In the published article, there was an error in the article title. Instead of “Nanocarrier-mediated RNAi of CYP9E2 and CYB5R enhance susceptibility of invasive tomato pest, Tuta absoluta to cyantraniliprole”, it should be “Nanocarrier-mediated RNAi of CYP9A306 and CYB5R enhances susceptibility of invasive tomato pest, Tuta absoluta to cyantraniliprole”.
In the published article, there was an error. Throughout the manuscript, the gene name “CYP9E2, CYP92, and CYP9E22” are wrong. All these three names should be replaced by the correct name “CYP9A306”. Also, the word “dsCYP9E2/SPc” should be revised as “dsCYP9A306/SPc”.
In the published article, there was an error in Table 1 as published. In Table 1, the gene name “CYP9E2” is wrong. It should be replaced by the correct name “CYP9A306”. Also, the word “dsCYP9E2/SPc” should be revised as “ dsCYP9A306/SPc. The corrected Table 1 and its caption “Table 1. Primer sequences used for RT-qPCR and dsRNA synthesis” appears below.
Table 1
| Primer name | Forward sequence | Reverse sequence |
|---|---|---|
| CYP9A306 | CGAGGTGAAAATCATGGCGT | CAGTGTCCACCCTTCATCCT |
| CYB5R | CGAGAGCGGGAAAATTGAGG | CGACTGTTCTTGGTGACGTC |
| RPL28 | TCAGACGTGCTGAACACACA | GCCAGTCTTGGACAACCATT |
| TaEF1α | GAAGCCTGGTATGGTTGTCGT | GGGTGGGTTGTTCTTTGTG |
| dsEGFP | TAATACGACTCACTATAGGGAAGTTCAGCGTGTCCGGCGAGG | TAATACGACTCACTATAGGGCACCTTGATGCCGTTCTTCTGC |
| dsCYP9A306 | taatacgactcactatagggTCCTTCTTCACGAGTTGGCT | taatacgactcactatagggACGTTGAAGGTGGAGGTGTC |
| dsCYB5R | taatacgactcactatagggTCGTGTAGTGAGCAAATCGC | taatacgactcactatagggTGTCGTCTTCTTTCGCAATG |
Primer sequences used for RT-qPCR and dsRNA synthesis.
In the published article, there was an error in Figure 2 as published. In Figure 2, the gene name “CYP9E2” is wrong. It should be replaced by the correct name “CYP9A306”. The corrected Figure 2 and its caption “Figure 2: Relative expression levels of CYP9A306 and CYB5R genes in cyantraniliprole-resistant (CyanRS) and susceptible (SS) strains of Tuta absoluta. Data presented as mean ± SE of the three independent biological replicates. The asterisks **** show significant differences at P < 0.0001, based on Student’s t-test.” appear below.
Figure 2
In the published article, there was an error in Figure 3 as published. In Figure 3, the gene name “CYP9E2” is wrong. It should be replaced by the correct name “CYP9A306”. The corrected Figure 2 and its caption “Figure 3: Phylogenetic and motif analysis of the CYB5R (a, b) and CYP9A306 (c, d) in lepidopteran insect species.” appear below.
Figure 3
In the published article, there was an error in Figure 4 as published. In Figure 4, the gene name “CYP9E2” is wrong. It should be replaced by the correct name “CYP9A306”. Also, the word “dsCYP9E2/SPc” should be revised as “dsCYP9A306/SPc”. The corrected Figure 4 and its caption “Figure 4: Nanocarrier-mediated RNAi of CYP9A306 and CYB5R genes increase the sensitivity of the cyantraniliprole-resistant strain (CyanRS) of Tuta absoluta against cyantraniliprole. (a) Schematic diagram of nanocarrier-mediated RNA inference. (b) Relative mRNA expression level of CYP9A306 and CYB5R genes in CyanRS and SS populations of Tuta absoluta. Data presented as mean ± SE of the three independent biological replicates. (c) The activity of cytochrome P450 enzyme among CyanRS and SS populations of Tuta absoluta. (d) Mortality rates (%) of cyantraniliprole-resistant strain of Tuta absoluta at 48 h of feeding on dsCYP9A306/SPc, dsCYB5R/SPc, dsEGFP/SPc and DEPC water after exposure to the LC50 of cyantraniliprole. Different lowercase letters represent significant differences at P<0.001 level (one-way analysis of variance (ANOVA) with Tukey’s post hoc test.” appear below.
Figure 4
In the published article, there was an error in Supplementary Table 1. The gene name “CYP9E2” is wrong. It should be replaced by the correct name “CYP9A306”.
The authors apologize for these errors and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Statements
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Summary
Keywords
resistance evolution, RNA interference, biological traits, lepidoptera, gene expression
Citation
Ullah F, G G-P-P, Gul H, Panda RM, Murtaza G, Zhang Z, Huang J, Li X, Desneux N and Lu Y (2025) Corrigendum: Nanocarrier-mediated RNAi of CYP9E2 and CYB5R enhance susceptibility of invasive tomato pest, Tuta absoluta to cyantraniliprole. Front. Plant Sci. 16:1631832. doi: 10.3389/fpls.2025.1631832
Received
20 May 2025
Accepted
27 May 2025
Published
25 June 2025
Volume
16 - 2025
Edited and reviewed by
Hafiz Muhammad Usman Aslam, Colorado State University, United States
Updates
Copyright
© 2025 Ullah, G, Gul, Panda, Murtaza, Zhang, Huang, Li, Desneux and Lu.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yaobin Lu, luybcn@163.com; Xiaowei Li, lixiaowei1005@163.com
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.