (Psidium guajava L.). Doctoral dissertation (Bangalore: University of Agricultural Sciences).

  • 58

    ShuklaS.KushwahaR.SinghM.SarojR.PuranikV.AgarwalR.et al. (2021). Quantification of bioactive compounds in guava at different ripening stages. Food Res.5, 183189. doi: 10.26656/fr.2017.5(3).554

  • 59

    ShulaevV.SargentD. J.CrowhurstR. N.MocklerT. C.FolkertsO.DelcherA. L.et al. (2011). The genome of woodland strawberry (Fragaria vesca). Nat. Genet.43, 109116. doi: 10.1038/ng.740

  • 60

    SinghH.DeshmukhR. K.SinghA.SinghA. K.GaikwadK.SharmaT. R.et al. (2010). Highly variable SSR markers suitabl e for rice genotyping using agarose gels. Mol. Breed.25, 359364. doi: 10.1007/s11032-009-9328-1

  • 61

    SittherV.ZhangD.HarrisD. L.YadavA. K.ZeeF. T.MeinhardtL. W.et al. (2014). Genetic characterization of guava (Psidium guajava L.) germplasm in the United States using microsatellite markers. Genet. Resour. Crop Evol.61, 829839. doi: 10.1007/s10722-014-0078-5

  • 62

    SrivastavaH. C.NarasimhanP. (1967). Physiological studies during the growth and development of different varieties of guavas (Psidium guajava L.). J. Hortic. Sci.42, 97104. doi: 10.1080/00221589.1967.11514197

  • 63

    TemnykhS.ParkW. D.AyresN.CartinhourS.HauckN.LipovichL.et al. (2000). Mapping and genome organization of microsatellite sequences in rice (Oryza sativa L.). Theor. Appl. Genet.100, 697712. doi: 10.1007/s001220051342

  • 64

    ThaipongK.BoonprakobU.Cisneros-ZevallosL.ByrneD. H.PathomN. (2005). Hydrophilic and lipophilic antioxidant activities of guava fruits. Southeast Asian J. Trop. Med. Public Health36, 254.

  • 65

    ThakurS.YadavI. S.JindalM.SharmaP. K.DhillonG. S.BooraR. S.et al. (2021). Development of genome-wide functional markers using draft genome assembly of guava (Psidium guajava L.) cv. Allahabad Safeda to expedite molecular breeding. Front. Plant Sci.12. doi: 10.3389/fpls.2021.708332

  • 66

    ThrimawithanaA. H.JonesD.HilarioE.GriersonE.NgoH. M.LiachkoI.et al. (2019). A whole genome assembly of Leptospermum scoparium (Myrtaceae) from anuka research. New Z. J. Crop Horticulture Sci.47, 233260. doi: 10.1080/01140671.2019.1657911

  • 67

    UddinM. S.BoernerA. (2008). Genetic diversity in hexaploid and tetraploid wheat genotypes using microsatellite markers. Plant Tissue Culture Biotechnol.18, 6573. doi: 10.3329/ptcb.v18i1.3267

  • 68

    Valdes-InfanteJ.HabanaN.HabanaB.HabanaG.SourdD.RodríguezJ.et al. (2003). Molecular characterization of Cuban accessions of guava (Psidium guajava L.), establishment of a first molecular linkage map and mapping of QTLs for vegetative characters. J. Genet. Breed.57, 349357.

  • 69

    VarshneyR. K.GranerA.SorrellsM. E. (2005). Genomics assisted breeding for crop improvement. Trends Plant Sci.10, 621630. doi: 10.1016/j.tplants.2005.10.004

  • 70

    VelascoR.ZharkikhA.AffourtitJ.DhingraA.CestaroA.KalyanaramanA.et al. (2010). The genome of the domesticated apple (Malus × domestica Borkh.). Nat. Genet.42, 833839. doi: 10.1038/ng.654

  • 71

    VerdeI.AbbottA. G.ScalabrinS.JungS.ShuS.MarroniF.et al. (2013). The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication, and genome evolution. Nat. Genet.45, 487494. doi: 10.1038/ng.2586

  • 72

    VijayaA.VelayuthaprabhuS.RengarajanR. L.SampathkumarP.RadhakrishnanR. (2020). Bioactive compounds of guava (Psidium guajava L.). Bioactive compounds underutilized fruits nuts, 503. doi: 10.1007/978-3-030-30182-8_37

  • 73

    WangP.LuoY.HuangJ.GaoS.ZhuG.DangZ.et al. (2020). The genome evolution and domestication of tropical fruit mango. Genome Biol.21, 117. doi: 10.1186/s13059-020-01959-8

  • 74

    WangX.WangL. (2016). GMATA: An integrated software package for genome-scale SSR mining, marker development, and viewing. Front. Plant Sci.7. doi: 10.3389/fpls.2016.01350

  • 75

    WuJ.WangZ.ShiZ.ZhangS.MingR.ZhuS.et al. (2013). The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res.23, 396408. doi: 10.1101/gr.144311.112

  • 76

    XiaE.-H.YaoQ.-Y.ZhangH.-B.JiangJ.-J.ZhangL.-P.GaoL.-Z. (2016). CandiSSR: An efficient pipeline used for identifying candidate polymorphic SSRs based on multiple assembled sequences. Front. Plant Sci.6. doi: 10.3389/fpls.2015.01171

  • 77

    YanM.XiongY.LiuR.DengM.SongJ. (2018). The application and limitation of universal chloroplast markers in discriminating East Asian evergreen oaks. Front. Plant Sci.9. doi: 10.3389/fpls.2018.00569

  • 78

    ZhangQ.ChenW.SunL.ZhaoF.HuangB.WangJ.et al. (2012). The genome of Prunus mume. Nat. Commun.3, 18. doi: 10.1038/ncomms2290

  • 79

    ZhaoX.KochertG. (1993). Phylogenetic distribution and genetic mapping of a (GGC) n microsatellite from rice (Oryza sativa L.). Plant Mol. Biol.21, 607614. doi: 10.1007/BF00014544

  • 80

    ZiyaM.E.KafkasS.KhodaeiaminjanM.ÇobanN.GözelH. (2016). Genome survey of pistachio (Pistacia vera L.) by next generation sequencing: development of novel SSR markers and genetic diversity in Pistacia species. BMC Genomics17, 114. doi: 10.1186/s12864-016-3359-x

Summary

Keywords

guava, in silico, FHTGSSRs, polymorphism information content, cross-species transferability

Citation

Pramanik K, Goswami AK, Kumar C, Singh R, Prabha R, Jha SK, Thakre M, Goswami S, Aditya K, Maurya A, Chanda S, Mishra P, Sarkar S and Kashyap A (2025) Development of genome-wide SSR markers through in silico mining of guava (Psidium guajava L.) genome for genetic diversity analysis and transferability studies across species and genera. Front. Plant Sci. 16:1527866. doi: 10.3389/fpls.2025.1527866

Received

13 November 2024

Accepted

01 April 2025

Published

25 April 2025

Volume

16 - 2025

Edited by

Steven Maina Runo, Kenyatta University, Kenya

Reviewed by

Jiban Shrestha, Nepal Agricultural Research Council, Nepal

Chet Ram, ICAR Central Institute of Arid Horticulture (CIAH), India

Sudip Kumar Dutta, Sikkim Centre, India

Updates

Copyright

*Correspondence: Amit Kumar Goswami, ; Chavlesh Kumar,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics