ORIGINAL RESEARCH article

Front. Plant Sci., 15 September 2025

Sec. Plant Abiotic Stress

Volume 16 - 2025 | https://doi.org/10.3389/fpls.2025.1666016

Iron Chlorin E6 enhances drought resilience in Camellia oleifera Abel

  • 1. Research Institute of Oil Tea Camellia, Hunan Academy of Forestry, Changsha, China

  • 2. Yuelushan Laboratory, Changsha, China

  • 3. National Engineering Research Center for Oil Tea Camellia, Changsha, China

  • 4. State Key Laboratory of Woody Oil Resources Utilization, Changsha, China

Abstract

This study investigates the effects of Iron Chlorin E6 (ICE6) on the physiological and biochemical responses of Camellia oleifera plants under both normal and drought stress conditions. Varying concentrations of ICE6 (0 µg/L, 20 µg/L, 40 µg/L and 80 µg/L) were applied to C. oleifera plants to assess physiological parameters, including photosynthetic rate, chlorophyll content (SPAD, Soil Plant Analysis Development chlorophyll meter), antioxidant enzyme activity, proline content (Pro), soluble sugars (SS), soluble proteins (SP), abscisic acid (ABA) levels and gene expression. Under well-watered conditions, 80 µg/L ICE6 significantly enhanced net photosynthetic rate (Pn) and SPAD values by 113.73% and 11.57%, respectively, compared to the control, while promoting indole-3-acetic acid (IAA) and soluble protein accumulation. Under drought stress, ICE6-treated plants exhibited improved stress tolerance, with reduced malondialdehyde (MDA) content by 18.32% (20 µg/L), 14.14% (40 µg/L), and 30.84% (80 µg/L) compared to the control, alongside enhanced antioxidant enzyme activities, ABA signaling, and proline accumulation, mitigating oxidative damage. Among the concentrations tested, 80 µg/L ICE6 delivered the greatest overall benefit by achieving the highest net photosynthetic rate (113.73%) and SPAD value (11.57%) under well-watered conditions, and the lowest MDA accumulation (30.84%) under drought, thus identifying it as the optimal dose in this study. This study provides a theoretical foundation for the use of ICE6 as a multifunctional plant growth regulator in C. oleifera and offers innovative strategies to enhance drought resistance in this economically significant crop.

1 Introduction

Camellia oleifera Abel., a small evergreen tree belonging to the Theaceae family and Camellia genus, is one of the four major woody oil crops worldwide, alongside olive, oil palm, and coconut trees (Gao et al., 2024). The primary product of C. oleifera, camellia oil, is renowned for its rich nutritional profile including bioactive compounds such as squalene, phytosterol, polyphenols and fat-soluble vitamins (Vitamins A, B, E), often earning it the title of “olive oil of the East” (Shi et al., 2020). However, due to the ongoing effects of global warming, drought stress has emerged as one of the most significant abiotic challenges faced by C. oleifera. Drought not only affects the growth and development of C. oleifera but also represents a major limiting factor for yield production (He et al., 2020; Shen et al., 2024).

Under drought stress, plants typically experience a decline in photosynthetic efficiency due to stomatal closure, reduced chlorophyll content, and impaired electron transport in photosystems (Karami et al., 2025). Water deficit also leads to excessive accumulation of reactive oxygen species (ROS), which can damage cellular membranes, proteins, and nucleic acids (Gorni et al., 2025). To mitigate oxidative damage, plants activate their antioxidant defense systems, including enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) (Khan et al., 2025). Meanwhile, osmotic adjustment substances like proline (Pro) and soluble sugars accumulate to maintain cellular osmotic balance and protect macromolecules (Sun et al., 2025). Drought stress also disrupts hormone homeostasis, commonly elevating abscisic acid (ABA) levels to regulate stomatal closure and stress signaling, while often altering auxin (IAA) distribution, which can inhibit normal growth and development (Basso et al., 2025; Ndombi et al., 2025). Lipid peroxidation, reflected by increased malondialdehyde (MDA) content, is another typical marker of drought-induced oxidative stress (Krishankumar et al., 2025; Ying et al., 2025).

In recent years, numerous studies have investigated strategies to improve the growth and drought tolerance of C. oleifera, with a particular focus on using exogenous plant regulators to enhance drought resistance. Prior research has shown that pre-harvest ethylene treatments can promote the accumulation of linoleic acid (LA) and α-linolenic acid (ALA) in C. oleifera fruit, with a 1.5gL−1 treatment increasing LA and ALA content by 18.0% and 19.1%, respectively, compared with the control (Li et al., 2023). Hydrogen cyanamide (0.5%) has also been found to significantly extend the flowering period of C. oleifera (by approximately 12 days) (Lin et al., 2022). Additionally, exogenous calcium (Zhang et al., 2023) and abscisic acid (ABA) (Yang et al., 2024) have been shown to boost photosynthesis, enhance antioxidant enzyme activities and osmotic regulation in C. oleifera seedlings under drought, thus enhancing drought resistance. The application of plant growth regulators, which chemically influence the growth and development of crops, has become an essential practice in modern agriculture.

Iron Chlorin E6 (ICE6), also known as iron dihydroporphyrin, is a novel natural plant growth regulator that can delay chlorophyll degradation by inhibiting chlorophyllase, thereby increasing chlorophyll content (Chen, 2018). Previous research has demonstrated that ICE6 not only promotes plant growth but also acts as a novel plant immunity inducer, significantly enhancing resistance to waterlogging, salt, and drought stresses in plants (Cao et al., 2016; Chen et al., 2023; Li et al., 2024). Furthermore, recent studies have shown that seed soaking in ICE6 at 100 – 200mgL−1 for 24 – 48h can enhance rice seed vigor and increase germination rate (Xie et al., 2022). These findings highlight the broad potential applications of ICE6 as a multifunctional plant regulator.

Despite its promising capabilities, no studies have explored the application of ICE6 in C. oleifera. Therefore, this research aims to investigate the physiological and biochemical responses of C. oleifera plants to foliar application of ICE6 under both normal and drought conditions. By measuring various physiological and biochemical parameters, including photosynthesis, chlorophyll content, antioxidant enzyme activity, and gene expression, this study will systematically analyze the regulatory role of ICE6 in C. oleifera saplings. Ultimately, this work seeks to address the current gap in understanding the potential application of ICE6 to enhance drought resistance in C. oleifera, offering new insights into its broader agricultural potential.

2 Materials and methods

2.1 Materials

Uniform, healthy, three-year-old potted plants of C. oleifera ‘Xianglin 210’ were supplied by the National Engineering Research Center for Oil-tea Camellia (Changsha, China). The seedlings were cultivated in plastic pots (top diameter: 24 cm; height: 20 cm) filled with a homogenized substrate of lateritic red soil (collected from Changsha, Hunan; 112°58′ E, 28°12′ N) and peat soil (Pindstrup Mosebrug A/S, Ryomgaard, Denmark) at a 3:1 (v/v) ratio. At the beginning of the experiment, seedlings had an average height of 75.9 cm and a basal stem diameter of 7.9 mm. The experiment was conducted in the Center’s greenhouse (113°01′ E, 28°06′ N), where daytime and nighttime temperatures were maintained at 30°C and 25°C, respectively, with a relative humidity of 80–85%. Water-soluble iron dihydroporphyrin powder was purchased from Anqing baite Biology Engineering Co., Ltd. (Anqing, China), dissolved to prepare solutions of 20, 40, and 80 µg/L, and applied as foliar sprays. Plants were sprayed with a handheld atomizer until leaf surfaces were uniformly wetted to the point of slight runoff, ensuring consistent coverage across treatments. Treatments commenced on day 1 of the experiment and were repeated at 15-day intervals for a total of three applications. SPAD values were measured on intact leaves using a SPAD-502 Chlorophyll Meter (Konica Minolta, Osaka, Japan), which estimates relative chlorophyll content based on leaf transmittance at 650 nm and 940 nm.

2.2 The role of ICE6 in the physiological and biochemical responses of C. oleifera plants under normal conditions

To investigate the physiological and biochemical responses of C. oleifera saplings under normal conditions following ICE6 treatment, four treatment groups with different ICE6 concentrations were established: 0 µg/L (T0, control), 20 µg/L (T1), 40 µg/L (T2), and 80 µg/L (T3). Throughout the normal condition experiment, all plants were maintained under normal growth conditions with adequate watering to avoid any water stress. ICE6 treatments were applied on days 1, 15, and 30 (Figure 1). Each treatment was performed with three biological replicates, and each replicate consisted of five uniformly sized plants. On day 31, photosynthetic parameters (n = 15) and SPAD values (n = 15) were measured on the fully expanded middle leaves of each plant between 9:00 and 11:00 in the morning. Subsequently, the same leaves were randomly collected, immediately frozen in liquid nitrogen, and transported back to the laboratory for further analysis. The indices measured included soluble protein (SP) content, soluble sugar (SS) content, indole-3-acetic acid (IAA) content, malondialdehyde (MDA) content, and proline (Pro) content (n = 3).

Figure 1

2.3 The role of ICE6 in the physiological and biochemical responses of C. oleifera plants under drought stress

Building upon the experiment described in Section 2.2, a drought stress treatment was further applied to the potted plants (Figure 1). The soil water content was measured using a ProCheck handheld multifunction reader/data logger. Drought stress was induced by withholding water on day 31, allowing the soil to dry naturally. Sampling was performed on the seventh day (On day 38), when the relative soil water content had decreased to approximately 30%. Once the target soil moisture level was reached, photosynthetic parameters (n = 15) and SPAD values (n = 15) were measured on the fully expanded leaves in the middle each plant between 9:00 and 11:00 in the morning. Same leaves were then collected, immediately frozen in liquid nitrogen, and transported back to the laboratory for subsequent physiological and biochemical analyses. The indices measured included superoxide dismutase (SOD) activity, peroxidase (POD) activity, catalase (CAT) activity, malondialdehyde (MDA) content, proline (Pro) content, soluble sugar (SS) content, abscisic acid (ABA) content, and soluble protein (SP) content (n = 3).

2.4 Measurement of photosynthetic parameters

Photosynthetic parameters, including net photosynthetic rate (Pn), intercellular CO2 concentration (Ci), stomatal conductance (Gs), and transpiration rate (Tr), were measured using a 6400XT Portable Photosynthesis System (LI-COR, Lincoln, NE, USA) on functional leaves of randomly selected C. oleifera saplings. The system was configured with an airflow rate of 500µmol/s, a photosynthetically active radiation (PAR) intensity of 1000µmol/m2/s, a CO2 concentration of 400 µmol/mol. Water use efficiency (WUE) was calculated as the ratio of Pn to Tr, to assess the efficiency of water utilization under specific conditions.

2.5 Measurement of physiological and biochemical indices

The activities of peroxidase (POD), superoxide dismutase (SOD) and catalase (CAT), together with the contents of malondialdehyde (MDA), proline (Pro), soluble sugars(SS) and soluble proteins (SP), were determined using commercial 96-well microplate assay kits (Quanzhou Ruixin Biotechnology Co., Ltd., Quanzhou, China). The following kits were used: Superoxide Dismutase (SOD) Activity Assay Kit (WST-8 method; Cat. No. G0101W), Peroxidase (POD) Activity Assay Kit (Cat. No. G0107W), Catalase (CAT) Activity Assay Kit (Cat. No. G0105W), Malondialdehyde (MDA) Content Assay Kit (Cat. No. G0109W), Proline (Pro) Content Assay Kit (Cat. No. G0111W), Soluble Sugar Content Assay Kit (Cat. No. G0501W) and Soluble Protein Content Assay Kit (Coomassie Brilliant Blue method; Cat. No. G0417W).

2.6 Quantification of IAA and ABA

Endogenous indole-3-acetic acid (IAA) and abscisic acid (ABA) were quantified by ultra-performance liquid chromatography–tandem mass spectrometry (UPLC–MS/MS). For each treatment, three biological replicates were prepared. Leaves from five uniformly sized plants were pooled per replicate. Each pooled sample was ground in liquid nitrogen, thoroughly mix, and accurately weigh approximately 0.3 g (to 0.0001 g) into a 15 mL centrifuge tube. Add 5 mL of extraction solution (isopropanol:water:formic acid, 80:19:1, v/v/v), homogenize for 2 min, and perform ultrasonic extraction at 4°C for 1 h. Centrifuge the extract at 10,000 rpm for 10 min to obtain the supernatant. Subsequently, add 1 mL of dichloromethane, perform low-temperature ultrasonic extraction for 30 min, and centrifuge at 10,000 rpm for 10 min to collect the supernatant. Repeat the ultrasonic extraction once more, and combine the three supernatants. Evaporate the combined supernatant under reduced pressure with nitrogen at room temperature to the aqueous phase, adjust the volume to 2 mL, vortex to mix, dilute 2-fold with methanol, and filter through a 0.22 µm membrane for analysis. All operations are conducted on wet ice and protected from light.

Chromatographic separation was performed on a Waters FTN UPLC system equipped with a BEH C18 column (2.1 × 50 mm, 1.7 µm). The column temperature was maintained at 40°C and the autosampler at 10°C. The mobile phase consisted of 0.1% formic acid in water (A) and acetonitrile (B), delivered at 0.3 mLmin−1 using the following gradient: 0.0 min, 80/20 (A/B); 1.5 min, 65/35; 3.0 min, 10/90; 4.5 min, 10/90; 4.7 min, 65/35; and 5.0 min, 80/20. The total runtime was 5 min, followed by a 5 min post time at the initial conditions (80/20) for column re-equilibration. Injection volume was 10 µL.

Mass spectrometric analysis was performed on an AB SCIEX 4000 triple quadrupole mass spectrometer equipped with an electrospray ionization (ESI) source operated in both positive and negative modes (ESI±). The MS/MS parameters were set as follows: curtain gas (CUR) 35 psi; collision gas (CAD) 7 psi; IonSpray voltage +5500 V in positive mode and –4500 V in negative mode; source temperature 450°C; ion source gas 1 (GS1) 40 psi; and ion source gas 2 (GS2) 50 psi.

The original chromatograms, calibration curves, and quantification data of IAA and ABA from UPLC–MS/MS analyses are included in the supplementary file (Supplementary Data S1).

2.7 Real-time quantitative PCR analysis

Total RNA was extracted from C. oleifera leaves (n = 3) using the RNAprep Pure Plant Plus Kit (TIANGEN, Beijing, China). First-strand cDNA was synthesized using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, Nanjing, China), followed by five-fold dilution of the cDNA for quantitative real-time PCR (RT-qPCR) analysis. The ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) was used for the RT-qPCR assays. Primers for the RT-qPCR were designed using Primer Premier 5 software (Premier Biosoft, Palo Alto, CA, USA), and the sequences of the primers are shown in Table 1. The 2{sp}−ΔΔ{it}Ct {/sp}{/it}method was used to calculate the relative expression levels of the genes. Tubulin was used as the reference gene, as it has been validated as a stable housekeeping gene in C. oleifera (Zhang et al., 2025). Descriptions of gene functions are provided in the supplementary file (Supplementary Data S2).

Table 1

GeneForward primer (5’-3’)Reverse primer (5’-3’)
TubulinTGTGGAGGACGAAGAAGATGGTCAAGACAGAGAATGGCAATACC
RbcLTGGCATCCAAGTTGAAAGAGACGCATAAATGGTTGGGAGT
RbcSCCAGGATACTACGATGGGAGGCTTGTGGGCGATGAAACTGA
IAA9TTCTCTGATGCTATGGATGGATTCGATTTGGACCGTTCTCATTTGC
TCP4GTCCTCTGCTTCCTCTGATTCGGATTTCTTCTTCCCACGGTAACG
PP2C16CTACGGTGGCAGTGAATAGTGCTTCCATCTCTGACCTCTTTCC
PP2C24TCTGATACTGGCGAGCGATGCCACCACAACCACACTTACG
PP2C51AGAAGCCTGATAGAGAAGATGAACATCCTCGTCACTCCTTGTCG
SnRK2.8TTCGGCTACTCAAAGTCATCAGCACCAACCAACATCACATATAAGG

Gene primer sequences used for the quantitative real-time PCR analysis.

*The abbreviations and corresponding full names are as follows: Tubulin, Tubulin alpha-3 chain; RbcL, Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit; RbcS, Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit; IAA9, Auxin/indole-3-acetic acid 9; TCP4, TCP family transcription factor 4; PP2C16, Protein Phosphatase 2C 16; PP2C24, Protein Phosphatase 2C 24; PP2C51, Protein Phosphatase 2C 51; SNRK2.8, Sucrose Non-Fermenting 1(SNF1)-Related Protein Kinase 2.8.

2.8 Statistical analysis

To investigate the relationships among physiological and biochemical traits under drought stress, we performed correlation analysis, principal component analysis (PCA), hierarchical clustering, and heatmap visualization. Pearson correlation coefficients were calculated based on trait values, and the correlation matrix was visualized using the corrplot package in R. Heatmaps of treatment means (standardized as Z-scores) were generated with the pheatmap package to illustrate clustering patterns of treatments and traits. PCA was conducted to examine the contribution of traits to the principal components. In addition, traits were clustered using the unweighted pair-group method with arithmetic mean (UPGMA), based on a distance matrix derived from Pearson’s correlation (1 – r), to identify groups of traits with similar response patterns.

Statistical analyses were conducted using IBM SPSS Statistics 27 (IBM Corporation, Armonk, NY, USA). For physiological and biochemical indices, including SPAD value, photosynthetic rate, antioxidant enzyme activities (SOD, POD,CAT), MDA content, Proline, soluble protein, soluble sugars, and hormone levels (ABA, IAA), means and standard deviations were calculated for descriptive statistics. All data were first subjected to two-way analysis of variance (ANOVA), followed by Duncan’s new multiple range test at a significance level of P < 0.05. In each column, means sharing the same letter (a, b, c, d) are not significantly different (P ≥0.05), whereas means with different letters differ significantly (P < 0.05).

3 Results

3.1 The role of ICE6 in regulating photosynthesis in C. oleifera seedlings

As illustrated in Figure 2A, the SPAD values of C. oleifera seedlings significantly decreased under drought conditions compared to normal conditions (T0). Furthermore, the SPAD values of ICE6-treated Camellia oleifera seedlings (T1, T2, T3) were higher than those of the control group (T0) under both normal and drought conditions. Under normal conditions, the SPAD values of ICE6-treated seedlings increased significantly compared to the control, with rises of 7.99% for T1 (20 µg/L), 11.36% for T2 (40 µg/L), and 11.57% for T3 (80 µg/L), corresponding to increasing ICE6 concentrations. Under drought stress, compared to T0, the SPAD values in the ICE6-treated groups remained relatively high, with T2 showing the most notable increase.

Figure 2

Under normal conditions, the Pn of the ICE-treated groups was significantly higher than that of the control group (T0), and Pn increased with higher ICE treatment concentrations. The highest rate was observed in the T3 group, showing a 113.73% increase compared to T0. The patterns of Gs (Figure 2C) and Tr (Figure 2E) under normal condition were consistent with the Pn. Moreover, the Ci in ICE-treated groups was higher than in T0, with similar Ci values across the different ICE concentrations. Interestingly, WUE was significantly lower in the ICE-treated groups compared to the control group T0 (Figure 2F). These observations suggest that treating C. oleifera saplings with ICE can significantly enhance their photosynthetic rates.

Under drought stress, the Pn in the T1 and T3 groups was significantly higher than that of the control group (T0), while T2 showed no significant difference compared to the control (Figure 2B). Gs and Tr in ICE-treated groups were also significantly higher than in T0, with the lowest Gs and Tr values observed in T2. (Figures 2C, E). The Ci among ICE-treated groups showed complex variations: Ci in T2 was significantly higher than in T0, while T1 had significantly lower values compared to T0, and T3 exhibited no significant difference from the control (Figure 2D). Furthermore, WUE in T1 was significantly higher than in T0, whereas T2 and T3 showed no significant differences from the control (Figure 2F). These results suggest that different ICE concentrations elicit varied photosynthetic responses under drought stress. Specifically, T1 was able to sustain higher photosynthetic activity during drought, whereas T2 and T3 appeared to actively downregulate its photosynthetic activity.

3.2 The role of ICE6 in regulating hormone responses in C. oleifera seedlings

Under normal conditions, the IAA content in the ICE-treated groups was higher than that of T0. However, it gradually decreased as the ICE concentration increased (Figure 3). Under drought stress, ABA content in ICE-treated groups was significantly lower than in T0, with T2 exhibiting the highest ABA levels among all treatments, followed by T1 and T3 (Figure 3).

Figure 3

3.3 The role of ICE6 in regulating the antioxidant system in C. oleifera seedlings

Antioxidant enzymes such as SOD, POD, and CAT play crucial roles in maintaining redox balance. They effectively eliminate excess reactive oxygen species (ROS), such as superoxide anions and hydrogen peroxide, which are frequently induced by drought stress (Laxa et al., 2019). These ROS attack unsaturated fatty acids in the cell membranes, triggering lipid peroxidation processes, with malondialdehyde (MDA) being a direct byproduct (Das and Roychoudhury, 2014; Huang et al., 2024). Consequently, an increase in MDA levels typically reflects the level of oxidative stress induced by ROS within the cells (Hasanuzzaman et al., 2020).

Under drought stress, SOD activity in ICE-treated groups was significantly higher than that in T0, with the highest activity observed in T2, followed by T1 and T3 (Figure 4A). Although the POD (Figure 4B) and CAT (Figure 4C) activities in ICE-treated C. oleifera seedlings were lower than those in the control group (T0) under drought stress, these activities were overall elevated compared to their respective levels under normal conditions. Furthermore, MDA levels in all ICE-treated groups were significantly lower than in T0, with reductions of 18.32% for T1 (20 µg/L), 14.14% for T2 (40 µg/L), and 30.84% for T3 (80 µg/L), indicating enhanced drought tolerance in C. oleifera saplings treated with ICE (Figure 4D). These results suggest that ICE treatment can effectively activate the antioxidant system in C. oleifera seedlings under drought stress. In particular, the T3 treatment showed the lowest MDA level under drought conditions, with no significant difference compared to its respective level under normal conditions.

Figure 4

3.4 The role of ICE6 in controlling osmotic regulatory substances in C. oleifera seedlings

Under normal conditions, both proline (Figure 5A) and soluble sugar levels (Figure 5B) in ICE-treated seedlings were not significantly different from those in the control group (T0). However, under drought stress, the proline and soluble sugar levels in C. oleifera seedlings were higher than their respective levels under normal conditions.

Figure 5

Regarding soluble protein (SP) content, under normal conditions, ICE-treated groups exhibited higher SP levels than T0, with the highest content observed in the T2 group, followed by T3 and T1 (Figure 5C). Under drought stress, SP content in ICE-treated groups was significantly higher than in T0, indicating that ICE promotes protein accumulation.

3.5 RT-qPCR analysis

To investigate how ICE6 influences gene expression in C. oleifera saplings, we focused on eight key genes previously identified in our transcriptomic analyses (He et al., 2022). These genes, which show significant differential expression under drought stress, are crucial for understanding hormonal signaling pathways, particularly those involving auxin and ABA.

Under normal conditions, the expression levels of RbcL in T2 and T3 were significantly higher than the control, while T1 showed slightly lower levels. Meanwhile, RbcS expression in T1 and T2 were significantly higher than in the control, whereas T3 was significantly lower (Figure 6). Under drought stress, RbcL expression in T1 and T2 did not significantly differ from the control, while T3 was significantly higher. RbcS expression in T2 and T3 were significantly higher than in the control, with no significant difference observed in T1.

Figure 6

Under normal conditions, IAA9, a negative regulator of auxin, exhibited significantly lower expression levels in T2 and T3 compared to the control, while T1 showed no significant difference. However, under drought stress, the highest expression levels of IAA9 were observed in T2, followed by T1, with T3 showing no significant difference from the control. These results suggest that, under normal conditions, ICE6 treatment in T2 and T3 may activate downstream genes in auxin pathways by inhibiting the negative regulator IAA9. Conversely, under drought stress, ICE6 treatment appears to upregulate IAA9 expression in T1 and T2, which could lead to the suppression of auxin pathway activities. Additionally, expression levels of TCP4 were significantly reduced across all ICE6-treated groups under normal conditions. During drought stress, TCP4 expression in T1 was significantly higher than in the control, while T2 showed no significant difference, and T3 was significantly lower. The varied expression of TCP4 suggests that drought tolerance mechanisms differ across the different ICE6 concentrations.

Under drought stress, the expression levels of PP2C16, PP2C24, PP2C51, and SnRK2.8 in T1 were higher than in the control, indicating enhanced ABA signaling. In T3, expression levels of PP2C24, PP2C51, and SnRK2.8 were also significantly higher than in the control. However, in T2, the expression of these genes showed no significant differences compared to the control.

3.6 Principal component analysis and trait correlations

Principal component analysis (PCA) revealed that the first two principal components (PC1 and PC2) explained 54.98% and 16.95% of the total variance, respectively, accounting for a cumulative variance of 71.93% (Figure 7A). The enzymatic antioxidant traits such as POD and CAT were strongly associated with the negative axis of PC1, whereas SOD was mainly associated with PC2. Lipid peroxidation marker MDA, osmolyte Pro and SS showed moderate contributions to both PC1 and PC2. Photosynthetic traits such as SPAD, Pn, Gs, and Tr were positioned opposite to POD and CAT vectors, indicating negative associations with these enzymatic antioxidant traits along PC1. This pattern was further supported by the Pearson correlation heatmap (Figure 7B), in which POD and CAT were positively correlated with each other but negatively correlated with SPAD, Pn, Gs, and Tr. Photosynthetic traits showed strong positive intercorrelations, while MDA and Pro exhibited moderate positive correlations with POD and CAT and negative correlations with most photosynthetic parameter.

Figure 7

3.7 Cluster analysis of physiological and biochemical traits

The UPGMA dendrogram grouped the physiological and biochemical traits into two major clusters (Figure 8A). Photosynthetic-related parameters (SPAD, Pn, Gs, Tr) were closely associated, while oxidative stress and antioxidant indicators (MDA, SOD, POD, CAT, Pro, etc.) formed another cluster. This classification highlights the coordinated responses of photosynthetic traits and stress-related traits under drought conditions. Consistently, the heatmap of standardized traits revealed distinct patterns among treatments (Figure 8B). Under well-watered conditions, T3 exhibited the most favorable profile, with the highest SPAD, Pn, Gs, and Tr, indicating optimal photosynthetic performance under non-stress conditions. Under drought stress, T3 also showed the lowest MDA while largely maintaining photosynthetic traits, suggesting effective mitigation of oxidative damage. Overall, T3 demonstrated superior performance under both normal and drought stress conditions.

Figure 8

4 Discussion

In this study, exogenous application of ICE6 significantly influenced the photosynthesis and physiological characteristics of C. oleifera saplings. The results indicated that, under normal conditions, the photosynthetic rate, SPAD value, and soluble protein content in ICE6-treated C. oleifera plants were significantly higher compared to the control (T0). These results may be related to ICE6’s ability to promote chlorophyll synthesis and inhibit its degradation, thereby enhancing the photosynthetic capacity of C. oleifera saplings (Xing et al., 2020). In this study, the T3 (80 µg/L) treatment group exhibited performance distinctly different from T1 (20 µg/L) and T2 (40 µg/L) under normal conditions, as demonstrated by its significantly higher net photosynthesis rates compared to T1 (20 µg/L) and T2 (40 µg/L) (Figure 2B). This suggests that T3 (80 µg/L) may enhance photosynthesis through mechanisms other than stomatal opening, even though there was no significant change in the Ci. This enhancement is likely related to the optimization of light capture and conversion in T3 (80 µg/L), such as increased activity of the Rubisco enzyme, improvements in chloroplast structure, and enhanced functionality of the photosynthetic electron transport chain, thereby enhancing the efficiency of CO2 utilization in photosynthesis (Qiao et al., 2024; Croce et al., 2024). In addition, the WUE of ICE6-treated groups was significantly lower than that of the control, suggesting that ICE6-treated saplings may prioritize enhancing photosynthesis over maintaining WUE under normal conditions. Furthermore, the IAA content in ICE6-treated saplings was higher, while soluble sugar content was lower compared to the control, which may have directly facilitated seedling growth. As IAA9 is a known negative regulator of auxin, its reduced expression leads to increased auxin activity, promoting cell elongation and division (Wang et al., 2005). In this study, the expression of IAA9 (Figure 6) were generally lower in ICE6-treated saplings than in the control under normal conditions, particularly in T2 (40 µg/L) and T3 (80 µg/L), further confirming enhanced auxin activity.

Previous studies in olive and pear tree have indicated that under drought stress, a reduction in RuBisCO activity and chlorophyll content often leads to a significant decrease in photosynthetic rate (Hao et al., 2023; Boussadia et al., 2023). In this study, ICE6-treated C. oleifera plants maintained relatively high SPAD values and photosynthetic activity under drought conditions, suggesting that ICE6 can mitigate the adverse effects of drought to some extent. Notably, the T2 (40 µg/L) group had the highest SPAD values, and RbcS expression levels were also higher than in the control under drought stress. However, the photosynthetic rate showed no significant difference from the control. This implies that the T2 (40 µg/L) group may have actively reduced its photosynthetic rate to prioritize survival over growth. Furthermore, IAA9 expression levels in T2 (40 µg/L) were significantly higher than those in the control, suggesting that T2 (40 µg/L) plants adopted a strategy of limiting growth activity to ensure survival under drought conditions. This may also be linked to the elevated ABA content observed in the T2 (40 µg/L) group. As a key hormone involved in drought stress response, ABA mediates stomatal closure, which may further decrease the photosynthetic rate (Lim et al., 2015; Li et al., 2022).

Moreover, although ABA content in T1 and T3 groups was significantly lower than in the control group under drought stress, expression levels of PP2C24, PP2C51, and SnRK2.8 were significantly higher. PP2C protein phosphatases and SnRK2.8 are key components of the ABA signaling pathway (Nakashima and Yamaguchi-Shinozaki, 2013; Ma et al., 2009; Soon et al., 2012). The high expression of these genes suggests that C. oleifera saplings in T1 (20 µg/L) and T3 (80 µg/L) may still utilize the ABA signaling pathway to regulate stress responses and enhance drought tolerance. In contrast, while T2 (40 µg/L) had higher ABA content, expression levels of PP2C24, PP2C51, and SnRK2.8 were not significantly different from the control, indicating that T2 (40 µg/L) might not primarily rely on the ABA signaling pathway for its drought response. Instead, T2 (40 µg/L) showed higher SOD and POD enzyme activities that are crucial for scavenging excess ROS produced under drought stress. In this study, due to its higher antioxidant enzyme activities, the MDA content in T2 (40 µg/L) was significantly lower than that in the control group, indicating its effectiveness in mitigating lipid peroxidation and protecting cells from oxidative stress caused by drought.

Previous studies have suggested that under drought stress, plants typically increase proline and soluble sugar content to regulate osmotic pressure, mitigate water loss, and reduce oxidative damage (Dien et al., 2019; Ozturk et al., 2021). In this study, although there were no significant differences in soluble sugar content among the groups under drought conditions, the soluble sugar content increased compared to normal growth conditions (Figure 5B). Similarly, the proline content in the drought-treated groups was higher than under normal growth conditions (Figure 5A). The changes in soluble sugar and proline content observed in this study are generally consistent with classical drought response findings (Khedr et al., 2003). Interestingly, the T2 group exhibited the lowest proline content among all treatments under normal conditions. However, under drought stress, the proline content in the T2 (40 µg/L) was highest. This suggests that the T2 (40 µg/L) group may rely more on proline to enhance osmotic adjustment, thereby improving its adaptation to drought conditions (Furlan et al., 2020).

Furthermore, under drought stress, the expression levels of TCP4 provided insights into the differential drought tolerance of plants treated with varying ICE6 concentrations. TCP4 is a positive regulator of plant response to water stress, and higher TCP4 expression is known to enhance plant tolerance (Wang et al., 2022). Therefore, the elevated TCP4 levels in T1 (20 µg/L) suggest stronger drought tolerance in this group (Figure 6). In contrast, although TCP4 expression in T3 (80 µg/L) was significantly lower than in the control, the photosynthetic parameters and key physiological indicators such as MDA remained relatively stable conditions. This stability may be attributed to the enhanced drought adaptability in T3 (80 µg/L) mediated through the ABA signaling pathway.

In previous studies, ICE6 has been mainly applied as a plant growth regulator under non-stress conditions, where it promoted the growth of crops such as ginger (Shengqi et al., 2024), tobacco (Xing et al., 2020), and rice (Xie et al., 2022). In this study, we demonstrate that ICE6 also enhances drought tolerance in C. oleifera, as evidenced by enhanced antioxidant enzyme activities, reduced MDA levels, and the maintenance of relatively stable photosynthetic performance. This is consistent with previous ICE6 studies on soybean (Cao CunFeng et al., 2018) and rapeseed plants (Cao et al., 2016) under salt stress conditions. This opens up promising avenues for utilizing ICE6 to improve agricultural productivity and sustainability, potentially reducing the need for water and chemical inputs in stressed environments. However, due to the limitations of pot experiments, these findings need further validation through extensive long-term field trials. Additionally, it is crucial to further explore the molecular mechanisms of ICE6, particularly its interactions with other plant hormones and its efficacy under multiple stress conditions. Such studies will help fully elucidate the potential of ICE6 and provide a scientific basis for the breeding of C. oleifera varieties with enhanced stress resistance.

5 Conclusions

This study preliminarily explored the influence of exogenous ICE6 on the physiological and biochemical responses of C. oleifera seedlings under normal and drought conditions. The results indicate that ICE6 significantly enhances the photosynthetic rate, SPAD value, and soluble protein content of the seedlings, thereby potentially promoting their growth. Additionally, ICE6 treatment enhanced the drought tolerance of C. oleifera seedlings, as evidenced by higher antioxidant enzyme activities, lower malondialdehyde (MDA) content, and stable photosynthetic parameters. These responses are likely related to mechanisms such as promoting chlorophyll synthesis, regulating the ABA signaling pathway, and increasing proline and protein accumulation. Overall, ICE6 at 80 µg/L was optimal, increasing net photosynthetic rate by 113.7% and SPAD by 11.6% under normal irrigation, while reducing MDA by 30.8% during drought stress, demonstrating its efficacy as a plant growth regulator for enhancing both growth and stress tolerance.

Statements

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Author contributions

DY: Conceptualization, Formal Analysis, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. ZL: Conceptualization, Formal Analysis, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. YH: Investigation, Resources, Software, Writing – review & editing. XM: Investigation, Software, Writing – review & editing. JS: Investigation, Writing – review & editing. CX: Data curation, Writing – review & editing. ZZ: Data curation, Writing – review & editing. RW: Project administration, Resources, Supervision, Writing – review & editing. YC: Project administration, Resources, Supervision, Writing – review & editing. ZH: Conceptualization, Formal Analysis, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing.

Funding

The author(s) declare financial support was received for the research and/or publication of this article. This research was funded by Top Ten Technological Research Projects in Hunan Province (2024NK1020) and R&D Plan for Key Areas in Hunan Province (2023NK2005).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2025.1666016/full#supplementary-material

References

  • 1

    BassoM. F.IovienoP.CapuanaM.ContaldiF.IeriF.MenicucciF.et al. (2025). Identification and expression of the areb/abf/abi5 subfamily genes in chickpea and lentil reveal major players involved in aba-mediated defense response to drought stress. Planta262, 22. doi: 10.1007/s00425-025-04740-y

  • 2

    BoussadiaO.OmriA.MzidN. (2023). Eco-physiological behavior of five Tunisian olive tree cultivars under drought stress. Agronomy13, 720. doi: 10.3390/agronomy13030720

  • 3

    CaoC.-F.YuB.-J.ZhaoX.-F.WeiP.-P.SongJ.-M.ChenL.-M.et al. (2016). Ameliorative effects of foliar 2,3-dihydroporphyrin iron (iii) spray on seedling growth and seed traits of salt-stressed rapeseed plants. Agron. J.108, 14551462. doi: 10.2134/agronj2015.0600

  • 4

    Cao CunFengC. C.Li XiaoJiangL. X.Yu LeRuiY. L.Shi XiaoKeS. X.Chen LiMingC. L.Yu BingJunY. B. (2018). Foliar 2, 3-dihydroporphyrin iron (iii) spray confers ameliorative antioxidation, ion redistribution and seed traits of salt-stressed soybean plants. J. Soil Sci. Plant Nutr. 18, 10481064. doi: 10.4067/S0718-95162018005003001

  • 5

    ChenJ.LiuR.ZhangG.LiJ.YangC.WangF.et al. (2023). Effects of iron chlorin e6 on photosynthetic characteristics of peanut leaves under drought stress and after rewatering at floweringpegging stage. J. Peanut. Sci.52, 5262. doi: 10.14001/j.issn.1002-4093.2023.01.007

  • 6

    ChenL. (2018). Plant growth regulator iron chlorine e6. Pesticide. Sci. Admin.39, 67–68. doi: 10.3969/j.issn.1002-5480.2018.03.018

  • 7

    CroceR.Carmo-SilvaE.ChoY. B.ErmakovaM.HarbinsonJ.LawsonT.et al. (2024). Perspectives on improving photosynthesis to increase crop yield. Plant Cell36, 39443973. doi: 10.1093/plcell/koae132

  • 8

    DasK.RoychoudhuryA. (2014). Reactive oxygen species (ros) and response of antioxidants as ros-scavengers during environmental stress in plants. Front. Environ. Sci.2. doi: 10.3389/fenvs.2014.00053

  • 9

    DienD. C.MochizukiT.YamakawaT. (2019). Effect of various drought stresses and subsequent recovery on proline, total soluble sugar and starch metabolisms in rice (oryza sativa l.) varieties. Plant Prod. Sci.22, 530545. doi: 10.1080/1343943X.2019.1647787

  • 10

    FurlanA. L.BianucciE.GiordanoW.CastroS.BeckerD. F. (2020). Proline metabolic dynamics and implications in drought tolerance of peanut plants. Plant Physiol. Biochem.151, 566578. doi: 10.1016/j.plaphy.2020.04.010

  • 11

    GaoL.JinL.LiuQ.ZhaoK.LinL.ZhengJ.et al. (2024). Recent advances in the extraction, composition analysis and bioactivity of camellia (camellia oleifera abel.) oil. Trends Food Sci. Technol.143, 104211. doi: 10.1016/j.tifs.2023.104211

  • 12

    GorniP. H.RodriguesC.SperaK. D.CorreiaR. F. C. C.MendesN. A. C.Dos ReisA. R. (2025). Selenium fertilization enhances carotenoid and antioxidant metabolism to scavenge ros and increase yield of maize plants under drought stress. Plant Physiol. Biochem.221, 109675. doi: 10.1016/j.plaphy.2025.109675

  • 13

    HaoL.ChangZ.LuY.TianY.ZhouH.WangY.et al. (2023). Drought dampens the positive acclimation responses of leaf photosynthesis to elevated [co2] by altering stomatal traits, leaf anatomy, and rubisco gene expression in pyrus. Environ. Exp. Bot.211, 105375. doi: 10.1016/j.envexpbot.2023.105375

  • 14

    HasanuzzamanM.BhuyanM. H. M. B.ParvinK.BhuiyanT. F.AneeT. I.NaharK.et al. (2020). Regulation of ros metabolism in plants under environmental stress: A review of recent experimental evidence. Int. J. Mol. Sci.21, 8695. doi: 10.3390/ijms21228695

  • 15

    HeZ.LiuC.ZhangZ.WangR.ChenY. (2022). Integration of mrna and mirna analysis reveals the differentially regulatory network in two different camellia oleifera cultivars under drought stress. Front. Plant Sci.13. doi: 10.3389/fpls.2022.1001357

  • 16

    HeX.XuL.PanC.GongC.WangY.LiuX.et al. (2020). Drought resistance of camellia oleifera under drought stress: Changes in physiology and growth characteristics. PloS One15, e0235795. doi: 10.1371/journal.pone.0235795

  • 17

    HuangY.LiJ.NongC.LinT.FangL.FengX.et al. (2024). Piriformospora indica enhances resistance to fusarium wilt in strawberry by increasing the activity of superoxide dismutase, peroxidase, and catalase, while reducing the content of malondialdehyde in the roots. Horticulturae10, 240. doi: 10.3390/horticulturae10030240

  • 18

    KaramiS.ShiranB.RavashR. (2025). Molecular investigation of how drought stress affects chlorophyll metabolism and photosynthesis in leaves of c3 and c4 plant species: A transcriptome meta-analysis. Heliyon11, e42368. doi: 10.1016/j.heliyon.2025.e42368

  • 19

    KhanA. A.WangY.-F.AkbarR.AlhoqailW. A. (2025). Mechanistic insights and future perspectives of drought stress management in staple crops. Front. Plant Sci.16. doi: 10.3389/fpls.2025.1547452

  • 20

    KhedrA. H. A.AbbasM. A.WahidA. A. A.QuickW. P.AbogadallahG. M. (2003). Proline induces the expression of salt-stress-responsive proteins and may improve the adaptation of pancratium maritimum l. to salt-stress. J. Exp. Bot.54, 25532562. doi: 10.1093/jxb/erg277

  • 21

    KrishankumarS.HunterJ. J.AlyafeiM.SoukaU.SubramaniamS.AyyagariR.et al. (2025). Influence of different scion-rootstock combinations on sugars, polyamines, antioxidants and malondialdehyde in grafted grapevines under arid conditions. Front. Plant Sci.16. doi: 10.3389/fpls.2025.1559095

  • 22

    LaxaM.LiebthalM.TelmanW.ChibaniK.DietzK.-J. (2019). The role of the plant antioxidant system in drought tolerance. Antioxidants8, 94. doi: 10.3390/antiox8040094

  • 23

    LiS.LiuS.ZhangQ.CuiM.ZhaoM.LiN.et al. (2022). The interaction of aba and ros in plant growth and stress resistances. Front. Plant Sci.13. doi: 10.3389/fpls.2022.1050132

  • 24

    LiH.MaX.WangW.ZhangJ.LiuY.YuanD. (2023). Enhancing the accumulation of linoleic acid and a-linolenic acid through the pre-harvest ethylene treatment in camellia oleifera. Front. Plant Sci.14. doi: 10.3389/fpls.2023.1080946

  • 25

    LiM.YueX.ZhouY.JiY.WeiL.ZhouD.et al. (2024). Regulation of iron chlorine e6 on high temperature stress tolerance and related gene expression in pepper. Jiangsu. J. Agric. Sci.40, 1070–1077. doi: 10.3969/j.issn.1000-4440.2024.06.014

  • 26

    LimC. W.BaekW.JungJ.KimJ.-H.LeeS. C. (2015). Function of aba in stomatal defense against biotic and drought stresses. Int. J. Mol. Sci.16, 1525115270. doi: 10.3390/ijms160715251

  • 27

    LinM.WangS.LiuY.LiJ.ZhongH.ZouF.et al. (2022). Hydrogen cyanamide enhances flowering time in tea oil camellia (camellia oleifera abel.). Ind. Crops Prod.176, 114313. doi: 10.1016/j.indcrop.2021.114313

  • 28

    MaY.SzostkiewiczI.KorteA.MoesD.YangY.ChristmannA.et al. (2009). Regulators of pp2c phosphatase activity function as abscisic acid sensors. Science324, 10641068. doi: 10.1126/science.1172408

  • 29

    NakashimaK.Yamaguchi-ShinozakiK. (2013). Aba signaling in stress-response and seed development. Plant Cell Rep.32, 959970. doi: 10.1007/s00299-013-1418-1

  • 30

    NdombiS. N.ChenY.GaoQ.JiangJ.ShenQ.MaY.et al. (2025). The csugt87a1 gene enhances drought stress tolerance in tea plants by modulating iaa homeostasis. Plant Physiol. Biochem. 227, 110158. doi: 10.1016/j.plaphy.2025.110158

  • 31

    OzturkM.Turkyilmaz UnalB.García-CaparrósP.KhursheedA.GulA.HasanuzzamanM. (2021). Osmoregulation and its actions during the drought stress in plants. Physiol. Plant.172, 13211335. doi: 10.1111/ppl.13297

  • 32

    QiaoM.HongC.JiaoY.HouS.GaoH. (2024). Impacts of drought on photosynthesis in major food crops and the related mechanisms of plant responses to drought. Plants13, 1808. doi: 10.3390/plants13131808

  • 33

    ShenS.YanW.XieS.YuJ.YaoG.LiuY.et al. (2024). Comparison of morphological, physiological, and related gene expression responses to drought stress in five camellia Vietnamensis cultivars. Agronomy14, 915. doi: 10.3390/agronomy14050915

  • 34

    ShengqiL.JiandongW.QingshengR.QingzhiL.BeiD.ShoupengG.et al. (2024). Application effect of 0.02% dihydroporphyrin iron soluble powder on ginger cultivation. Agric. Eng.14, 6467. doi: 10.19998/j.cnki.2095-1795.2024.09.011

  • 35

    ShiT.WuG.JinQ.WangX. (2020). Camellia oil authentication: A comparative analysis and recent analytical techniques developed for its assessment. a review. Trends Food Sci. Technol.97, 8899. doi: 10.1016/j.tifs.2020.01.005

  • 36

    SoonF.-F.NgL.-M.ZhouX. E.WestG. M.KovachA.TanM. H. E.et al. (2012). Molecular mimicry regulates aba signaling by snrk2 kinases and pp2c phosphatases. Science335, 8588. doi: 10.1126/science.1215106

  • 37

    SunC.XuL.UllahA.LiuX.SunJ.JiangD.et al. (2025). Drought priming combined with additional potassium application enhances wheat tolerance to post-anthesis drought via osmotic adjustment and leaf hydraulic conductance. Plant Physiol. Biochem.227, 109984. doi: 10.1016/j.plaphy.2025.109984

  • 38

    WangH.JonesB.LiZ.FrasseP.DelalandeC.RegadF.et al. (2005). The tomato aux/iaa transcription factor iaa9 is involved in fruit development and leaf morphogenesis. Plant Cell17, 26762692. doi: 10.1105/tpc.105.033415

  • 39

    WangY.YuY.WanH.TangJ.NiZ. (2022). The sea-island cotton gbtcp4 transcription factor positively regulates drought and salt stress responses. Plant Sci.322, 111329. doi: 10.1016/j.plantsci.2022.111329

  • 40

    XieY.WeiL.JiY.LiS. (2022). Seed treatment with iron chlorine e6 enhances germination and seedling growth of rice. Agriculture12, 218. doi: 10.3390/agriculture12020218

  • 41

    XingY.ChenL.MengD.XuJ.ShiJ. (2020). Application effect of 0.02% iron chlorin soluble powder in tobacco. Jiangsu. Agric. 431. Sci.48, 91–94. doi: 10.15889/j.issn.1002-1302.2020.24.017

  • 42

    YangD.ChenY.WangR.HeY.MaX.ShenJ.et al. (2024). Effects of exogenous abscisic acid on the physiological and biochemical responses of camellia oleifera seedlings under drought stress. Plants13, 225. doi: 10.3390/plants13020225

  • 43

    YingX.LiX.DengS.ZhangB.XiaoG.XuY.et al. (2025). How lipids, as important endogenous nutrient components, affect the quality of aquatic products: An overview of lipid peroxidation and the interaction with proteins. Compr. Rev. Food Sci. Food Saf.24, e70096. doi: 10.1111/1541-4337.70096

  • 44

    ZhangT.LiuC.ChenY.XuY.TangW.ChenL.et al. (2023). Physiological and biochemical effects of exogenous calcium on camellia oleifera abel under drought stress. Forests14, 2082. doi: 10.3390/f14102082

  • 45

    ZhangZ.LiuC.ZhangY.HeZ.ChenL.XunC.et al. (2025). Stage-specific transcriptomic insights into seed germination and early development in camellia oleifera abel. Plants14, 2283. doi: 10.3390/plants14152283

Summary

Keywords

drought stress, iron dihydroporphyrin, oil-tea camellia, plant growth regulators, ICE6

Citation

Yang D, Li Z, He Y, Ma X, Shen J, Xun C, Zhang Z, Wang R, Chen Y and He Z (2025) Iron Chlorin E6 enhances drought resilience in Camellia oleifera Abel. Front. Plant Sci. 16:1666016. doi: 10.3389/fpls.2025.1666016

Received

14 July 2025

Accepted

25 August 2025

Published

15 September 2025

Volume

16 - 2025

Edited by

Muthusamy Ramakrishnan, Nanjing Forestry University, China

Reviewed by

Indraneel Saha, Bose Institute, India

Peihua Du, Hebei Agricultural University, China

Dawei Shi, Nanjing Forestry University, China

Zhang Guoliang, Huaiyin Institute of Technology, China

Purui Guo, Central South University of Forestry and Technology, China

Updates

Copyright

*Correspondence: Zhilong He,

†These authors contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics