ORIGINAL RESEARCH article

Front. Plant Sci., 22 July 2025

Sec. Plant Pathogen Interactions

Volume 16 - 2025 | https://doi.org/10.3389/fpls.2025.1598183

The infection of mycovirus down regulates Aa-milR13 to weaken the pathogenicity of the Alternaria alternata f. sp. mali

  • College of Plant Protection, Hebei Agricultural University, Baoding, Hebei, China

Abstract

This study explored the association between differentially expressed miRNA Aa-milR13 in Alternaria alternata f. sp. mali strains with and without virus infection, and the regulation of fungal host pathogenicity by viruses. MiRNA sequencing was conducted on a hypovirulent strain (QY21) with compound infection of Alternaria alternata chrysovirus 1 (AaCV1) and Alternaria alternata magoulivirus 1 (AaMV1), a hypovirulent strain (QY21-C1) with single AaMV1 infection, and a virus-free strain (QY21-C2). Fourteen miRNAs with significant differential expression were identified. Aa-milR13 was significantly downregulated in virus-infected strains and validated by RT-qPCR. Structural analysis of the Aa-milR13 sequence identified that the mature Aa-milR13 is located at the 5’ end of its precursor stem-loop structure. Knockout of Aa-milR13 in QY21-C2 resulted in slower hyphal growth, darker colony color, and reduced pathogenicity, resembling virus-infected strains. Conversely, overexpression of Aa-milR13 led to accelerated hyphal growth, lighter colony color, and significantly enhanced pathogenicity.Three target genes of Aa-milR13, subtilisin-like protein (AaSLP,cinr CC77DRAFT_1100266), DUF431-domain-containing protein (DUF431, CC77DRAFT_1022347), and high-affinity nitrate transporter NrtB (NrtB, CC77DRAFT_1056077), were predicted and confirmed by RT-qPCR to be negatively correlated with Aa-milR13 expression. Bioinformatics analysis indicated that Aa-milR13 targets the CDS regions of the potential target genes through cleavage, with Watson-Crick pairing of AU, CG, wobble pairing of GU, and various pairing patterns such as AA, AC, AG, GG, UU, UC, etc. This study suggests that fungal virus infection downregulates Aa-milR13, upregulating its targets, potentially contributing to reduced fungal pathogenicity. This is the first report of small RNAs acting as an intermediate bridge in the regulation of fungi virulence by fungal viruses. The research results lay the foundation for elucidating the mechanism of small RNA-involved regulation of fungi hypovirulence by fungal viruses and provide theoretical support for the use of fungal viruses in the control of crop fungal diseases.

1 Introduction

Alternaria blotch of apple, caused by Alternaria alternata f. sp. mali, is one of the major leaf diseases of apples (). Chemical control is primarily used in production to manage this disease. However, the long-term and excessive use of chemicals may pose potential risks to human health and the ecological environment (). Therefore, biological control, as a green and sustainable prevention and control measure, is gradually gaining attention. Studies have shown that mycoviruses can attenuate the pathogenicity of their fungal hosts and, in some cases, convert fungal hosts into plant endophytes, thereby promoting plant growth and disease resistance. Mycoviruses have emerged as a potential biological control measure (). Revealing the mechanisms by which mycoviruses regulate host virulence will facilitate their application in crop disease control.

In recent years, progress has been made in studying the hypovirulence mechanisms of mycoviruses (). From a cellular biology perspective, studies have found that mycovirus infection may be accompanied by abnormal morphological development of host hyphae, reduced conidia production, abnormal pigmentation, and other growth phenotypic changes, as well as physiological and metabolic abnormalities such as interference with the production of host cell wall-degrading enzymes (e.g., cutin) and impeded synthesis of pathogenic mycotoxins (e.g., Alternariol, AOH and Altersolanol A) (; ). At the molecular level, transcriptome sequencing technology has been used to analyze the effects of virus infection on fungal host mRNA. As an example, stemphylium lycopersici alternavirus 1 (SlAV1) infection in Stemphylium lycopersici was found to significantly enrich genes associated with ribosome biogenesis, spliceosome RNA transport, and DNA replication pathways, based on transcriptome sequencing data (). Small RNA sequencing technology has revealed significant differences in the expression of host small RNAs (sRNAs) before and after mycovirus infection (; ).

Fungal sRNAs play a critical role in the interaction between plant pathogens and their hosts, influencing both virulence and host defense. These sRNAs, including miRNA-like (milRNA) and siRNA, can be processed by enzymes such as Dicer and Argonaute (AGO) proteins to form miRISC complexes, which target host genes for cleavage or translational repression (; ). Studies have revealed that fungal sRNAs are involved in regulating their own gene expression, influencing developmental processes and virulence. For instance, Fusarium oxysporum f. sp. cubense produces miRNAs that target glycosyl hydrolase genes, promoting pathogenicity (). Fungal sRNAs can also hijack the host’s RNA interference (RNAi) machinery to suppress plant immunity. For example, Botrytis cinerea secretes sRNAs that enter plant cells and silence defense genes (). The ability of sRNAs to mediate these interactions has opened new avenues for biotechnological applications, such as the development of environmentally friendly RNA-based biocontrol agents.

Host-derived small RNAs induced and activated by animal and plant viruses play important roles in host-virus interactions (; ), but studies on this aspect of mycoviruses have not been reported. This study aims to reveal the mechanism by which small RNAs, as intermediate bridges, participate in the regulation of fungal host virulence by mycoviruses, providing theoretical support for the use of mycoviruses in the control of plant fungal diseases. In previous work, we obtained A. alternata f. sp. mali strains QY21 carrying mycoviruses Alternaria alternata chrysovirus 1 (AaCV1) and Alternaria alternata magoulivirus 1 (AaMV1). By virus-free culture, we obtained the virus-free strain QY21-C2 and the AaMV1 singly infected strain QY21-C1, demonstrating that infection by these two viruses is the primary cause of the decline in pathogenicity of A. alternata f. sp. mali strains. These are the first viruses found in A. alternata f. sp. mali that significantly reduce the pathogenicity of their fungal hosts, leading to host colony shrinkage, abnormal hyphal morphology, reduced sporulation, growth inhibition, abnormal pigmentation, and particularly, reduced synthesis of the pathogenicity-related factor AOH and decreased pathogenicity (). This study focuses on the endogenous small RNAs activated by mycoviruses in A. alternata f. sp. mali and investigates their functions and mechanisms during the decline of fungal host virulence.

2 Materials and methods

2.1 Alternaria alternata f. sp. mali strains

The compound infection strain QY21 of A. alternata f. sp. mali by AaCV1 and AaMV1, as well as the AaMV1 single infection strain QY21-C1 and virus-free strain QY21-C2 obtained through detoxification of QY21, are preserved in Research Laboratory of Plant Disease Epidemiology and Integrated Pest Management of Hebei Agricultural University.

2.2 Small RNA isolation and sequencing

Three strains, QY21, QY21-C1, and QY21-C2, were inoculated separately onto potato dextrose agar (PDA) medium lined with cellophane at the bottom. After 72 hours of culture at 25°C, mycelia were scraped using a sterile disposable mycelium scraper, placed in RNA- and DNA-free centrifuge tubes, and rapidly frozen in liquid nitrogen. milRNA was extracted using the miRcute milRNA isolation kit (Tiangen, Beijing, China). Three biological replicates were set up for each strain, and milRNA sequencing was entrusted to Shanghai Majorbio Pharmaceutical Technology Co., Ltd (Shanghai, China). Reference species is A. alternata SRC1lrK2f. Reference genome version is Altal1 (Acc No: GCA_001642055). Specific steps were conducted, including extracting total RNA from the samples, measuring the concentration and purity of the extracted RNA using Nanodrop2000 (Thermo, MA, USA), assessing RNA integrity via agarose gel electrophoresis, and determining the RQN value using Agilent5300. Small RNA libraries were constructed using the QIAseq miRNA Library Kit (96) (Qiagen, Germany) according to the manufacturer’s protocol. The requirements for cDNA library construction are: total RNA amount of 1 μg, concentration ≥ 50 ng/μL, RQN > 7, and OD260/OD280 between 1.8 and 2.2. Adapter sequences were ligated to the 3’ and 5’ ends, respectively. Under the action of reverse transcriptase, a single strand of cDNA was reverse-synthesized using the RNA with ligated adapters as a template and random primers. This was followed by second-strand synthesis to form a stable double-strand structure. PCR amplification (11-12 cycles) was performed using sequencing primers to enrich the library. Target fragments were recovered by gel electrophoresis (6% Novex TBE PAGE gel, 1.0 mm, 10 well). The enriched 18-32 nt small RNA fragments were sequenced on the NovaSeq X Plus platform (Illumina Inc., San Diego, CA, USA).

2.3 Processing of high-throughput sequencing data

The sequencing data was aligned with the reference genome sequence Altal1 to identify contamination or confusion in the samples. Low-quality data was removed before data analysis (). Fastp (https://github.com/OpenGene/fastp) was used for quality filtering and adaptor trimming. For the raw reads obtained from small RNA sequencing, small RNA fragments <18 nts and >30 nts were discarded, reads with an undetermined base ratio >10% were removed, reads with 3’ and 5’ adapter contamination, no inserted sequences, and single-copy sequences were removed, and reads containing polyA were discarded to obtain clean reads. After data quality control, the quality-controlled data was again statistically analyzed and quality assessed, including base quality, error rate, and content distribution statistics. This resulted in high-quality quality-controlled data (clean data) to ensure the accuracy of subsequent analysis results.

2.4 Analysis of small RNA sequencing data

The quality-controlled raw data was aligned with the reference genome to obtain valid data (mapped reads) for subsequent analysis. TopHat2 (http://tophat.cbcb.umd.edu/) () and HISAT2 (http://ccb.jhu.edu/software/hisat2/index.shtml) () software were used to align the quality-controlled raw data with the reference genome. The distribution of raw data with a mapping rate higher than 65% (Total Mapped Reads) on the reference sequence was analyzed. Based on the existing reference genome, software Cufflinks (http://cole-trapnelllab.github.io/cufflinks/) () and StringTie (http://ccb.jhu.edu/software/stringtie/) () were used to assemble and splice the mapped reads and compare them with known transcripts. The reads aligned to the reference genome Altal1 were compared with the miRbase (Version 22.1) and Rfam (Version 14.6) databases to obtain known milRNA annotation information. MiReap software was used to predict new milRNAs for reads without annotation information using the aforementioned reference genome. DESeq2 () was used to perform differential expression analysis on all small RNA loci in the nine strains, normalizing the raw read counts of each small RNA in each sample to the total read counts in that sample. The fold change (FC) between virus-infected and uninfected samples was calculated. The Benjamini and Hochberg method was used to correct the P-values obtained from the Wald test multiple times to obtain adjusted P-values (Padjust). Statistically supported differentially expressed milRNAs were retrieved (padjust ≤0.05, up-regulated when log2(FC) ≥0.6 or down-regulated when log2(FC) ≤-0.6). The RNAfold web server (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi) was used to predict the secondary structure of milRNA precursors, with base pairing probabilities used for coloring. The online website predictprotein (https://predictprotein.org/) was used to predict the secondary structure of proteins. Protein tertiary structure analysis was performed according to SWISS-MODEL (https://swissmodel.expasy.org/interactive) was used for target gene prediction.

2.5 Extraction of mycelial DNA and RNA

The fungal genomic DNA rapid extraction kit (Sangon, Shanghai, China) was used to extract DNA from A. alternata f. sp. mali strains. Total RNA was extracted from the three strains, QY21, QY21-C1, and QY21-C2, using Trizol reagent (TransGen, Beijing, China). The integrity of the total RNA was detected using 1.0% agarose gel electrophoresis, and the concentration and purity of the nucleic acids were determined using the Eppendorf Biospectrometer® basic UV-Vis fluorospectrophotometer (Eppendorf, HH, Germany).

2.6 Real-time fluorescent quantitative PCR

The RT-qPCR detection of key milRNAs was performed using 2×FastFire qPCR PreMix (Tiangen, Beijing, China) on a 7500 quantitative PCR system (ABI, CA, USA). The primers used were: pmilR13q-F: GCGCGTGTTTATCTTCCAGA, and pmilR13q-R: AGTGCAGGGTCCGAGGTATT. U6 (U6 small nuclear RNA) was used as the housekeeping gene for milRNAs, while the Tubulin gene served as the housekeeping gene for the target genes. The relative expression levels were calculated using the 2-ΔΔCt method. The quantitative primers for the potential target genes were: pAaSLPq-F: ATGGTGACGGTGTGGAGGATG, pAaSLPq-R: CGCAATGTCGGGCTGGAAAC; pAaDUF431q-F: AGTTCCTGCTGTCTTCCGTACC, pAaDUF431q-R: TCTGTCCGCATAGATTTCTTCAATACC; pAaNrtBq-F: GTGCTACCGTCGTGTCCAATG, pAaNrtBq-R: TCGCAGGCTTGTCGTCCAG.

2.7 RT-PCR verification of the presence of the precursor of Aa-milR13 in Alternaria alternata f. sp. mali

To further validate that Aa-MIL1R13 serves as the functional precursor encoding mature Aa-milR13 and confirm its stability across fungal generations, we conducted a detailed precursor verification workflow. First, based on the miRNA sequencing-derived precursor sequences of Aa-milR13, we designed strain-specific forward (pmilR13-F: 5’-TGTTTATCTTCAGACTGTTGTTGT-3’) and reverse (pmilR13-R: 5’-AGTGTCAATCCACCAACACTGA-3’) primers using Premier 5.0 software. These primers were synthesized by Sangon Biotech (Shanghai) to ensure high specificity. Total RNA was extracted from mycelia of three A. alternata strains (QY2, QY21-C1, QY21-C2) subcultured for 3 generations using a standardized protocol (method 2.5). cDNA synthesis was performed with HiScript II Enzyme Mix (Vazyme) following the kit’s instructions. PCR amplification was conducted using a 25 μL reaction system with thermal cycling conditions: pre-denaturation at 95°C for 3 min, 35 cycles of 94°C (30 s), 58°C (30 s), and 72°C (30 s), followed by a final extension at 72°C for 5 min. PCR products were analyzed via 1.5% agarose gel electrophoresis and Sanger sequencing.

2.8 Generation of Aa-milR13 mutant or overexpression transformants in Alternaria alternata f. sp. mali

2.8.1 Construction of Aa-milR13 knockout vector

The precursor sequence of Aa-milR13 in A. alternata was obtained through milRNA sequencing. BLAST alignment was performed using the NCBI database (http://www.mirbase.org/). Based on the precursor sequence, 200 base pairs (bp) were extended towards the 5’ and 3’ ends, respectively. These extended precursor sequences were then located in the genome, and adjacent sequences of 1000 bp upstream and downstream were obtained. Based on these sequence information, specific primer pairs were designed for PCR amplification (upstream amplification primers: pΔmilR13-1-F: AAAAACGACGGCCAGTGAATTCTTTGTCCATTGAAGCGCATCG, pΔmilR13-1-R: TGCTCCTTCAAAAGGACCTTGCTGTCAAAGCTGC; downstream amplification primers: pΔmilR13-2-F: CCCTGGGTTCGCAAAAGATAAAAAGACAGTTAGACTGTTGTAAGGAAAAAAG, pΔmilR13-2-R: CAGGTCGACTCTAGAGGATCCCGTTATCGTACCTGACAGCCTG). PCR amplification was performed using hygromycin B as the resistance screen. Primers for the hygromycin B resistance gene with homologous parts upstream and downstream of the Aa-milR13 precursor were designed (phyg-F: CAAGGTCCTTTGAAGGAGCATTTTTTGGGC, phyg-R: TTATCTTTGCGAACCCAGGG) and amplified using the pUChyg plasmid as a template. The amplification products were ligated into the pUC19 vector, transformed, and verified by colony PCR. Sequencing was performed by Sangon Biotech (Shanghai, China). to confirm positive transformants.

2.8.2 Construction of Aa-milR13 overexpression vector

To construct the overexpression vector for Aa-milR13 in A. alternata, we first double-digested the pSilent-1 plasmid with FlyCut®XhoI and FlyCut®HindIII (Thermo Fisher Scientific) to generate compatible ends, followed by gel extraction (Qiagen) to purify the linearized vector. Using genomic DNA from A. alternata QY21-C2 as a template, the Aa-milR13 overexpression precursor fragment was amplified with primers pOE-milR13-F (5’-atcgataccgtcgacctcgagTCTTGGTACCAATGTCGTTGCTA-3’) and pOE-milR13-R (5’-cctgtatcctccagcaagcttTGTGAAGTTGAATTCAATCAGTATCCG-3’), where lowercase letters denote vector backbone sequences and italicized lowercase letters mark restriction enzyme recognition sites (XhoI and HindIII). The PCR product was ligated to the linearized pSilent-1 vector using the Vazyme Seamless Cloning Kit, and the ligation mixture was transformed into E. coli DH5α(Takara Bio Inc., Beijing) via heat shock (42°C for 45 s) with recovery in SOC medium. Positive transformants were selected on LB agar with 50 μg/mL hygromycin B, validated by colony PCR with the same primers, and confirmed by Sanger sequencing (Sangon Biotech, Shanghai). Verified recombinant plasmids were extracted for subsequent fungal transformation, ensuring high-purity DNA for downstream experiments.

2.8.3 PEG-mediated genetic transformation of Alternaria alternata f. sp. mali protoplasts

Protoplasts of the A. alternata strain QY21-C2 were prepared following a modified method of : mycelia were digested with lytic enzymes to generate protoplasts, which were filtered through a 40-μm nylon mesh and washed three times with sterile distilled water to remove enzyme residues. The protoplast concentration was adjusted to 1×107 cells/mL using a hemocytometer. Enriched fragments of the Aa-milR13 precursor knockout vector and overexpression vector were then subjected to PEG-mediated protoplast transformation: equal volumes of the protoplast suspension (1×107 cells/mL) and linearized DNA fragments were mixed gently in a 50-mL RNase & DNase free aseptic centrifuge tube, followed by the addition of PEG 4000 (Sigma-Aldrich) to a final concentration of 40% (w/v) and incubation at room temperature for 30 min to facilitate DNA uptake. After transformation, 1 mL of potato dextrose broth (PDB) containing 0.6 M sorbitol was added to stabilize the protoplasts, which were incubated at 28°C for 24 h to allow recovery and expression of the selectable marker ().

For knockout mutants, stable transformants growing on PDA plates supplemented with 100 μg/mL hygromycin B were verified by PCR using primers targeting the hygromycin resistance gene (phyg: phyg-F/phyg-R), Aa-milR13 precursor (pfmilR13-F: 5’-TCTTGGTACCAATGTCGTTGCT-3’/pfmilR13-R: 5’-TGTGAAGTTGAATTCAATCAGTATCC-3’), and Aa-milR13 precursor knockout vector backbone (pΔmilR13-1-F/pΔmilR13-2-R). RT-qPCR with primers pfmilR13-qF (5’-CGAAACCGTATAATCTCA-3’) and pfmilR13-qR (5’-TACCAAGTATGGCAACC-3’) and β-tubulin as the reference gene further confirmed downregulation of the Aa-milR13 precursor in these mutants. For overexpression mutants, genomic DNA was extracted from stable transformants growing on hygromycin-containing PDA plates, and PCR was performed using the overexpression fragment amplification primers pOE-milR-F/R to verify vector integration. RT-qPCR with the primers (pfmilR13-qF/pfmilR13-qR) was also used to validate Aa-milR13 overexpression.

Stable overexpression and knockout mutants were collected by centrifugation (5,000 × g, 5 min), resuspended in 50% glycerol (v/v) in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and stored at –80°C for subsequent experiments.

2.9 Phenotype and pathogenicity assay of Aa-milR13 knockout and overexpression strains

To evaluate the phenotypic and pathogenic characteristics of Aa-milR13 knockout and overexpression strains, two sets of experiments were conducted: colony morphology observation and detached plant tissue inoculation assays.

2.9.1 Colony morphology observation

Five-millimeter mycelial plugs from Aa-milR13 knockout mutants, overexpression strains, wild-type QY21, and QY21-C2 (control) were aseptically placed at the center of PDA plates. Plates were incubated upside down at 25°C in the dark for 7 days. Each treatment was repeated three times, with three replicate plates per strain. Daily observations were made to record colony morphology and measure colony diameter.

2.9.2 Detached leaf and fruit pathogenicity assay

Uniformly grown crabapple (Malus spectabilis) leaves and ‘Tianhong 2’ apple (M. domestica) fruits with consistent maturity and health status were selected. Tissues were rinsed thoroughly with deionized water to remove surface contaminants, then placed on sterile trays lined with double-layered, pre-soaked filter paper. All tissues were injured uniformly using a sterile inoculation needle (2 mm deep, 1 mm wide) to create standardized wounds. A 5-mm mycelial plug from each strain (Aa-milR13 knockout, overexpression, QY21, or QY21-C2) was placed on the wounded area with the mycelial surface facing the leaf or fruit tissue. Trays were sealed with double-layer plastic wrap to maintain high humidity during incubation.

Inoculated tissues were incubated at 25°C with 80% relative humidity for 14 days. Disease progression was assessed by tracing the margins of lesions onto red grid paper (1 cm × 1 cm squares) at 7-day intervals. Lesion areas were calculated by counting the number of grid squares covered by necrotic tissue and converting to square centimeters (cm²). Each treatment included three biological replicates, with three tissue samples per replicate.

3 Results and analysis

3.1 Differences in milRNA expression and base preference in strains of Alternaria alternata f. sp. mali with different virus

To elucidate the impact of virus infection on differential milRNA expression in A. alternata, we constructed milRNA libraries for the AaCV1 and AaMV1 co-infected strain QY21, the AaMV1 singly infected strain QY21-C1, and the virus-free strain QY21-C2, and performed deep sequencing. The results are shown in Table 1. The average raw reads for the three strain libraries were 10,341,053, 12,478,073, and 11,684,185, respectively. After removing contaminants and low-quality sequences, the average clean reads obtained for the libraries were 7,899,450, 8,910,066, and 8,049,814, respectively. The average error rates of the sequenced bases were all below 0.1%, and both Q20 and Q30 were above 95%, indicating good library construction quality and sequencing quality, and reliable data.

Table 1

SampleRaw readsRaw basesClean readsClean basesError rate (%)Q20 (%)Q30 (%)GC content (%)
QY21-C21168418587631390080498142101278290.023498.5595.8948.82
QY21-C11247807393585552589100662137666020.022698.9596.6846.29
QY211034105377557900078994502100664940.022698.9896.6850.68

Average sequencing data of small RNA from different virus-infected strains of Alternaria alternata f. sp. mali.

The reads of the reference genome were aligned with the miRBase and Rfam databases to obtain annotation information for known milRNAs. The miReap software was used to predict new milRNAs for reads without annotation information. Venn analysis of all milRNAs among samples was performed, and the results are shown in Figure 1A. Twenty-five milRNAs were expressed in all three strains, accounting for 11.25%. There were 36 specific milRNAs in QY21, accounting for 16.67%, 31 specific milRNAs in QY21-C1, accounting for 14.35%, and 104 specific milRNAs in QY21-C2, accounting for 48.15%. This suggests that virus infection can cause a decrease in the number of milRNAs. In addition, we analyzed the base preference of milRNAs in the three strains, and the results are shown in Figures 1B, C. Except for the first base of 23 nt milRNAs preferring G, milRNAs of other lengths preferred U. We also found certain preferences at other sites, such as a general lack of U at positions 2 to 4, and a preference for A at position 25.

Figure 1

3.2 Identification of differentially expressed milRNA in strains of Alternaria alternata f. sp. mali with different virus

Using DESeq2, we analyzed the differential expression of milRNA in strains with different virus types. The obtained P-values were corrected for multiple testing using the Benjamini and Hochberg method. The results, shown in Figure 2 and Table 2, revealed a total of 14 significantly differentially expressed milRNA. The largest number of significantly differentially expressed milRNA was found between the virus-free strain QY21-C2 and the co-infected strain QY21. Among the two virus-taking strains QY21 and QY21-C1, and the virus-free strain QY21-C2, there were two milRNA, Aa-milR87 (KV441478_174387) and Aa-milR13 (KV441481_212713), that showed significant differences in expression between the virus-free strain and the two virus-taking strains, but not between the two virus-taking strains themselves. Quantitative analysis of these two milRNA, shown in Figure 3, confirmed the sequencing results, with Aa-milR13 exhibiting a more significant difference in expression. Therefore, Aa-milR13 was selected for further investigation.

Figure 2

Table 2

milRNA IDQY21/QY21-C2QY21-C1/QY21-C2QY21/QY21-C1
Log2FCPadjustSignificant/ RegulateLog2FCPadjustSignificant/ RegulateLog2FCPadjustSignificant/ Regulate
KV441486_2621925.052.59E-02yes|up3.629.19E-01no|up1.431.00E+00no|up
KV441470_407665.672.76E-15yes|up1.171.00E+00no|up4.503.11E-08yes|up
KV441471_517023.851.18E-04yes|up1.241.00E+00no|up2.611.88E-01no|up
KV441478_174387-3.181.21E-07yes|down-2.125.10E-03yes|down-1.061.00E+00no|down
KV441469_166143.061.99E-01no|up4.731.34E-02yes|up-1.671.00E+00no|down
KV441487_271159-4.234.40E-05yes|down0.871.00E+00no|up-5.111.51E-06yes|down
mtr-miR52936.543.51E-02yes|up3.581.00E+00no|up2.951.00E+00no|up
KV441481_212713-2.552.59E-03yes|down-2.231.92E-02yes|down-0.321.00E+00no|down
KV441498_33308411.884.41E-16yes|up0.001.00E+00no|no_change9.262.93E-09yes|up
KV441487_2654630.001.00E+00no|no_change8.891.89E-06yes|up-5.521.93E-02yes|down
KV441492_3050169.333.29E-11yes|up13.131.28E-21yes|up-3.803.09E-08yes|down
KV441477_15723012.224.46E-17yes|up0.001.00E+00no|no_change9.606.39E-10yes|up
KV441490_2921512.693.84E-05yes|up4.073.28E-11yes|up-1.383.66E-01no|down
KV441490_2913940.001.00E+00no|no_change9.626.22E-09yes|up-6.249.19E-04yes|down

Differential expression of endogenous milRNA in Alternaria alternata f. sp. mali strains with different virus infection.

Log2FC (s1/s2): The base-2 logarithm of the fold change in miRNA expression between two samples (s2 serves as the control group). Padjust: The P-value adjusted for multiple hypothesis testing.; “yes” indicates significant difference in expression level; “no” indicates insignificant difference in expression level; “up” means up-regulation of expression level in the latter compared to the former; “down” means down-regulation of expression level in the latter compared to the former.

Figure 3

The stem-loop structure of Aa-milR13 was predicted using the RNAfold web server. The result, shown in Figure 4, indicated that the mature Aa-milR13 is located on the 5’ arm of the stem-loop structure, suggesting a highly conserved position of Aa-milR13 on its precursor gene. The thermodynamic predictions showed that the free energy of the thermodynamic system was -23.32 kcal/mol, and the minimum free energy was -22.90 kcal/mol, with a small difference between the two and both in a relatively low energy state, indicating that the structure is thermodynamically stable. In addition, the frequency of the Minimum Free Energy (MFE) structure was 50.99%, and the ensemble dispersion was 1.01, indicating a relatively high frequency and a relatively low dispersion, which suggests that this structure dominates in the thermodynamic system and is relatively concentrated, further demonstrating the stability of the Aa-milR13 stem-loop structure.

Figure 4

3.3 Verification of the presence of the precursor of Aa-milR13 in Alternaria alternata f. sp. mali

To further validate the stable presence of the Aa-milR13 precursor in A. alternata trains, three independent isolates (QY2, QY21-C1, and QY21-C2) were subcultured for 3 generations. RT-PCR amplification using strain-specific primers targeting the predicted Aa-milR13 precursor sequence produced a single prominent band of approximately 57 bp in all three subcultured strains (Figure 5), consistent with the predicted length of the Aa-milR13 precursor (57 bp). Sanger sequencing of the PCR products confirmed 100% sequence identity with the genomic sequence of the predicted Aa-milR13 precursor, with no detectable mutations or sequence divergence across generations. These results demonstrate that the Aa-milR13 precursor is stably maintained in A. alternata strains, confirming its role as the functional precursor encoding mature Aa-milR13.

Figure 5

3.4 Effects of knockout and overexpression of Aa-milR13 on Alternaria alternata f. sp. mali strains

To elucidate the effect of Aa-milR13 on A. alternata strains, an Aa-milR13 knockout vector and overexpression vector were constructed (as shown in Figures 6A–C, 7A–C). Knockout and overexpression transformants were obtained via PEG-mediated protoplast transformation. Stable genetically knocked-out mutant ΔQYC2-milR13 and overexpression mutant OE-milR13 were selected through hygromycin resistance screening. PCR and RT-qPCR identification results are shown in Figures 6D, E, 7D, E.

Figure 6

Figure 7

For phenotypic analysis, QY21-C2, QY21, ΔQYC2-milR13, and OE-milR13 were placed at the center of PDA plates and cultured for 1–7 days. Colony diameters were measured daily, and the results are shown in Figure 8. The mycelial growth rate of ΔQYC2-milR13 was slower, with a significantly smaller colony diameter compared to QY21-C2. Its colony color and diameter were closer to those of QY21. In contrast, the mycelial growth rate of OE-milR13 was accelerated, and its colony diameter showed no significant difference from that of QY21-C2.

Figure 8

To investigate the effect of Aa-milR13 on pathogenicity, QY21-C2, QY21, OE-milR13, and ΔQYC2-milR13 were cultivated under equivalent conditions (28°C in the dark for 5 days). Five-millimeter-diameter mycelial plugs were collected from each strain and inoculated onto detached crabapple leaves and apple fruits (cv. ‘Tianhong 2’). Lesion diameters were measured 14 days post-inoculation, and the results are shown in Figures 9, 10. OE-milR13 exhibited the strongest pathogenicity, with leaf and fruit lesions significantly larger than those of the virus-free strain QY21-0C2 and other strains (QY21-C2 > ΔQYC2-milR13> QY21). Lesions of ΔQYC2-milR13 were significantly smaller than those of QY21-C2, indicating a marked reduction in pathogenicity. The QY21 strain showed the smallest lesions. These results suggest that deletion of Aa-milR13 significantly reduces the pathogenicity of A. alternata strains, whereas overexpression of Aa-milR13 significantly enhances their pathogenicity.

Figure 9

Figure 10

3.5 Target genes analysis of Aa-milR13 in Alternaria alternata f. sp. mali

To further investigate the role of Aa-milR13 in the pathogenicity of A. alternata, we predicted the target genes of Aa-milR13. The results are shown in Table 3. Three potential intracellular target genes, AaSLP, DUF431, and NrtB, were predicted using the RNAhybrid online website. These genes correspond to a subtilisin-like protease (CC77DRAFT_1100266), a DUF431 domain-containing protein (CC77DRAFT_1022347), and a high-affinity nitrate transporter NrtB (CC77DRAFT_1056077), respectively. 0

Table 3

Name of target geneTarget_Acc.Length of target geneTarget regionsStart and stop site of targetBinding free energyInteraction modeEncoded protein
AaSLPCC77DRAFT_110026620591046-1066U、U-31.1CleavageSubtilisin-like protein
DUF431CC77DRAFT_10223471434873-893G、U-31.4Cleavagedomain-containing protein
NrtBCC77DRAFT_105607717431051-1071U、G-31.4CleavageHigh affinity nitrate transporter NrtB

Information on intracellular target genes of Aa-milR13 in Alternaria alternata f. sp. mali.

To clarify the synergistic expression changes between these three genes and Aa-milR13 in the strain, RT-qPCR analysis was conducted. The results, shown in Figure 11, indicate that the expression levels of the three genes significantly increased following Aa-milR13 knockout, whereas they were significantly downregulated in the overexpression strain compared to QY21-C2. This pattern suggests a significant negative correlation between Aa-milR13 and the expression levels of these target genes, implying that Aa-milR13 may directly target AaSLP, DUF431, and NrtB. Notably, the highest expression levels of the target genes were observed in the virus-infected strain, indicating that viral infection-induced downregulation of Aa-milR13 might be the primary driver of the upregulated expression of these three genes.

Figure 11

Upon reviewing the literature, the functions of the aforementioned potential target genes in Alternaria species have not been reported. We analyzed the cleavage mode and target regions of Aa-milR13 to its target genes. The results, shown in Figure 12, indicate that the target regions of Aa-milR13 are all located in the CDS regions of the target genes and act through cleavage. The pairing between Aa-milR13 and the target genes involves Watson-Crick pairing of AU and CG, wobble pairing of GU, and various other pairing modes such as AA, AC, AG, GG, UU, and UC.

Figure 12

The primary structures of AaSLP, DUF431, and NrtB were analyzed using the Portparam online software. The results show that AaSLP has a molecular mass of 50 kD, a theoretical isoelectric point (pI) of 9.25, and a molecular formula of C2198H3482N642O656S20. It contains multiple amino acids, with a high content of alanine (Ala) at 8.7%. DUF431 has a molecular mass of 23 kD, a theoretical pI of 4.88, and a molecular formula of C2567H3920N646O676S23. It has the highest leucine (Leu) content at 9.7%, an instability index of 38.9, and is classified as a stable protein. NrtB has a molecular mass of 55 kD, a theoretical pI of 8.89, and a molecular formula of C2567H3920N646O676S23. It has a high glycine (Gly) content at 10.4%, an instability index of 25.66, and is considered a stable protein.

The secondary structures of AaSLP, DUF431, and NrtB proteins were predicted using the predictprotein software. The results, shown in Figure 13, indicate that all three are proteins with heterogeneous secondary structure compositions. AaSLP and DUF431 are dominated by random coils, accounting for more than 50%, while NrtB is dominated by α-helices, accounting for 56.19% (Figure 13A). Homologous three-dimensional structural modeling using the SWISS-MODEL online tool revealed that the three genes are mainly composed of α-helices and random coils, with a small amount of β-sheets, which is consistent with the secondary structure prediction results (Figure 13B).

Figure 13

4 Discussion

4.1 Aa-milR13 may mediate the regulation of host virulence by mycovirus

The RNA silencing system serves as a primary signaling pathway for virus-host interactions. RNA interference (RNAi) is a conserved mechanism in eukaryotes that regulates gene expression through mRNA cleavage, transcriptional or translational repression (). MicroRNAs (miRNAs) are one of the key regulatory factors of RNAi in eukaryotes (). When a virus infects a host, it can alter the levels of host miRNAs, thereby regulating the expression of numerous target genes and achieving widespread gene silencing effects. This, in turn, affects the physiological metabolism and various critical functions of the host, such as growth and reproduction, substance transport and metabolism, stress response and resistance, pathogenicity, and parasitism ability. The discovery of milRNA in fungi lags behind that in plants, with a relatively small number and low conservation. With the advancement of sequencing technology, an increasing number of fungal milRNA have been discovered and identified. Using sequencing technology, two milRNA and 42 novel milRNA have been found in Sclerotinia sclerotiorum (), 19 milRNA have been identified in F. oxysporum (), and 57 milRNA have been identified in Valsa mali (). In this study, 44 putative milRNAs (homologous to miRBase-annotated miRNAs) and 172 novel milRNAs were identified in A. alternata f. sp. mali strains, representing the first comprehensive characterization of milRNAs in this species. We analyzed the differentially expressed milRNA in strains with mycovirus and without mycovirus. The expression levels of Aa-milR87 and Aa-milR13 were significantly lower in the virus-taking strains QY21 and QY21-C1 than in the virus-free strain QY21-C2, with no significant difference between the virus-taking strains. This was verified by RT-qPCR, and Aa-milR13 exhibited a more significant difference. When Aa-milR13 was knocked out in the virus-free strain, the biological traits of the mutant were closer to those of the virus-taking strain, and its pathogenicity was also significantly reduced. This confirms that Aa-milR13 is likely involved in the process of virus-regulated hypovirulence in the host.

4.2 The targeting mode of Aa-milR13 to target genes

Fungal virus infection induces differential expression of functional milRNA in the host, which forms the miRISC silencing complex by binding to AGO proteins and targets key virulence genes, leading to host virulence decline (; ). In plants and animals, different AGOs determine the type of bound sRNA based on their 5’ terminal nucleotide preference (). Arabidopsis AGO2 and AGO4 mainly bind sRNA starting with 5’ adenine (A), while AGO1 primarily binds 5’ uracil (U) sRNA (). In this study, Except for 23 nt milRNA with a preference for G as the first base, milRNA of other lengths preferred U. This suggests that among the AGOs, at least one prefers binding to 5’ uracil (U) and one prefers binding to 5’ guanine (G), but further research is needed to determine which AGO proteins play a major role.

In addition, unlike plant and animal miRNAs, Aa-milR13 employs a multi-compatible base-pairing mechanism with its potential fungal target genes (AaSLP, DUF431, and NrtB). Aa-milR13 primarily interacts with the coding sequences (CDS) of its targets, diverging from animal miRNAs (3’UTR-focused) or plant miRNAs (CDS-start-site-focused) (). This CDS-centric targeting allows direct disruption of fungal protein synthesis. Aa-milR13 accommodates Watson-Crick (AU/CG), G-U wobble, and non-canonical (AA/AC/AG/GG/UU/UC) pairs, relaxing the “seed-region rigidity” of canonical miRNAs (). Aa-milR13 drives efficient mRNA cleavage in a pairing-pattern-dependent manner, contrasting with animal miRNAs (rare cleavage) or plant miRNAs (cleavage restricted to near-perfect complementarity). This cleavage dominance reflects fungal evolutionary adaptations to rapidly silence critical genes (). The findings of this study provide clues for a deeper understanding of the regulatory mechanisms of gene expression.

4.3 Prediction of Aa-milR13 potential target gene functions

We further predicted the function of the potential target genes of Aa-milR13. We speculated that virus infection triggers the downregulation of Aa-milR13 in the host A. alternata, which in turn upregulates the expression of target genes, thereby affecting the host’s biological traits and virulence.

The predicted Aa-milR13 potential target genes in the host include Subtilisin-like protein, high affinity nitrate transporter NrtB, and DUF431-domain-containing protein. The functions of these genes in A. alternata have not been reported. Firstly, as a type of protease, Subtilisin-like protein involved in protein hydrolysis and degradation processes. It has been reported that Subtilisin-like proteins in microorganisms are associated with inducing programmed cell death in host cells, which can affect the expression of defense enzymes and defense-related genes in the host, and trigger host immune responses (; ; ). High Affinity Nitrate Transporter (NrtB) is usually found in plants, responsible for transmembrane transport of nitrate in environments with low nitrate concentrations, and is a key protein for plant nitrogen nutrition absorption. reported disruption of the Aspergillus nidulans high-affinity nitrate transporter genes NrtB prevents growth on nitrate (). DUF431 domain-containing protein is predicted to be an SAM-dependent RNA methyltransferase in NCBI, catalyzing RNA methylation and RNA modification enzymes, which has not been reported in A. alternata. however, in F. verticillioides, it was found that RNA m5C methylation modification was negatively correlated with fumonisin biosynthesis (). In our study, when A. alternata is infected by virus, the expression of Aa-milR13 is downregulated. This downregulation may relieve the inhibitory effect of Aa-milR13 on its target genes. Consequently, these alterations might indirectly influence the overall physiology and metabolism of the fungus, including its pathogenicity. Further in-depth research is required to determine the precise interactions.

In addition, we also analyzed the target genes of Aa-milR13 in plants (Table 4) and found that the number of target genes in apples was much higher than that in A. alternata. Most of the target genes in apples are related to growth and development regulation and apple host defense immunity. To further clarify the cross-kingdom regulatory potential of Aa-milR13, we could perform dual-luciferase reporter assays in Nicotiana benthamiana to validate its direct post-transcriptional regulation of high-confidence apple defense genes (), which would help reveal how Aa-milR13 interacts with host gene expression during infection. Second, to investigate the molecular mechanisms underlying its cross-kingdom activity, we could track Aa-milR13 subcellular localization in N. benthamiana using fluorescent labeling and live-cell imaging, as previously observed for fungal small RNAs like those from B. cinerea (). Additionally, testing the dependence of Aa-milR13-mediated regulation on host RNAi components via knockout assays could clarify its reliance on plant machinery (). Collectively, these studies will clarify Aa-milR13’s role as a cross-kingdom regulator.

Table 4

Target_Acc.Target regionsBinding free energyEncoded protein
LOC1034547841923-1946-20.33developmentally-regulated G-protein 3-like
LOC103426542643-665-21.94starch synthase 4, loroplastic/amyloplastic
LOC1034128571083-1103-21.35protein SUPPRESSOR OF PHYA-105 1
LOC103427323696-716-22.43LRR receptor-like serine/threonine-protein kinase At3g47570
LOC1034324542721-2741-20.11elongation factor Tu, mitochondrial
LOC1034364262717-2738-20.17homeobox protein HAT3.1-like
LOC103443237531-551-23.74xyloglucan glycosyltransferase 5
LOC103453238644-665-20.37early light-induced protein 1, chloroplastic-like
LOC103437620626-647-20.11heavy metal-associated isoprenylated plant protein 23
LOC10343372425827-25847-21.2rust resistance kinase Lr10-like
LOC1034209565759-5777-22.91TMV resistance protein N-like
LOC1034348531683-1708-20.37peroxidase 19
LOC1034399301297-1314-20.31CDPK-related kinase 4-like
LOC1034125973450-3472-21.36endo-1,4-beta-xylanase 5-like
LOC1081694781199-1219-21.61DNA (cytosine-5)-methyltransferase CMT3-like
LOC1148192743109-3129-21.86probable WRKY transcription factor 20

Information of target genes of Aa-milR13 from Alternaria alternata f. sp. mali in apple.

4.4 Theoretical significance and practical application value of studying Aa-milR13

The study of Aa-milR13 in A. alternata has important theoretical significance and practical application value. From a theoretical perspective, studying Aa-milR13 helps to gain a deeper understanding of the life activity mechanisms of fungi, especially the role of small RNAs in fungal growth, development, and pathogenicity. This will provide new clues and ideas for further revealing the biological characteristics of fungi. From a practical application perspective, research on Aa-milR13 is expected to provide new strategies and methods for the prevention and control of apple diseases. For example, inhibitors or interference technologies targeting Aa-milR13 can be developed to reduce fungal pathogenicity and enhance apple defense capabilities, thereby reducing the occurrence of apple diseases. In addition, Aa-milR13 can be utilized as a biomarker for early detection and diagnosis of apple diseases, providing a basis for timely adoption of prevention and control measures.

5 Conclusion

In this study, through miRNA sequencing and a series of molecular biological experiments, we revealed the relationship between Aa-milR13 and the regulation of host pathogenicity by mycovirus in A. alternata f. sp. mali strains. The results showed that the expression levels of Aa-milR13 in the two virus-taking strains with low pathogenicity were significantly lower than those in the virus-free strain, Knockout of Aa-milR13 in virus-free strain resulted in slower hyphal growth, darker colony color, and reduced pathogenicity, resembling virus-infected strains. Conversely, overexpression of Aa-milR13 led to accelerated hyphal growth, lighter colony color, and significantly enhanced pathogenicity. Meanwhile, the expression levels of three potential target genes of Aa-milR13 (AaSLP, DUF431 and NrtB) were significantly upregulated in the knockout mutant, but remarkably downregulated in the Aa-milR13-overexpressed strain, showing a negative correlation with the expression level of Aa-milR13. Bioinformatics analysis indicated that Aa-milR13 targets the CDS regions of these genes through cleavage. This study is the first to report the involvement of small RNAs as an intermediate bridge in the regulation of host virulence by mycovirus, laying the foundation for elucidating the mechanism of small RNA-mediated regulation of host fungal hypovirulence by mycovirus and providing theoretical support for the utilization of mycovirus in the control of crop fungal diseases.

Statements

Data availability statement

The original contributions presented in the study are publicly available. This data can be found here: https://www.jianguoyun.com/p/DbH_84cQzbvGDRjcvokGIAA.

Author contributions

JZ: Formal analysis, Software, Writing – original draft, Visualization, Data curation, Writing – review & editing, Validation, Methodology. CL: Methodology, Data curation, Visualization, Software, Writing – original draft, Validation, Formal analysis, Writing – review & editing. SY: Formal analysis, Writing – review & editing, Methodology, Writing – original draft, Data curation. YF: Data curation, Writing – review & editing, Formal analysis, Writing – original draft. ML: Formal analysis, Writing – review & editing, Writing – original draft, Investigation. BL: Writing – review & editing, Writing – original draft, Data curation, Formal analysis. SW: Writing – original draft, Methodology, Writing – review & editing, Conceptualization. KC: Writing – original draft, Project administration, Supervision, Writing – review & editing. YW: Conceptualization, Supervision, Project administration, Data curation, Writing – original draft, Writing – review & editing, Funding acquisition.

Funding

The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by grants from the Hebei Provincial Natural Science Foundation (C2022204196), the Hebei Provincial Key Research and Development Program (21326506D), Qinhuangdao Modern Agricultural Industrial Technology System for Cherries and the National Modern Agricultural (Apple) Industry Technology System (CARS-27).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2025.1598183/full#supplementary-material.

References

Summary

Keywords

Alternaria alternata f. sp. mali, mycovirus, milRNA, hypovirulence mechanism, interaction mechanism

Citation

Zhang J, Li C, You S, Feng Y, Liu M, Li B, Wang S, Cao K and Wang Y (2025) The infection of mycovirus down regulates Aa-milR13 to weaken the pathogenicity of the Alternaria alternata f. sp. mali. Front. Plant Sci. 16:1598183. doi: 10.3389/fpls.2025.1598183

Received

22 March 2025

Accepted

26 June 2025

Published

22 July 2025

Volume

16 - 2025

Edited by

Jia-He Wu, Chinese Academy of Sciences (CAS), China

Reviewed by

Shin-Yi Lee Marzano, United States Department of Agriculture, United States

Xiaofeng Su, Chinese Academy of Agricultural Sciences, China

Updates

Copyright

*Correspondence: Yanan Wang,

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics