ORIGINAL RESEARCH article

Front. Plant Sci., 13 October 2025

Sec. Plant Pathogen Interactions

Volume 16 - 2025 | https://doi.org/10.3389/fpls.2025.1630288

Analysis of the sulfate permease family in Bursaphelenchus xylophilus in the nematode development and stress adaptation

  • 1. The Key Laboratory of Forest Resources Conservation and Utilization in the Southwest Mountains of China Ministry of Education, Southwest Forestry University, Kunming, China

  • 2. The Construction Program of Yunnan Provincial Key Laboratory for Conservation and Utilization of In-forest Resource, Southwest Forestry University, Kunming, China

Abstract

Introduction:

Pine wilt disease (PWD), caused by the pine wood nematode (PWN) Bursaphelenchus xylophilus, poses a significant threat to global pine forests. The sulfate permease (SULP) family is essential for sulfate transport, sulfur assimilation and cellular homeostasis, yet it remains uncharacterized in B. xylophilus. This study aimed to comprehensively identify all members of the SULP family in B. xylophilus and to elucidate their roles in nematode development and stress adaptation.

Methods:

Through genomic data analysis, we identified 10 members of the SULP family in B. xylophilus and conducted a comprehensive characterization of their physicochemical properties, conserved motifs, protein structures, and gene expression profiles across different developmental stages.

Results:

The results revealed Bx-sulps were located on 5 chromosomes of B. xylophilus. Phylogenetic analysis unveiled both conserved and divergent evolutionary patterns of these proteins compared to counterparts in other nematodes. Expression analysis demonstrated upregulation of Bx-sulps during the dauer third-instar larva (D3) stage, suggesting their involvement in stress response and diapause. Moreover, certain Bx-sulps exhibited high expression levels in adult stages, indicating a potential role in reproductive processes.

Discussion:

The study presents the first comprehensive examination of BxSULP family, shed light on its significance in nematode development and stress adaptation. These findings provide the groundwork for further functional investigations and may aid in the development of targeted strategies for managing PWD.

1 Introduction

Pine wilt disease (PWD), caused by the pine wood nematode (PWN) Bursaphelenchus xylophilus, is one of the greatest threats to pine (). First identified in Japan in the 20th century, PWD has become a major concern for global forestry (). In China, PWD has impacted 620 counties in 18 provinces, spreading rapidly to westward and northward (; ). At present, the management strategies for PWD focus on integration monitoring, early detection, and rapid response methods. Integrated pest management (IPM) practices, including cultural techniques (such as proper watering, mulching, and pruning to enhance tree health), biological control, and chemical interventions (insecticides and nematicides), are commonly employed to reduce PWD incidence (). B. xylophilus is primarily spread by vector insects, notably the genus Monochamus. These insects introduce B. xylophilus into healthy pines while laying eggs or feeding on infected ().

Under natural conditions, B. xylophilus alternates between two life-history modules: a propagative phase within living pines and a dispersal phase between hosts (). During propagation, eggs hatched into second instar larva (L2), which molt through third instar larva (L3) and fourth instar larva (L4) before maturing into adults (). Entirely confined to the resin canal system, this phase supported exponential population growth under favorable temperature and moisture. Declining temperature and host humidity triggered L2 to divert into the dispersal pathway, molting into dauer third-instar larva (D3) (). These accumulate lipid reserves, thicken their cuticles, and aggregated around pupal chambers of the M. alternatus (). After quiescence, D3 molted into dauer fourth-instar larva (D4), which were transported by emerging beetles and inoculated into new host trees during maturation feeding, initiating further infections ().

B. xylophilus is capable of proliferating and multiplying within the resin canals of its pine host, a trait closely linked to the adaptive evolution of its gene family (). Investigating the expression patterns and roles of individual gene family members of B. xylophilus can elucidate their contributions to the nematode’s growth and development, offering valuable insights for identifying molecular targets to manage B. xylophilus. Research of gene families in B. xylophilus has advanced considerably in recent decades. Genome analysis has revealed several gene families crucial for the adaptive evolution and pathogenicity of B. xylophilus. The cytochrome P450 (CYP450) family in B. xylophilus has undergone significant amplification, facilitating the detoxification and metabolism of pine defense chemicals by the nematode (). The flavin-containing monooxygenase (FMO) family contributes to detoxification processes, enabling the nematode to thrive in pine resin channels (). The glycoside hydrolase (GH) family aids in the degradation of pine cell walls, thereby enhancing the nematode’s pathogenicity (). Nevertheless, investigations into the Sulfate permease family in B. xylophilus remain relatively limited. Sulfur is essential for synthesizing sulfur-containing amino acids like cysteine and methionine, crucial for protein synthesis in nematodes (). This suggested that Bx-sulps might similarly determine PWN fitness within the host, making them high-value targets for RNAi- or HIGS-based control strategies.

In B. xylophilus, the SULP family may be linked to the evolutionary adaptation of nematodes to pine environments. Through enhanced sulfate uptake and utilization, B. xylophilus may exhibit improved adaptation to pine defense mechanisms. To date, the functional characterization of the SULP family in B. xylophilus remains unexplored. This study represents the first systematic investigation into the SULP family within B. xylophilus. The research aimed to identify all members of the SULP family in B. xylophilus and to elucidate their roles in nematode development and stress adaptation.

2 Materials and methods

2.1 Physicochemical properties analysis of BxSULPs

Firstly, we obtained the whole genome of B. xylophilus (SAMEA7282713) (https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_904067135.1/) data from Wormbase (https://parasite.wormbase.org). To obtain a representative set of SULP orthologues, we first screened all publicly available nematode genomes deposited in NCBI database (https://www.ncbi.nlm.nih.gov/gene) () for the presence of complete, well-annotated SULP families. After applying strict criteria for sequence completeness and annotation quality, only three genomes (Brugia malayi, Caenorhabditis elegans, and Caenorhabditis briggsae) were retained. We used BLASTX to compare the queried protein sequence with the protein database of B. xylophilus to obtain the candidate BxSULPs sequence. BLAST searches were performed with an E-value cut-off of 1 × 10-5, ≥ 30% query coverage and ≥ 25% identity. After that, we queried the Pfam database (https://pfam.xfam.org/) to search for the conserved structural domains possessed by the SULP protein and downloaded its Hidden Markov Model (). The protein sequences with the Hidden Markov Model were then searched from the protein database of B. xylophilus by HMMER3.0 software. HMMER 3.0 was run using the trusted cut-off (TC) defined in Pfam for the Sulfate_transp and STAS domains, with an inclusion threshold of E ≤ 1 × 10–5 and a minimum alignment coverage of 70% of the Pfam model. Finally, the candidate sequences were characterized using NCBI-conserved domains (https://www.ncbi.nlm.nih.gov/Structure/cdd) () and InterPro (https://www.ebi.ac.uk/Interpro) () to eliminate duplicates and acquire the protein sequences of BxSULPs. The physicochemical properties of BxSULPs were analyzed using Expasy 3.0 (https://web.expasy.org/protparam) ().

2.2 Phylogenetic analysis of BxSULPs and analysis of conserved motifs

In order to evaluate the extent of phylogenetic similarity among the 10 protein sequences, we conducted phylogenetic and conserved motif analyses of BxSULPs. Evolutionary relationships of BxSULP were analyzed using MEGA 11.0 software through multiple sequence alignments of 10 BxSULPs and the optimal model for the maximum likelihood tree was determined. Based on the prediction results of the maximum likelihood tree in the best model, the LG model was selected to construct the phylogenetic evolutionary tree of BxSULP. This model had a BIC (Bayesian Information Criterion) value of 11645.256 and an AICc (Corrected Akaike Information Criterion) value of 11362.515. The model was chosen because it provided the lowest BIC value (11645.256), indicating that it is the best fit for the data among the tested models (). A maximum likelihood evolutionary tree was constructed with the Bootstrap test performed 1000 times (). Subsequently, the constructed phylogenetic evolutionary tree was landscaped using iTOL (https://itol.embl.de/tree/) (). Gene information for Bx-sulps was obtained from the gene structure annotation file, and gene structure analysis was conducted using the GSDS 2.0 (http://gsds.gao-lab.org/) (). Additionally, the distribution of conserved motifs in BxSULPs was examined using MEME Suite 5.5.6 (https://meme-suite.org/meme/) () with default parameters and a motif value of 8. The results from MEME were combined with the maximum likelihood tree to create gene structure maps with annotated conserved motifs.

2.3 Chromosomal distribution and protein structure analysis of BxSULPs

The gene density information of B. xylophilus from the annotation file of gene structure was extracted by Gene Density Profile function of TBtools. Then, we integrated the annotation file and the density file to map the distribution of BxSULP on chromosomes by Gene Location Visualize from GTF/GFF function (, ). Subsequent analysis included predicting the secondary structure of BxSULPs using online tools like Prabi (https://doua.prabi.fr/software/cap3) (), NetPhos 3.1 (https://services.healthtech.dtu.dk/services/NetPhos-3.1/) (), and Protter 1.0 (http://wlab.ethz.ch/protter/start/) (). Swiss-Model (https://swissmodel.expasy.org/interactive) () was employed to forecast the protein tertiary structure, and SAVES v6.1 (https://saves.mbi.ucla.edu) was used to create Ramachandran diagrams.

2.4 Isolation and identification of B. xylophilus

B. xylophilus was isolated from symptomatic Pinus thunbergii logs collected in Zhejiang Province, China. Xylem samples were cut into 2–3 cm thick disks and placed on a modified Baermann funnel (25 °C, 24 h) (). Nematodes that migrated into the collection tube were recovered and examined under a light microscope. Individual adult females were carefully picked out and identified to species according to the morphological diagnostic criteria (). Only those specimens that exhibit the typical morphological characteristics of B. xylophilus are retained for subsequent cultures and experiments.

2.5 Culture of B. xylophilus in different developmental stages

Synchronized eggs were obtained from embryos by incubating mixed-stage B. xylophilus in petri dishes at 25 °C in the absence of light for 10 minutes. This process facilitated the adhesion of eggs to the substrate through surface glycoproteins. The top layer containing water and nematodes was then removed to harvest the synchronized eggs. Subsequently, these eggs were allowed to hatch at 25 °C in the dark to yield second instar larvae (L2) in a nutrient-free setting. These synchronized L2 larvae were then transferred onto a Botrytis cinerea lawn on a PDA plate. Nematodes were harvested at 24, 48, and 72-hour intervals to obtain third instar larvae (L3), fourth instar larvae (L4), and adults, respectively. Dauer third-instar larvae (D3) and dauer fourth-instar larvae (D4) were isolated from infected pinewood by Baermann funnel. Male and female nematodes were manually sorted under microscope using worm pickers ().

2.6 Expression profiles of BxSULP family in different developmental stages

Gene expression in distinct developmental stages was analyzed by reverse-transcription quantitative polymerase chain reaction (RT-qPCR) by synchronizing B. xylophilus in different developmental stages. To explore the molecular response mechanisms of Bx-sulps to various treatments, expression levels of 10 Bx-sulps were determined across various developmental stages of B. xylophilus, including eggs. The statistical significance of the data was determined using a one-way analysis of variance (ANOVA) using GraphPad Prism 10.6.0.890 with a student’s t-test with p < 0.05 as the significance threshold.

2.7 Validation of gene expression by RT-qPCR

Differentially expressed genes were chosen for validation via RT-qPCR (). Primer sequences were generated with Primer 6.0 software and subsequently synthesized by Sangon Biotech (Shanghai, China) (Table 1). Amplification was performed on a QuantStudio 1 Plus instrument (Thermo Fisher Scientific, USA) following the manufacturer’s instructions for the One Step PrimeScript™ RT-PCR Kit (RR064A, Beijing), and relative gene expression was calculated using the -ΔΔCt method. Gene-expression data were normalized to the Bx28S rRNA reference gene.

Table 1

Protein ID of B. xylophilusProtein namePrimer sequences
BXYJ5.010268100BxSULP1F: CCCACTTTCAGGCTCTCCAG
R: CCGAAACGACAGATTGGTGC
BXYJ5.020105600BxSULP2F: CTGGTTTCATTAACGGCGGC
R: ACACCGTTAAGAGCAGGGTG
BXYJ5.020147800BxSULP3F: AACTTTTCGCTGTCTCCGCT
R: AGACGGCGATGTGTTCTGAT
BXYJ5.030165800BxSULP4F: CACGCTTTCGAGCTATGTGC
R: GAGACCGCCAATACTCTGGG
BXYJ5.030215700BxSULP5F: GGCCAAAATTCCAGCACCTG
R: CCAGCAGATCCGAGCCATAG
BXYJ5.050106800BxSULP6F: CTTGGCTTCATGGGGACACT
R: GACTCCACACTCAACGCTCA
BXYJ5.050140100BxSULP7F: AACTGCCCTGATGGTTGGAG
R: CGGGGGCTACATCCATTCTC
BXYJ5.050219300BxSULP8F: TTTTGTCGCACCTGACCGTA
R: GTCAATTCGTATACACTTTTTCCGT
BXYJ5.060009300BxSULP9F: TGATAGGGAAAGAGGGGCGA
R: GCCAGAACGGAGTAGGCAAT
BXYJ5.060037700BxSULP10F: GAAGCCACTGCCAAACCAAG
R: TCATCGGGTGGGAGTCTGAT
28S/F: AACCGAACACGCGACAATAG
R: GTGCGTATTCAGCCTTCTGG

RT-qPCR primer sequences.

3 Results

3.1 Identification of BxSULPs

Following a BLASTX search in the Wormbase database and subsequent validation of conserved domains using Conserved Domains and InterPro, we identified 10 distinct SULP proteins in B. xylophilus, designated as BxSULP1 to BxSULP10 based according to their ascending order on chromosomes (Table 2). To further elucidate the evolutionary relationships, we conducted a comparative analysis of the protein sequences of SULP found in BxSULP1 to BxSULP10 with those of analogous proteins from other nematodes.

Table 2

Protein ID of B. xylophilusProtein nameSequence ID in NCBIProtein name in other nematodesOther nematodes nameScores of blastPSimilarity e-value% identity
BXYJ5.010268100BxSULP1CBG_23242Protein CBR-SULP-4Caenorhabditis briggsae3351.8×10-12136.2
BXYJ5.020105600BxSULP2CELE_F41D9.5Protein CE-SULP-3Caenorhabditis elegans3021.5×10-14058.4
BXYJ5.020147800BxSULP3CELE_ZK287.2Protein CE-SULP-8Caenorhabditis elegans1998.7×10-6235.0
BXYJ5.030165800BxSULP4CBG_23242Protein CBR-SULP-4Caenorhabditis briggsae2242.6×10-3728.4
BXYJ5.030215700BxSULP5CELE_K12G11.2Protein CE-SULP-5Caenorhabditis elegans1472.3×10-3728.3
BXYJ5.050106800BxSULP6CBG_23241Protein CBR-SULP-5Caenorhabditis briggsae2342.2×10-10147.0
BXYJ5.050140100BxSULP7CELE_W01B11.2Protein CE-SULP-6Caenorhabditis elegans2492.5×10-14246.7
BXYJ5.050219300BxSULP8CELE_ZK287.2Protein CE-SULP-8Caenorhabditis briggsae4628.4×10-14856.5
BXYJ5.060009300BxSULP9CBG_23241Protein CBR-SULP-5Caenorhabditis elegans3433.1×10-13351.5
BXYJ5.060037700BxSULP10CBG_23241Protein CBR-SULP-5Caenorhabditis briggsae3031.9×10-12948.9

Comparison of BxSULPs with other nematodes.

Comparative analysis of BxSULPs with homologs from nematodes like C. briggsae and C. elegans revealed both conserved and divergent evolutionary patterns. High BLASTP scores (above 100) and low E-values (below 1×10-10) indicated significant sequence similarity, implying shared conserved structural and functional domains, notably in the Sulfate Transporter and Anti-sigma factor antagonist (STAS) domain crucial for sulfate binding and transport. Notably, BxSULP8 exhibited a remarkable BLASTP score of 462 and an exceptionally low E-value of 8.4×10–148 compared to a STAS domain-containing protein in C. elegans. This high degree of sequence similarity suggested that BxSULP8 was highly conserved and likely played a crucial role in sulfate transport, similar to its orthologs in other nematodes. Given the critical function of the STAS domain in sulfate binding and transport, BxSULP8 might be particularly important for maintaining sulfate homeostasis in B. xylophilus. This warrants further functional investigations to elucidate its specific role in nematode biology. These differences underscored the importance of understanding the evolutionary and functional contexts of SULP across diverse nematode species, providing insights for targeted potential control strategies and targeted interventions.

3.2 Physicochemical analysis of BxSULPs

The average number of amino acids in BxSULPs was 202.2, with an average molecular mass of 22.71 kDa. The size of BxSULP varied, ranging from 17.63 kDa (BxSULP1) to 29.47 kDa (BxSULP2). Notably, BxSULP10, the largest protein, may exhibit more intricate functionalities or interactions. The isoelectric points (pI) of BxSULPs spanned from 6.51 (BxSULP6) to 10.19 (BxSULP9). Proteins with pI values near neutrality are anticipated to demonstrate enhanced stability under physiological conditions, whereas those with extreme pI values might serve specialized roles. BxSULP9 could participate in processes occurring in high pH environments. BxSULP6, characterized by the highest aliphatic index (119.51), may exhibit greater resistance to thermal denaturation compared to other BxSULPs, a critical feature for its potential function in extreme nematode environments. BxSULP2, BxSULP5, BxSULP9, and BxSULP10 were hydrophilic, while the remaining proteins were hydrophobic. BxSULP4, BxSULP7, and BxSULP8 demonstrated stability, contrasting with the instability observed in the other proteins. This suggested that protein may possess more robust structures, potentially ensuring sustained functionality over time (Table 3).

Table 3

Protein nameNumber of amino acidsMolecular weight/kDaIsoelectric point1Aliphatic index2Hydropathicity3Instability index4Stability
BxSULP115817.639.9685.190.06851.61Unstable
BxSULP225729.479.6094.79-0.12546.28Unstable
BxSULP320022.329.3099.950.40246.92Unstable
BxSULP416718.758.58105.030.10034.51Stable
BxSULP517320.2310.0982.89-0.12453.37Unstable
BxSULP622525.526.51119.510.51043.38Unstable
BxSULP718119.768.22114.640.89337.56Stable
BxSULP822724.719.90109.910.76331.44Stable
BxSULP917219.5010.1972.67-0.24759.18Unstable
BxSULP1026229.187.7475.92-0.04949.91Unstable

Physicochemical properties analysis of BxSULPs.

1 Isoelectric point (pI): The isoelectric point (pI) is the pH at which a protein carries no net electrical charge.

2 Aliphatic indexes: The Aliphatic Index is a measure that describes the relative volume occupied by aliphatic side chains in a protein.

3 Hydropathicity: Hydropathicity is a relative value used to measure the hydrophobicity or hydrophilicity of a molecule. Positive values indicate hydrophobicity, while negative values indicate hydrophilicity.

4 Instability index: The Instability Index is a metric used to evaluate the stability of proteins. If the Instability Index is less than 40, the protein is considered stable. If the Instability Index is greater than 40, the protein is unstable.

3.3 Phylogenetic and conserved motif analysis of BxSULPs

We performed phylogenetic analysis on the full-length protein sequences. The conserved STAS and Sulfate_transp domains were subsequently mapped onto the alignment to verify motif conservation. The phylogenetic analysis revealed distinct clustering patterns among SULPs, indicating conserved and divergent evolutionary trajectories. The grouping of BxSULPs with homologs from closely related nematodes like C. briggsae and C. elegans suggested significant sequence conservation and shared ancestry. For example, BxSULP7 clustered closely with CbrSULP6 and CeSULP6, implying a strong evolutionary relationship, while functional equivalence remains to be experimentally determined. However, notable divergence was observed among SULPs from different nematode species. BxSULP2 exhibited a unique branching pattern, suggesting potential functional or adaptive divergence specific to B. xylophilus, possibly linked to its distinct ecological niche. The phylogenetic tree categorized BxSULP into distinct clades, denoted by different colors. Purple represents the SULP I family, red the SULP II family, and green the SULP III family, highlighting separate evolutionary lineages within the SULP family. SULP4, SULP5, SULP6, SULP8 of B. xylophilus, SULP3 of C. briggsae and SULP8 of B. malayi form a well-supported clade. Similarly, SULP1, SULP9 of B. xylophilus, SULP7 of C. elegans and SULP7 of C. briggsae clustered together in another distinct clade. SULP3, SULP7, SULP10 of B. xylophilus, SULP1, SULP2, SULP4, SULP5, SULP6, SULP8 of C. elegans, SULP2, SULP4, SULP5, SULP6, SULP8 of C. briggsae and SULP6 of B. malayi clustered in a separate branch, supporting the concept of gene duplication and subsequent functional diversification. These clades were also strongly supported by high bootstrap values, affirming their robustness (Figure 1).

Figure 1

In the context of sulfate permeases, the motifs are likely involved in critical functions such as sulfate binding, transmembrane transport, and protein stability (Supplementary Figure S1). Analysis determined the compositions of introns and exons in Bxsulps, revealing that the number of exons ranged from 7 to 16 across the 10 genes. Specifically, BxSULP3, BxSULP8 and BxSULP10 had only 7 exons, while BxSULP5 exhibited the highest number with 14 exons. Examination of structural motifs in the BxSULPs unveiled shared motifs among these proteins, as corroborated by the analysis of conserved motif structures (Supplementary Figure S2). The figure illustrated the conserved motifs identified within BxSULPs, emphasizing regions of sequence similarity across the proteins. These motifs are short, conserved sequences that are likely involved in critical functions such as sulfate binding, transmembrane transport, and protein stability. The clustering of these motifs indicates regions of high conservation, suggesting potential functional roles.

3.4 Chromosomal distribution of Bx-sulps

The chromosomal localization of the 10 Bx-sulps in B. xylophilus was determined using TBtools v2.056, precisely mapping the locations of these channel-encoding genes across various chromosomes (Figure 2). Analysis of chromosomal localization revealed that the genes encoding the 10 SULP proteins were distributed among five chromosomes of B. xylophilus. Specifically, on chromosome 1, Bx-sulp1 was situated in the 3′ region. Bx-sulp2 and Bx-sulp3 were positioned in the middle of chromosome 2. Furthermore, Bx-sulp4 and Bx-sulp5 were identified in the 3′ region of chromosome 3. Within chromosome 5, Bx-sulp6 and Bx-sulp7 were located in the central region, and Bx-sulp8 was found in the 3′ region. Additionally, Bx-sulp9 and Bx-sulp10 were situated in the 5′ region of chromosome 6, with no genes present on chromosome 4. The dispersion of Bx-sulps across multiple chromosomes indicates their non-clustered distribution throughout the genome. This dispersion had implications for gene regulation, as genes located on distinct chromosomes could be governed by diverse regulatory mechanisms and environmental factors.

Figure 2

3.5 Protein structure analysis of BxSULPs

Analysis of the three-dimensional structures of 10 BxSULPs revealed similar proportions of structural elements, including α-helices (32.56%–60.22%), β-folds (6.11%–23.12%), β-turns (0.60%–11.05%), and random coils (28.73%–53.82%). The transmembrane segment of BxSULPs predominantly comprised α-helices, facilitating their integration into the cell membrane to form channel structures for sulfate transport. Despite variations in the number and positioning of transmembrane segments across different proteins, a general conservation of these regions was observed. While BxSULPs exhibited sequence diversity, their three-dimensional structures displayed substantial similarity, indicating the preservation of core functional features essential for sulfate transport (Table 4; Figure 3). The Ramachandran plot was used to assess the three-dimensional structures of 10 proteins. The dihedral angles of BxSULPs residues were found to be located in the yellow favored regions, and the spatial structure was found to be over 90% stable, indicating a high degree of confidence in the tertiary structure. The Ramachandran plot analysis confirms the high stability of the three-dimensional structures of BxSULPs, with the majority of residues falling within the core regions, indicating a high degree of confidence in the predicted protein conformations (Figure 4).

Table 4

Protein IDNumber of N-glycosylation sitesNumber of amino acidsPercentage of number (%)
TSY1α-helix2β-fold3β-turn4Random coil5α-helixβ-foldβ-turnRandom coil
BxSULP1351407822114749.3713.926.9629.75
BxSULP2191721074699541.6317.903.5036.96
BxSULP334131951578347.507.503.5041.50
BxSULP404133902615053.8915.570.6029.94
BxSULP512153674095738.7323.125.2032.95
BxSULP625661092558648.4411.112.2238.22
BxSULP7141801091555260.228.292.7628.73
BxSULP817721123257849.3414.102.2034.36
BxSULP91101125637196032.5621.5111.0534.88
BxSULP10291259816714137.406.112.6753.82

Secondary structure motifs of BxSULPs.

1 T, S, Y: T is Threonine, S is Serine, and Y is Tyrosine, quantity share is the number of amino acids that make up each secondary structure as a percentage of the total number of amino acids.

2 α-helix: The α-helix is a common secondary structure in proteins, formed by the right-handed coiling of a polypeptide chain around a central axis.

3 β-fold: The β-fold is a secondary structure formed by the parallel or antiparallel alignment of polypeptide chains.

4 β-turn: The β-turn is a common type of turn structure, typically composed of four amino acid residues.

5 Random coils: Random coil refers to the parts of a protein that cannot be classified as α-helices, β-fold, or other regular secondary structures.

Figure 3

Figure 4

The topological structure analysis indicated that BxSULP2, BxSULP3, BxSULP4, BxSULP6, BxSULP7, BxSULP8, and BxSULP10 were transmembrane proteins characterized by the presence of transmembrane domains enabling their integration into the cell membrane, primarily facilitating sulfate transmembrane transport. Conversely, BxSULP1, BxSULP5, and BxSULP9 were intra-membrane proteins. Although these proteins lacked transmembrane domains, they can be secreted outside the cell via signaling peptides. These signal peptides were short, hydrophobic regions at the N-terminus of the protein that guided the protein through the endoplasmic reticulum and into the extracellular space. These intra-membrane proteins operate within the extracellular matrix or engage in intercellular signaling upon secretion. Once secreted, these proteins can interact with other molecules in the extracellular matrix or participate in intercellular signaling pathways. Their functions might include binding to extracellular ligands, modulating cell-cell interactions, or influencing the local environment around the cell. Notably, BxSULP1 and BxSULP3 exhibited the highest number of N-glycosylation sites, with 3 sites each, enhancing their stability and functionality in membrane-associated or secreted contexts. This suggested a pivotal role in sulfate transport and interaction with the extracellular environment. The elongated signal peptide of BxSULP7 suggested more precise localization within the cell membrane, thereby enhancing its efficacy in sulfate transport. Despite variations in transmembrane structure, glycosylation patterns, and signal peptides among the BxSULPs, they exhibited a degree of structural similarity. These structural variations suggested functional partitioning. The multi-pass trans-membrane proteins were predicted to form the core sulfate-transport channels. In contrast, the secreted is formed that contain signal peptides might function as extracellular sulfate-binding or sulfate-donating molecules, modulate local sulfur availability or serving as signaling ligands during host invasion and diapause (Figure 5).

Figure 5

3.6 Expression profiles of Bx-sulps in different stages

To analyze gene expression in different developmental stages of B. xylophilus, we employed reverse-transcription quantitative polymerase chain reaction (RT-qPCR). By analyzing gene expression data from B. xylophilus under various nematode states and stress conditions, the expression data of 10 Bx-sulps were obtained. Significant variations in Bx-sulps expression across different nematode states (Figure 6). Specifically, Bx-sulps exhibited low expression levels during egg incubation and fourth instar larva (L4). Only two genes, Bx-sulp3 and Bx-sulp5, were highly expressed in second instar larva (L2). Bx-sulp1, Bx-sulp2 and Bx-sulp3 were highly expressed in third instar larva (L3). Notably, Bx-sulp4, Bx-sulp8, Bx-sulp9, and Bx-sulp10 showed heightened expression in dauer third-instar larva (D3), crucial for maintaining essential physiological functions during diapause and enhancing resistance. The overexpression of Bx-sulps potentially bolstered resistance during diapause, with sulfate likely playing a role in cell membrane stabilization and enhancing cell tolerance to extreme conditions. Moreover, Bx-sulp1, Bx-sulp6 and Bx-sulp7 were prominently expressed in female adult nematodes and male adult nematodes, suggesting involvement in sex differentiation. While L2, L3, and L4 stages exhibited similar sulp genes expression patterns, the transition to adulthood, either male or female, was marked by significant changes in gene expression profiles.

Figure 6

4 Discussion

In recent years, an increasing number of researchers had been investigating the molecular pathways of B. xylophilus by RNA-sequence analysis (). RNA-sequence analysis had primarily been employed to elucidate the pathogenicity, stress resistance, growth, and detoxification mechanisms of B. xylophilus (; ). For instance, Li conducted a comparative transcriptomic analysis to investigate the molecular interactions between the B. xylophilus and β-pinene, a secondary metabolite produced by pine as a defense against nematode infection (). The study revealed that a significant proportion of the differentially expressed genes were associated with cytochrome P450 (CYP), UDP-glucuronide transferase (UDT), and short-chain dehydrogenase (SDR) genes. Similarly, Lu analyzed transcriptome data of B. xylophilus following exposure to emamectin benzoate (). The analysis indicated that genes encoding pectate lyases and β-1,4-endoglucanases were down-regulated, while those related to glutamate-gated chloride channels (GluCls), γ-aminobutyric acid type β receptors (GABAB), and ATP-binding cassette transporters (ABC) were upregulated. These genes played crucial roles in the embryonic and larval development, reproduction, as well as the nervous and motor systems of B. xylophilus, making them potential targets for B. xylophilus control strategies. Further exploration of specific gene families within B. xylophilus will offer a solid theoretical foundation for the development of targeted control measures. This study provides theoretical basis for developing control strategies based on B. xylophilus by studying BxSUIPs.

The sulfate permease (SULP) family, commonly associated with sulfate transporters (SULTR) which is prevalent in plants and certain microorganisms. SULTR played a crucial role in sulfate absorption and transportation, serving as a carrier protein essential for active sulfate transport in plants (). The SULTR protein comprises 12 membrane-spanning domains (TMDs) at the N-terminal, a sulfur_transp domain at the N-terminal, and a STAS domain at the C-terminal region. These domains are directly involved in sulfate binding, transmembrane transport, and the maintenance of SULTR protein activity and stability (). In Heterodera glycines, an SULTR-type sulphate transporter (HgSULTR1;2) was transcriptionally up-regulated 5- to 12-fold within 24 h of root invasion and RNAi-mediated knock-down reduced both cyst formation and egg hatching by >60%, demonstrating that efficient sulphate uptake is essential for parasitic success (). Sulphate limitation triggers a global stress response in nematodes. In Caenorhabditis elegans, sulphate starvation induced dauer formation, implying that precise control of sulphate availability via SULP transporters can modulate developmental decisions and reproduction in B. xylophilus (). In other plant pathogens and symbionts, disruption of sulphate permeases reduced virulence. For example, deletion of the sulphate permease gene cysP in the bacterium Xanthomonas campestris attenuated growth in plant (). These findings suggested that sulp genes were evolutionarily conserved and functionally diversified across taxa.

Cysteine and methionine synthesis depend on a continuous supply of sulfate; any modulation of SULP-mediated transport could directly impact nematode protein metabolism. As a sulfur-containing compound, ergothioneine can significantly prolong the lifespan of C. elegans, improve its mobility and resistance to adverse environments (). The diapause stage is a survival strategy of B. xylophilus to endure unfavorable conditions like low temperatures and drought, allowing it to remain active across seasons and environments, thereby expanding its transmission range (). The high expression of Bx-sulps in the dauer third-instar larva (D3) of B. xylophilus indicated its importance in maintaining essential physiological functions and enhancing resistance during diapause, aligning with the notion that sulfur compounds can enhance nematode resilience to adverse environments. In the D3 stage, sulfate likely aids in stabilizing cell membranes and increasing cell tolerance to extreme conditions (). Moreover, the significant expression of Bx-sulp6 and Bx-sulp7 in female adult nematodes (FM) and male adult nematodes (M) suggested their involvement in sex differentiation, underscoring the potential role of sulfate transport in reproductive processes with implications for nematode population dynamics and pathogenicity. The varying expression patterns in different developmental stages emphasized the significance of elucidating the regulatory mechanisms that control Bx-sulps gene expression, this could facilitate the design of precise interventions to disrupt the nematode’s sulfate transport mechanisms. Future functional studies, including RNA interference (RNAi) and CRISPR-based gene editing, were warranted to dissect the individual contributions of each Bx-sulp genes to nematode development and pathogenicity.

The phylogenetic analysis displayed distinct clustering patterns, indicating that BxSULPs form well-supported clades with homologs from other nematodes, suggesting significant sequence conservation and shared ancestry. This observation implied that these proteins likely preserve essential functional features crucial for sulfate transport (). Conserved motifs were identified across the 10 BxSULPs, associated with key functions such as sulfate binding, transmembrane transport, and protein stability, further supporting their conserved functionality. The chromosomal localization of the 10 Bx-sulps revealed their dispersed distribution across five chromosomes. This dispersion had implications for gene regulation, genes situated on different chromosomes might be subject to diverse regulatory mechanisms and environmental influences (). The non-clustered distribution of Bx-sulps suggested a complex regulatory landscape, possibly involving diverse transcription factors and signaling pathways (). This intricate regulatory network might enable the nematode to finely regulate its sulfate transport mechanisms in response to varying environmental conditions and developmental stages (). The topological analysis indicated that BxSULP2, BxSULP3, BxSULP4, BxSULP6, BxSULP7, BxSULP8, and BxSULP10 were transmembrane proteins primarily facilitating sulfate transmembrane transport. In contrast, BxSULP1, BxSULP5, and BxSULP9 were intra-membrane proteins that might be secreted outside the cell through signaling peptides, localized within the extracellular matrix, or participate in intercellular signaling upon secretion. The hydropathicity analysis indicated that BxSULP5 and BxSULP9 exhibited hydrophilic properties, which can involve in extractable interactions or signaling processes, consistent with the results of topology analysis. The three-dimensional structural analysis of BxSULPs revealed that their transmembrane segments were primarily composed of α-helices. These α-helical structures facilitated protein integration into the cell membrane, crucial for forming functional channel configurations that facilitate efficient sulfate ion transport (). These findings provided a structural foundation for comprehending the function and regulation of BxSULPs.

The identification and comparative analysis of BxSULPs represent a significant advancement in comprehending the adaptive strategies of nematodes and their pathogenic interactions with pine hosts. This research elucidates the roles of the BxSULPs in the development and survival, enhancing the understanding of the molecular mechanisms governing development and stress responses of B. xylophilus. Disrupting the sulfate transport mechanisms of B. xylophilus can potentially impede its ability to thrive within the pine host environment, thereby mitigating its pathogenicity and spread. Furthermore, this study serves as a foundation for future investigations into the gene family of B. xylophilus and gene knockout experiments involving the SULP family.

5 Conclusions

In conclusion, this study represents the first comprehensive identification and characterization of the complete SULP gene family in B. xylophilus. The BxSULPs exhibit highly conserved structural features, indicative of evolutionary stability within nematodes, while minimal structural divergence among them suggests functional consistency and potential synergistic interactions. Expression profiling revealed that Bx-sulp4, Bx-sulp8, Bx-sulp9, and Bx-sulp10 were specifically up-regulated during the dauer (D3) stage, implicating these transporters in diapause maintenance and stress adaptation. Conversely, Bx-sulp1, Bx-sulp6 and Bx-sulp7 showed elevated expression in adult males or females, indicating a putative role in reproductive processes and sexual differentiation. The non-clustered genomic distribution and diverse membrane topologies of BxSULPs further provide a structural foundation for their stage-specific and environmentally modulated regulation. Collectively, these findings position the BxSULPs as promising molecular targets for RNAi-based or small-molecule intervention strategies aimed at disrupting critical biological processes such as diapause and fecundity, thereby offering novel prospects for the control of PWD. However, further investigation is required to elucidate the involvement of BxSULPs in the immune mechanisms of B. xylophilus. This study establishes a foundational framework for future functional analyses of BxSULPs and identifies potential targets for the development of targeted management strategies against B. xylophilus infestations.

Statements

Data availability statement

The raw sequencing data BXSULP1-10 generated from genes analyses in this study have been deposited in the NCBI database (PX242223-32).

Author contributions

HL: Data curation, Validation, Writing – original draft, Software, Formal Analysis. RW: Writing – original draft, Validation, Visualization, Methodology. NP: Writing – original draft, Validation, Visualization. SY: Project administration, Investigation, Funding acquisition, Resources, Writing – review & editing. JC: Visualization, Validation, Supervision, Writing – review & editing, Conceptualization. XH: Conceptualization, Writing – original draft.

Funding

The author(s) declare financial support was received for the research and/or publication of this article. The study supported by Southwest Forestry University Forestry major in Yunnan Province First-Class Construction Discipline (LXXK-2023M06); Yunnan Fundamental Research Projects (202401BD070001-115); Yunnan Provincial Plateau-Characteristic Science and Technology Project in Agriculture (202302AE090017).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2025.1630288/full#supplementary-material

References

Summary

Keywords

Bursaphelenchus xylophilus, sulfate permease family, gene and protein structure, bioinformatic analysis, gene expression

Citation

Li H, Wang R, Pu N, Yang S, Chen J and Hao X (2025) Analysis of the sulfate permease family in Bursaphelenchus xylophilus in the nematode development and stress adaptation. Front. Plant Sci. 16:1630288. doi: 10.3389/fpls.2025.1630288

Received

17 May 2025

Accepted

23 September 2025

Published

13 October 2025

Volume

16 - 2025

Edited by

Claudia Sl Vicente, University of Évora, Portugal

Reviewed by

Laith Khalil Tawfeeq Al-Ani, Universiti Sains Malaysia, Malaysia

Margarida Espada, University of Évora, Portugal

Santisree Parankusam, Sedia Biosceinces, United States

Updates

Copyright

*Correspondence: Xin Hao, ; Jie Chen,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics