- 1College of Resources and Environment, Henan Agricultural University, Zhengzhou, China
- 2College of Mechanical & Electrical Engineering, Henan Agricultural University, Zhengzhou, China
Purpose: This study examined the effects and underlying mechanisms of combining pig manure composts, produced by different fermentation methods, with chemical fertilizers on winter wheat yield, nutrient uptake, light–thermal physiology, soil fertility, and microbial communities.
Methods: Field experiment was conducted in Yuanyang County, Henan Province (2023–2024) with the following treatments: no fertilizer (CK), chemical fertilizer (TK), combined organic–inorganic applications with 25:75 and 50:50 ratios. The 25:75 treatments included natural compost (TA1), water-controlled trough compost (TA2), acid-controlled trough compost (TA3), and trough compost (TA4) combined with chemical fertilizer; the 50:50 treatments included the same four compost types (TB1–TB4). Their effects on yield, nutrient uptake dynamics, and light–thermal traits were evaluated, alongside changes in soil physicochemical properties, available nitrogen distribution, aggregate structure, enzyme activities, and microbial community composition and diversity.
Results: The compost-to-fertilizer ratio of 25:75 significantly increased yields, with TA3 performing best—42.26%, 6.43% and 12.68% higher than the CK, TK, and the average of other organic fertilizer treatments, respectively. TA3 also recorded the highest total nitrogen, phosphorus, and potassium uptake and the greatest average uptake rate. It markedly enhanced photosynthetic performance at all growth stages. Compost–fertilizer combinations improved soil nutrient levels and increased the proportion of large aggregates (≥0.25 mm). High-throughput sequencing revealed that acid-regulated compost altered microbial community structure and promoted the expansion of rare taxa. Moreover, partial least squares path model indicated that acid-regulated trough compost increased yield by elevating soil nutrient levels and improving wheat physiological status.
Conclusion: 25:75 acid-regulated compost–fertilizer combination significantly improved winter wheat yield, nutrient efficiency, light–thermal use, soil fertility, structure, and microbial diversity, providing a practical basis for efficient organic fertilizer use in sandy fluvo-aquic soils of China’s winter wheat regions.
1 Introduction
Wheat (Triticum aestivum L.) is one of China’s most important staple crops, accounting for approximately 19.9% of the nation’s total grain cultivation area and 19.6% of total grain output (NBS, 2024). In recent years, advances in agricultural technology have improved both wheat yield and production efficiency. However, increasing crop productivity per unit area remains a major challenge in the context of accelerating climate change, population growth, and shrinking arable land resources (Yan et al., 2020). Chemical fertilizers play a vital role in enhancing crop yield and quality and remain indispensable in agricultural production. Nevertheless, widespread overuse and inefficient application methods have caused significant environmental issues, including soil degradation, increased greenhouse gas emissions, and water eutrophication (Xing et al., 2023). In 2023, China’s total fertilizer consumption reached 50.217 million tons, yet the seasonal utilization rates of nitrogen, phosphorus, and potassium fertilizers in wheat production were only 26–31%, 10–20%, and 30–40%, respectively (CAGDRS et al., 2024). Excessive and improper fertilizer use, along with low nutrient use efficiency, not only wastes resources but also exacerbates soil acidification, compaction, and organic matter loss. In some regions, soil organic matter content has fallen below the critical threshold of 1.5%, posing serious risks to sustainable agriculture (Zhao et al., 2023). Nutrient imbalance and low fertilizer use efficiency are often more pronounced in specific soil types, particularly in sandy fluvo-aquic soils (Yin et al., 2022). Therefore, the development of green and efficient nutrient management strategies that simultaneously improve crop productivity and soil health is essential for ensuring food security and enhancing soil fertility and quality.
Organic fertilizers are rich in organic matter, essential nutrients, and beneficial microorganisms. When applied appropriately, they can significantly improve soil structure, enhance nutrient cycling, increase soil enzyme activity, and boost soil fertility (Li et al., 2020). However, organic fertilizers also have limitations, such as low concentrations of key nutrients, slow nutrient release, and the need for large application volumes, making them insufficient on their own to meet crop nutrient demands during a single growing season (Zhu et al., 2024; Ren et al., 2025). Studies indicate that neither sole nor excessive application of organic fertilizer can meet current food security needs in most regions of China. Only through the integrated application of organic and chemical fertilizers, balancing quick nutrient availability with long-term fertility, can the benefits of both be fully realized—simultaneously improving wheat yield and soil fertility (He et al., 2022; Dang and Wang, 2025). Research has shown that combined application of both organic and inorganic fertilizers significantly increases crop yield, dry matter accumulation, and nutrient uptake (Lu et al., 2024), boosts grain crude protein and amino acid content (Sun et al., 2022), improves canopy structure and photosynthetic rates (Liang et al., 2022), and increases fertilizer use efficiency under the same application rate (Ren et al., 2022). Moreover, combined fertilization is a practical approach to improving soil fertility and structure. It can significantly increase soil nutrient content, optimize nutrient ratios (He et al., 2022), and enhance humus content and enzyme activities (Li et al., 2023a; Yin et al., 2024; Ren et al., 2025). This approach also helps regulate the balance between soil NH4+-N and NO3--N dynamics and reduces NH3 volatilization losses (Watts et al., 2010; Duan et al., 2024a). Organic fertilizers supply various nutrients that serve as rich carbon and nitrogen sources and energy for microorganisms. Proper application promotes a more balanced soil microbial community (Jin et al., 2022; Yu et al., 2024), facilitates the colonization and expression of functional microbes (e.g., nitrogen-fixers and phosphate-solubilizers), and inhibits the proliferation of soil-borne pathogens (Wu et al., 2022). Enhancement of microbial community structure also strengthens the soil’s carbon and nitrogen metabolic networks, providing a sustained biological driver for nutrient efficiency and healthy crop root development (Yin et al., 2022).
With the rapid expansion of livestock and poultry production and increasing intensification of farming, China generates approximately 3.8 billion tons of livestock and poultry manure annually. The comprehensive utilization rate of this waste rose from less than 60% in 2015 to 75% in 2020. Converting livestock waste into organic fertilizer is considered one of the most effective strategies for recycling agricultural waste resources (Wei et al., 2021; Zhang et al., 2023a). While fresh manure is rich in nutrients and organic matter, it also contains significant quantities of pathogens, heavy metals, and emerging contaminants like microplastics and antibiotic resistance genes. Direct application of untreated manure to farmland can lead to the transfer of these pollutants through microbial activity into crops and potentially throughout the food chain, posing risks to ecosystem safety and human health (Li et al., 2024a; Cheng et al., 2022; Braun et al., 2021). Therefore, the development of appropriate fermentation and composting methods for livestock manure is of both theoretical and practical significance for improving the safety, reliability, and value-added utilization of organic fertilizers. Accordingly, this study focuses on how different fermentation methods affect compost quality to enhance both its safety and agronomic efficiency, providing a novel perspective for optimizing manure recycling and utilization.
Aerobic composting converts livestock and poultry manure into organic fertilizer rich in humus and nutrients, offering a resource-efficient and safe method for manure management and utilization (Qiu et al., 2020). Trough composting, a mechanized aerobic fermentation system built on trough reactors, maintains dynamic oxygen levels through mechanical turning and forced aeration. This method ensures a high degree of homogenization and efficient degradation of volatile organic compounds, making it the mainstream manure treatment process for large-scale livestock farms (Qiu et al., 2020; Tweib et al., 2014). However, the dual stress of sustained high temperature and alkaline conditions during composting can inhibit the activity of core functional microbes such as thermophilic actinomycetes (Zhang et al., 2023b; Li et al., 2023b). These conditions also promote the conversion of sulfides into toxic intermediates like thiosulfates, impeding lignocellulose degradation and slowing humification. As a result, the final compost may show a low germination index and residual levels of phenolic compounds and free ammonia, indicating incomplete maturation and reduced safety and agronomic efficiency (Xu et al., 2024; Duan et al., 2024b). Therefore, in addition to temperature regulation, adjusting the pH of compost products is critical for ensuring compost quality. pH is a key factor in aerobic composting; excessively high pH levels increase ammonia volatilization, suppress microbial activity, reduce organic matter decomposition, and compromise compost effectiveness. For example, Wang et al. (2018) found that adding a mixture of zeolite and biochar to pig manure compost significantly reduced NH3 emissions. Yuan et al. (2018) reported that adding superphosphate reduced NH3 release and improved nutrient retention in the final product. Current research on compost maturation mainly focuses on parameter optimization and physical amendments, but these methods can be complex and rarely verify post-compost performance in crop systems. To address this issue, this study employed readily available acetic acid as a chemical regulator to control pH levels during the composting process and validated its impact on crop system performance through field experiment. A field experiment was then conducted using winter wheat, combining organic fertilizers produced by different fermentation methods—natural composting, water-regulated trough composting, acid-regulated trough composting, and conventional trough composting—with chemical fertilizers at two mixing ratios: 25:75 and 50:50 (organic: inorganic). This study aims to systematically investigate how pig manure compost produced by different fermentation methods, when combined with chemical fertilizers, affects winter wheat yield, light-thermal physiological traits, nutrient uptake and accumulation dynamics, and soil properties, including nutrient content, enzyme activity, aggregate structure, and microbial community composition. The findings are expected to provide technical guidance for the rational use of organic fertilizer, as well as for enhancing wheat yield and quality and improving cultivated land health through sustainable practices.
2 Materials and methods
2.1 Experimental site description
From October 2023 to June 2024, a field experiment was conducted at the Yuanyang Science and Education Park of Henan Agricultural University (35°11′N, 113°95′E), testing the effects of different fermentation methods of organic fertilizer combined with chemical fertilizer on winter wheat. Detailed temperature and precipitation trends during the experiment are shown in Figure 1. The test soil was sandy fluvo-aquic soil, with the 0–20 cm topsoil layer having the following baseline properties: pH 8.08, bulk density 1.36 g·cm-³, organic matter 16.17 g·kg-¹, total nitrogen (TN) 0.92 g·kg-¹, available phosphorus (AP) 18.41 mg·kg-¹, and available potassium (AK) 112 mg·kg-¹.
2.2 Experimental design
The organic fertilizers used in this study were prepared by fermenting fresh pig manure (after solid-liquid separation) with wheat straw for 32 days. Four fermentation methods were applied. The first was natural composting, in which the pig manure and straw were stacked in windrows measuring 10 m in length, 2.5 m in width, and 1.2 m in height for passive fermentation. The remaining three methods involved trough composting, conducted in a trough structure measuring 40 m in length (divided into three 10 m sections with 5 m buffer zones), 20 m in width, and 2.5 m in height. The compost was turned every 24 hours using mechanical equipment. The three trough composting treatments were as follows: (1) Conventional trough composting, where no additional treatment was applied before or after turning; (2) Water-Regulated trough composting method: After each turning, spray water onto the compost surface using a sprayer at a rate of 2 kg per square meter. (3) Acid-regulated trough composting method: After each turning, spray a 0.005 mol·L-¹ dilute acetic acid solution onto the compost surface at a rate of 2 kg per square meter. The physicochemical properties of the organic fertilizers before and after fermentation are shown in Table 1.
Table 1. Physicochemical properties of the organic manure before fermentation and after fermentation.
A total of 10 treatments were established in the field experiment: no fertilization (CK); chemical fertilizer only (TK); and two ratios of organic–inorganic fertilizer combinations. For the 25% organic fertilizer + 75% chemical fertilizer treatments: natural compost + fertilizer (TA1), water-regulated trough compost + fertilizer (TA2), acid-regulated trough compost + fertilizer (TA3), and conventional trough compost + fertilizer (TA4). For the 50% organic fertilizer + 50% chemical fertilizer treatments: natural compost + fertilizer (TB1), water-regulated trough compost + fertilizer (TB2), acid-regulated trough compost + fertilizer (TB3), and conventional trough compost + fertilizer (TB4).
Application rates for nitrogen (N), phosphorus (P205), and potassium (K2O) were 150, 120, and 90 kg·hm-², respectively. Organic fertilizers substituted for 25% or 50% of the total chemical fertilizer input based primarily on nitrogen content and adjusted for phosphorus and potassium. The chemical fertilizers used were urea (46% N), single superphosphate (12% P205), and potassium chloride (60% K2O), all applied as basal fertilizer once before sowing. Each plot measured 36 m² (3.6 m × 10 m), with three replicates arranged in a randomized block design. The winter wheat variety used was ‘Zhengmai 369’, sown on October 17, 2023, and harvested on May 29, 2024, at a seeding rate of 300 kg·hm-². Field management followed local farming practices.
2.3 Measurement items and methods
2.3.1 Yield measurement
At wheat maturity, all grain spikes within a uniformly growing 5.0 m² area of each plot were harvested, air-dried under natural conditions, threshed, and weighed to calculate grain yield.
2.3.2 Plant sample collection and analysis
At the overwintering, jointing, flowering, and maturity stage, representative 1 m double-row wheat samples were collected from each plot. The samples were inactivated at 105°C for 30 minutes, dried at 75°C to a constant weight, and then weighed to determine biomass. After grinding, samples were digested using the concentrated H2SO4-H2O2 method. TN was measured using the Kjeldahl method, total phosphorus by the molybdenum blue colorimetric method, and total potassium using flame photometry (Bao, 2000).
2.4 Canopy temperature measurement and analysis
At the overwintering, jointing, and flowering stage, canopy temperature was measured between 11:00 and 13:00 on sunny days with minimal wind using an infrared thermal imager (TiX650, Fluke, USA). The imager’s camera lens was positioned approximately 1.0 m above the canopy with a 60° viewing angle. Three images were captured per plot, and canopy temperature were analyzed using the instrument’s SmartView software.
2.5 Leaf photosynthetic parameter measurement
At the overwintering and jointing stage, the newest fully expanded leaves were selected (flag leaves at flowering). Between 9:00 and 11:00 AM, photosynthetic parameters, including net photosynthetic rate (Pn, µmol·m-²·s-¹), stomatal conductance (Gs, mol·m-²·s-¹), intercellular CO2 concentration (Ci, µmol·mol-¹), and transpiration rate (Tr, μmol·m-²·s-¹), were measured using the LI-6800 portable photosynthesis system (LI-COR, USA), with the leaf chamber setting to a light intensity of 1000 µmol·m-²·s-¹, CO2 concentration of 400 µmol·mol-¹, relative humidity of 50%, temperature of 25°C, and airflow rate of 500 µmol·s-¹ (Liang et al., 2022).
2.6 Soil sampling and analysis
For soil nutrient measurement, soil samples were collected from the 0–20 cm layer before sowing and fertilization and at the overwintering, jointing, flowering, and maturity stage. After air-drying and sieving, soil pH, organic matter, TN, AP and AK were tested (Bao, 2000). For soil aggregates and C: N ratio measurement, three soil samples were collected from the 0–20 cm layer per plot at the overwintering, jointing, flowering, and maturity stage. Samples from the same stage were mixed, fractionated using the wet-sieving method following Cambardella and Elliott (1993). Proportions of >2 mm (macro-aggregates), 0.25–2 mm (large aggregates), 0.053–0.25 mm (micro-aggregates), and <0.053 mm (silt and clay) were determined. TN and organic carbon were measured for each aggregate size class (Bao, 2000). For soil enzyme activity measurement, fresh soil samples were collected at the overwintering, jointing, and flowering stage. Urease activity (S-URE) was measured by the phenol-sodium hypochlorite colorimetric method, acid phosphatase (S-ACP) by the disodium phenyl phosphate method, and dehydrogenase activity (S-DHA) by potassium permanganate titration (Wang et al., 2020).
For soil microbial community composition analysis, fresh soil samples were collected at wheat maturity and stored in liquid nitrogen. Samples were ground in extraction buffer using a Tissuelyser-48 (Jingxin Instruments, Shanghai, China) at 60 Hz. DNA was extracted using the MagBeads FastDNA Kit for Soil (MP Biomedicals, USA) and quantified with a Nanodrop spectrophotometer. Bacterial 16S rRNA V3–V4 region and fungal ITS1 region were amplified using primer pairs 338F (5’-barcode+ACTCCTACGGGAGGCAGCA-3’)/806R (5’-GGACTACHVGGGTWTCTAAT-3’) and ITS5 (GGAAGTAAAAGTCGTAACAAGG)/ITS2 (GCTGCGTTCTTCATCGATGC), respectively (Gade et al., 2013) and sequenced.
2.7 Data analysis and processing
The nutrient accumulation process of winter wheat followed an S-shaped curve that conformed to the logistic model. A logistic equation was used to fit the dynamic accumulation of nitrogen (N), phosphorus (P), and potassium (K) under different treatments, and the corresponding parameters were calculated as follows (Yin et al., 2018):
where k, a, and b are constants; y is the nutrient accumulation (N, P, or K) at x days after sowing. By differentiating the equation, the following parameters were derived:
where t1 is the starting time of the rapid accumulation phase, t2 is the end time, Δt is the duration of rapid nutrient accumulation, Tmax is the time of maximum accumulation rate, Vmax is the maximum accumulation rate, and Vmean is the average accumulation rate.
All basic data processing and analyses were performed using Microsoft Excel 2021. SPSS Statistics 22.0 was employed for analysis of variance (ANOVA) and significance testing with the LSD method. DPS 7.05 was used for Logistic equation fitting, and Origin Pro 2024 was used for plotting. Microbial data were statistically analyzed using R software (version 4.5.0), with packages linkET, ggplot2, ggtext, dplyr, RColorBrewer, cols4all, and tidy verse for Mantel tests. Partial least squares path model was used to explore the reasons for the increase of wheat yield by pig manure composting. The path coefficient and determination coefficient in the path model were measured and verified by plspm package. Canoco 5 for redundancy analysis (RDA).
3 Results
3.1 Yield and yield components
The combined application of pig manure compost prepared under different fermentation methods and chemical fertilizer significantly improved winter wheat yield and its yield components (Table 2). Compared with CK, all treatments (TK–TB4) increased spike grain number, thousand-grain weight, and grain yield by 6.33%–17.07%, 1.55%–7.14%, and 17.72%–49.27%, respectively. Among treatments with 25% organic fertilizer and 75% chemical fertilizer (TA1–TA4), yield components improved further compared to TK, with average increases of 2.11%–4.03% in spike grain number, 1.51%–3.88% in thousand-grain weight, and 0.93%–6.87% in yield. The TA3 treatment showed the best yield performance, with significant increases of 1.62 g in thousand grain weight and 525.71 kg·hm-² in grain yield compared to TK (P < 0.05). In contrast, treatments with 50% organic and 50% chemical fertilizer (TB1–TB4) resulted in lower yield than TK, with reductions in spike grain number, thousand grain weight, and yield ranging from 0.60%–5.51%, 0.22%–1.53%, and 9.84%–11.57%, respectively.
Table 2. Effects of different fermentation methods of pig manure compost combined with chemical fertilizer on winter wheat yield and its components.
3.2 Above-ground nutrient accumulation dynamics
Across all treatments, N, P, and K accumulation in the above-ground parts of winter wheat followed an S-shaped curve over the growing season, characterized by an initial slow increase, a subsequent rapid accumulation phase, and a final plateau (Figure 2). Model fitting (Equations 1–7) results (Supplementary Table S1) showed that compared to TK, all treatments with 25% pig manure compost and 75% chemical fertilizer (TA1–TA4) increased the maximum above-ground accumulation (Ym) of N, P, and K by 1.40–6.57, 0.37–2.88, and 3.86–7.60 kg·hm-², respectively. The TA3 treatment performed best, with Ym values of 173.98, 35.38, and 173.60 kg·hm-², representing increases of 3.50%, 8.85%, and 4.58% over TK. TA2 ranked second, with respective increases of 3.90%, 4.03%, and 2.33%. In contrast, treatments with 50% organic fertilizer and 50% chemical fertilizer (TB1–TB4) significantly reduced above-ground N, P, and K accumulation, with reductions of 15.24–24.62, 6.25–6.40, and 9.38–14.35 kg·hm-², respectively. Furthermore, treatments TA1–TA4 advanced the onset of rapid nutrient accumulation (t1) by 1.0–7.6 days for N, 5.4–10.5 days for P, and 1.5–5.0 days for K, with TA3 showing the earliest onset. These treatments also shortened the duration of rapid accumulation (Δt) by 4.15–11.64 days (N), 4.59–9.60 days (P), and 3.46–5.78 days (K). Compared to TK, TA1–TA4 also enhanced average accumulation rates (Vmean) for N, P, and K by 12.71%, 16.43%, and 9.11%, respectively. In summary, TA3 was the most effective treatment, characterized by the highest Ym, the greatest average accumulation rate (Vmean), and the shortest duration of rapid accumulation (Δt).
Figure 2. Effects of different fermentation methods of pig manure compost combined with chemical fertilizer on the dynamics of nutrient accumulation in the aboveground part of winter wheat.
3.3 Canopy temperature and photosynthetic parameters
The application of pig manure compost under different fermentation methods with chemical fertilizers significantly affected canopy temperature and photosynthetic parameters of winter wheat (Supplementary Table S2, Figure 3). Compared to CK, all fertilizer treatments reduced the minimum, maximum, and average canopy temperature. During the overwintering, jointing, and flowering stage, the TK treatment reduced average canopy temperature by 0.13 °C, 0.51 °C, and 0.80 °C, respectively, compared to CK. Treatments with pig manure compost plus chemical fertilizer (TA1–TB4) further lowered canopy temperature, with average reductions of 7.04%, 2.36%, and 4.26% compared to TK. Among all treatments, TA3 performed best, with average canopy temperature of 6.93°C, 21.27°C, and 22.83°C during the overwintering, jointing, and flowering stage, respectively—5.33% lower than TK on average. In addition, co-application of pig manure compost and chemical fertilizer improved leaf photosynthetic performance more effectively than chemical fertilizer alone (Supplementary Figure S1). Pn, Gs, and Tr increased progressively over the growth stage, while Ci decreased. Compared with CK, the TK treatment significantly increased Pn, Gs, and Tr, while reducing Ci. Treatments TA1–TA4 further enhanced Pn, Gs, and Tr, with a greater decline in Ci. Conversely, treatments TB1–TB4 showed lower levels of Pn, Gs, and Tr than TK, and higher Ci levels, forming the trends of TA > TK > TB for Pn, Gs, and Tr and TA < TB < TK for Ci. Among all treatments, TA3 again performed best. At the flowering stage, Pn, Gs, and Tr peaked at 26.52 μmol·m-²·s-¹, 0.54 mol·m-²·s-¹, and 8.78 mmol·m-²·s-¹, respectively, while Ci reached its lowest value of 154.45 μmol·mol-¹.
Figure 3. Effects of different fermentation methods of pig manure compost combined with chemical fertilizer on canopy temperature of winter wheat (thermal image, temperature scale in °C).
3.4 Soil Enzyme activity and nutrient content
Soil enzyme activities increased progressively throughout the winter wheat growth stage and were significantly affected by fertilization (Table 3). The CK group exhibited the lowest activities of soil urease (S-URE), acid phosphatase (S-ACP), and dehydrogenase (S-DHA), with reductions of 34.04%, 81.11%, and 37.29%, respectively, compared to TK. Co-application of pig manure compost and chemical fertilizer significantly enhanced soil enzyme activity, with the TB1–TB4 treatments (50% organic fertilizer) showing the most pronounced effects. Compared to TK, TB1–TB4 S-URE activity by 15.82%, 20.74%, and 14.80%, S-ACP activity by 29.01%, 33.33%, and 55.36%, and S-DHA activity by 25.59%, 66.84%, and 14.50% during the overwintering, jointing, and flowering stage, respectively. Relative to the TA1–TA4 treatments (25% organic fertilizer), TB1–TB4 further improved soil enzyme activities (S-URE, S-ACP, and S-DHA) by 8.37%, 12.20%, and 15.12% on average during the overwintering, jointing, and flowering stage, respectively. Consistent with enzyme activity trends, soil nutrient levels were also significantly affected by fertilization (Supplementary Figure S2). At maturity, TK increased TN, AP, and AK by 28.41%, 91.54%, and 9.54%, respectively, over the CK group, while soil organic matter (SOM) rose by 2.61% (P > 0.05). On average, TA1–TB4 treatments raised TN, AP, AK, and SOM by 43.44%, 173.57%, 24.65%, and 19.04%, respectively. Compared to TK, TA1–TA4 increased TN, AP, AK, and SOM by 9.48%, 57.40%, 19.06%, and 9.18%, while TB1–TB4 increased these values by 13.94%, 28.26%, 8.53%, and 22.83%, respectively. In terms of pH, TK lowered soil pH by 0.14 compared to CK, whereas TA1–TB4 treatments reduced it by only 0.05 on average. Compared to TK, TA1–TA4 and TB1–TB4 increased soil pH by 0.10 and 0.08, respectively.
Table 3. Effects of different fermentation methods of pig manure compost and chemical fertilizer on soil enzyme activity of winter wheat (IU/L).
3.5 Spatial distribution of NH4+-N and NO3–N
The spatial distribution of soil NH4+-N and NO3--N in the 0–100 cm profile was significantly affected by the combined application of pig manure compost and chemical fertilizer under different fermentation methods (Figure 4). TK treatment markedly increased NH4+-N and NO3--N levels across all soil layers. In contrast, treatments TA1–TB4 enhanced NH4+-N concentrations primarily in the 0–20 cm layer while reducing NO3--N accumulation in deeper layers (40–100 cm). During the overwintering stage, treatments TK–TB4 significantly increased NH4+-N in the 0–80 cm layer and NO3--N in the 0–100 cm layer, both decreasing with soil depth. The most notable declines in NH4+-N and NO3--N occurred between the 0–20 cm and 20–40 cm layers. At the jointing stage, NH4+-N maintained a depth-dependent decline similar to that observed during overwintering, whereas NO3--N first increased and then decreased with depth. NO3--N peaked at 60–80 cm (23.00 mg·kg-¹) in the TK group but peaked at 20–40 cm (12.88–18.00 mg·kg-¹) in the TA1–TB4 groups. During flowering, NH4+-N levels declined rapidly from 0–80 cm, with TA1–TB4 maintaining high concentrations in the top 0–20 cm layer (15.49–23.89 mg·kg-¹). At maturity, NH4+-N levels followed a pattern similar to that observed at flowering. In the 0–20 cm layer, NH4+-N concentrations under TA1–TB4 were 26.20%–94.40% higher than under TK. NO3--N content under TK and TA1–TA4 initially increased with depth and then declined, with TK showing the highest NO3--N accumulation in the 20–100 cm layer. In contrast, TB1–TB4 treatments showed an inverse trend—NO3--N increased in the 0–20 cm layer by 7.84%–21.61% over TK, dropped to the lowest levels at 40–60 cm (12.03–13.00 mg·kg-¹), and then rose again in deeper layers.
Figure 4. Effects of different fermentation methods of pig manure compost combined with chemical fertilizer on NH4+-N and NO3--N contents in different soil layers of winter wheat.
3.6 Aggregate distribution and carbon-nitrogen ratio
The combined application of pig manure compost and chemical fertilizer promoted the transformation of <0.25 mm soil aggregates into >0.25 mm aggregates (Figure 5). In the CK and TK groups, the proportions of ≤0.053 mm and 0.053–0.25 mm aggregates increased over time, while the proportions of 0.25–2 mm and ≥2 mm aggregates decreased. In contrast, treatments TA1–TB4 showed the opposite trends: with the proportions of fine aggregates (≤0.053 and 0.053–0.25 mm) decreased, while those of the coarser aggregates (0.25–2 and ≥ 2 mm) increased with crop development. By maturity, TA1–TB4 treatments increased 0.25–2 mm and ≥2 mm aggregate proportions by an average of 8.73% and 6.42%, respectively, and reduced ≤0.053 mm and 0.053–0.25 mm aggregates by 6.78% and 4.52% compared to TK. Among treatments, the 50%:50% manure-to-fertilizer ratio group (TB1–TB4) showed the greatest improvement. Compared to TA1–TA4 treatments, TB1–TB4 treatments increased the proportion of 0.25–2 mm and ≥2 mm aggregates by 3.47% and 4.88%, respectively, and reduced the proportion of 0.053–0.25 mm and ≤0.053 mm aggregates by 2.79% and 3.96%, respectively.
Figure 5. Effects of different fermentation methods of pig manure compost combined with chemical fertilizer on soil aggregate distribution of winter wheat. The different lowercase letters in the figure indicate significant differences between the treatments (P < 0.05), the same below.
3.7 Changes of soil microbial community
Based on prior findings from our research group and the current analysis of plant and soil physicochemical indicators, the acid-regulated trough composting combined with chemical fertilizer application (TA3) was identified as the optimal organic-inorganic fertilization strategy (Wang et al., 2024b, Wang et al., 2025). To further investigate changes in functional microbial communities and their response mechanisms, soil microbial diversity was analyzed at maturity for CK, TK, TA3, and TB3 treatments. Compared to CK and TK, TA3 and TB3 significantly increased the Chao1 and Shannon indices for both bacterial and fungal communities (Figures 6a, b), indicating enhanced microbial diversity under organic–inorganic co-application. Venn diagram analysis (Figures 6c, d) showed that 1,660 bacterial OTUs and 152 fungal OTUs were shared across all treatments, suggesting that the core bacterial community was relatively stable, while the fungal community was more responsive to fertilization. Each treatment exhibited distinct OTUs, with TB3 showing the highest number of unique groups in both bacteria (4,223) and fungi (424), suggesting that a higher proportion of organic fertilizer substantially enhances microbial specificity and richness, thereby contributing to a more diverse soil microecosystem.
Figure 6. Effects of different fermentation methods of pig manure compost combined with chemical fertilizer on soil bacterial and fungal community composition of winter wheat. (a) Chao1 index of bacteria and fungi (b) Shannon index of bacteria and fungi, (c) Venn diagram of bacteria (d) Venn diagram of fungi, (e) relative abundance of the top 10 phyla of bacteria (f) relative abundance of the top 10 phyla of fungi, (g) heat map of soil physical and chemical indicators and Mantel test of bacterial and fungal diversity index. A4-large aggregates (≥2mm), A3-large aggregates (0.25-2mm), A2-microaggregates (0.053-0.25mm) and A1-powder clay (≤0.053mm).
At the phylum level, a total of 33 bacterial phyla were detected across the four treatments (Figure 6e). The top ten phyla by relative abundance included Acidobacteriota, Proteobacteria, Actinobacteriota, Gemmatimonadota, Chloroflexi, Methylomirabilota, Bacteroidota, Myxococcota, Planctomycetota, and Verrucomicrobiota. Different treatments showed varying bacterial abundance. Compared to TK, the relative abundance of Acidobacteriota and Bacteroidota in TA3 and TB3 treatment groups increased by 0.17% and 1.07%, and 1.24% and 0.11%, respectively. For fungi (Figure 6f), 10 phyla were detected, with Ascomycota, Basidiomycota, and Mortierellomycota accounting for over 95% of the total abundance. Ascomycota dominated the fungal communities in TA3 and TB3, with relative abundances of 81.35% and 81.43%, slightly lower than those in TK by 1.35% and 1.27%. In contrast, Basidiomycota abundance increased by 0.26% and 2.40%, respectively.
Mantel test results (Figure 6g) indicated significant correlations between soil physicochemical properties, aggregate structure, and microbial community composition. Bacterial communities were strongly and positively correlated with nitrogen-related indicators (NH4+-N, NO3--N, and total nitrogen), soil organic matter (SOM), available phosphorus (AP), and available potassium (AK) (Mantel’s r ≥ 0.4, P < 0.001). In addition, bacterial communities were significantly associated with large macroaggregates (A3, 0.25–2 mm) and very large aggregates (A4, ≥2 mm), suggesting that structurally stable, oxygen-rich macroaggregates provide a favorable microhabitat for bacteria. Although the correlations between fungal communities and environmental factors were slightly weaker, significant associations were still found with SOM, TN, AK, and medium-sized aggregates (A2, A3) (Mantel’s r > 0.3, P < 0.05), implying that fungi prefer well-aerated soils with moderate aggregate sizes and high organic matter. Notably, within the studied pH range, pH showed no significant correlation with either bacterial or fungal community structures. These findings were corroborated by heatmap and Pearson correlation analyses, further confirmed these findings, with bacterial communities showing stronger correlations with nitrogen, SOM, and AK compared to fungi, indicating that bacteria are more sensitive to nutrient fluctuations. In contrast, fungal communities responded more selectively to SOM and medium-sized aggregates.
Figure 7a illustrates the relationship between bacterial phylum-level community structure and various environmental factors, with RDA1 and RDA2 explaining 39.48% and 27.13% of the variation, respectively. Proteobacteria, Bacteroidota, and Actinobacteriota were significantly positively correlated with environmental factors, including TN, NO3--N, NH4+-N, AP, AK, and SOM. In contrast, Acidobacteriota, Gemmatimonadota, and Methylomirabilota were distributed in the opposite directions, suggesting their higher abundance under oligotrophic or stable soil conditions. Chloroflexi, Planctomycetota, and Verrucomicrobiota appeared toward the central-left region of the plot, indicating weak correlations with the environmental variables, possibly reflecting low sensitivity to environmental changes or broad ecological tolerance. Figure 7b shows the relationship between fungal phylum-level communities and soil environmental factors, with RDA1 and RDA2 explaining 22.65% and 19.38% of the variation, respectively. Ascomycota, Mucoromycota, and Kickxellomycota were significantly positively associated with nutrient-rich conditions, including SOM, NH4+-N, TN, NO3--N, and AP, suggesting their greater activity or dominance in fertile soils. Conversely, Glomeromycota, Olpidiomycota, and Mortierellomycota were distributed along gradients of higher pH and lower nutrient levels, indicating a preference for neutral to alkaline, nutrient-poor environments. Basidiomycota, Chytridiomycota, and Rozellomycota were positioned in the upper-left quadrant, implying weak responses to the main environmental variables assessed. Among the factors, TN (F = 1.8, P = 0.04) and NH4+-N (F = 1.9, P = 0.05) significantly influenced fungal community composition, explaining 15.4% and 14.3% of total variance, respectively.
Figure 7. Redundancy analysis (RDA) of Bacteria (a) and Fungi (b) with Soil Properties. In the figure, AN-mmonium nitrogen, NN-nitrate nitrogen, A4-large aggregates (≥2mm), A3-large aggregates (0.25-2mm), A2-microaggregates (0.053-0.25mm) and A1-powder clay (≤0.053mm).
The species composition heatmap (Figure 8) further illustrated the impact of different fertilization treatments on soil bacterial and fungal community structures. In the bacterial community, compared with CK, TK treatment significantly enriched taxa such as Vicinamibacteraceae, WQ55, Il-24, and NB1-j, indicating their sensitivity to readily available inorganic nutrients. In contrast, genera like Massilia and S0154_terrestrial_group were more abundant under CK, suggesting a preference for low-nutrient environments. With increasing proportions of organic fertilizer, compost-related taxa such as Streptomyces, Gaiella, and Gemmatimonas became progressively enriched in TA3 and TB3, with TB3 showing the most pronounced accumulation, reflecting their affinity for compost-derived carbon sources and organic matter. In the fungal community, the abundances of Aspergillus, Trichoderma, and Talaromyces decreased under TK but significantly rebounded in TB3, indicating that organic matter input supports their growth. Saprophytic fungi such as rtierella, Penicillium, and Humicola were notably enriched in TB3, suggesting that higher compost ratios promote functional fungal proliferation and nutrient cycling. Conversely, Stachybotrys and Sarocladium were more abundant in CK, indicating their adaptation to nutrient-poor or undisturbed environments. Overall, among the organic-inorganic combined treatments, TB3 had the most pronounced effect, contributing to enhanced microbial diversity and improved ecological function in the soil.
Figure 8. Effects of pig manure compost with different fermentation methods combined with chemical fertilizer on the species composition heat map of bacteria (left) and fungi (right) in winter wheat soil.
3.8 Soil properties, interaction between microorganisms and plants after application of pig manure compost
The partial least squares path model was used to evaluate the effects of fertilization and soil factors on yield (Figure 9). The results showed that pig manure composting had a significant positive effect on soil nutrients (Path coefficient = 0.92, P < 0.001) and microbial communities (Path coefficient = 0.78, P < 0.01). In addition, soil nutrients significantly positively affected plant indicators (Path coefficient = 1.52, P < 0.001) and plant physiology (Path coefficient = 0.71, P < 0.01), and soil aggregates (Path coefficient = -0.95, P < 0.01) significantly negatively affected plant indicators. The indirect effect of pig manure compost on plant indicators was greater than its direct effect (Path coefficient = 0.23), indicating that the application of pig manure compost may indirectly affect crop yield and nutrient accumulation by changing soil nutrient levels or improving plant physiological status.
Figure 9. Partial least squares path analysis model. The TN, AP, AK and SOM is soil total nitrogen, available phosphorus, available potassium and organic matter. < 0.053mm, 0.053-0.25mm, 0.25-2mm and 2mm < is aggregate size distribution. NA, PA and KA is the accumulation of nitrogen, phosphorus and potassium.
4 Discussion
4.1 Yield, nutrients, light and temperature physiology
Integrated application of organic and inorganic fertilizers is an effective strategy to improve crop yield and to enhance N, P, and K accumulation (Gelaye, 2023; Hu et al., 2023; Li et al., 2022a; He et al., 2022). Organic fertilizers, rich in organic matter and diverse nutrients, help maintain an optimal C: N ratio and provide sustained nutrient availability. Their application with chemical fertilizers improves nutrient retention and supply, promotes nutrient uptake, and enhances N, P, and K accumulation—ultimately boosting fertilizer use efficiency and crop yield (Verma et al., 2023; Wei et al., 2020; Gorfie et al., 2022; He et al., 2023). In this study, treatments TA1–TA4 (25% organic + 75% chemical fertilizer) significantly increased wheat yield, thousand-grain weight, and N, P, and K accumulation compared with TK, whereas treatments TB1–TB4 (50% organic + 50% chemical fertilizer) showed a declining trend for the same indicators (Table. 2). This may be attributed to insufficient levels of available nutrients in higher organic fertilizer treatments during peak wheat nutrient demand, resulting in poor nutrient synchrony. High organic input also disrupts the soil C: N balance, stimulating heterotrophic microbial activity. These microbes preferentially utilize mineral nitrogen for their metabolism and organic matter decomposition, causing “nitrogen immobilization,” which suppresses plant growth and nutrient accumulation (Mooshammer et al., 2014). Logistic modeling results (Figure 2, Supplementary Table S1) indicated that 25% organic fertilizer substitution (TA treatments) enhanced nutrient accumulation rates and accelerated winter recovery, advancing wheat growth resumption. However, lower availability of mineral nutrients in TB treatments restricted nutrient uptake compared to TA and TK. This is likely due to organic fertilizers increasing soil water content and specific heat, buffering against temperature fluctuations, and protecting roots and tillers from frost. They also enhance the activities of β-xylosidase and α-glucosidase, promoting straw decomposition and accumulation of labile carbon (e.g., EOC, DOC), supplying energy during greening (Gong et al., 2019). Moreover, a 25-year long-term fertility trial found no yield advantage from combined fertilization over single applications of equivalent nutrient levels from either organic or inorganic sources. This outcome highlights the complex interactions among fertilizers, cropping systems, soil properties, and field management, and underscores the need to tailor fertilization strategies to local soil fertility, environmental conditions, and agronomic practices (Ripoche et al., 2015). The difference chiefly reflects soil and management factors: the Mali experiment was on low-fertility sandy soils with weak nutrient buffering and manure inputs already large relative to mineral fertilizer in a cotton–sorghum–groundnut rotation, whereas this study involved higher-fertility sandy fluvo-aquic soils and optimized nutrient ratios and timing for winter wheat, so organic–mineral co-application produced a clear yield benefit here.
Maintaining an optimal light-temperature physiological state is essential for achieving high crop yields. Canopy temperature, reflecting the energy exchange between plant leaves and their environment, serves as an indicator of leaf water status and photosynthetic activity (Mao et al., 2025). It is closely linked to photosynthesis as elevated canopy temperature often signal water deficits or environmental stress, leading to stomatal closure, reduced stomatal conductance, and suppressed transpiration, which collectively decrease CO2 uptake and significantly reduce the photosynthetic rate (Jiang et al., 2024; Hill et al., 2014). In this study, organic fertilizers produced through different fermentation methods reduced wheat canopy temperature by an average of 4.55% and enhanced leaf Pn (Supplementary Table S2; Supplementary Figure S1), consistent with findings by Jiang et al. (2024) and Xiao et al. (2022a). High temperature negatively impacts chlorophyll stability and enzymatic activity in leaves, thereby lowering photosynthetic efficiency. In contrast, reduced canopy temperature is associated with higher leaf water content and physiological activity, greater stomatal opening, enhanced transpiration, and improved gas exchange. This allows more CO2 to be absorbed for photosynthesis, ultimately increasing photosynthetic rate and productivity. Thus, monitoring canopy temperature provides a rapid assessment of photosynthetic performance and overall plant health. Maintaining an optimal canopy temperature is not only a sign of healthy wheat development but also a fundamental physiological basis for efficient photosynthesis and high yield. Pig manure compost improves soil water retention and nutrient-holding capacity, enhancing root water and nutrient uptake, which alleviates water stress and helps keep stomata open, thereby lowering canopy temperature. Additionally, the slow and steady nutrient release from compost ensures a more stable nitrogen supply, which increases chlorophyll content and delays leaf senescence. This contributes to a higher leaf area index and sustained stomatal conductance, improving CO2 assimilation and fixation capacity, and ultimately boosting photosynthetic rate (Xiao et al., 2022b).
4.2 Soil nutrients and physical structure
Plant growth and development are strongly influenced by soil physical structure and chemical properties. Sandy fluvo-aquic soils, while well-aerated due to their loose texture, often suffer from poor water retention, leading to drought stress, nutrient leaching, and restricted root development, all of which limit crop growth and yield formation (Zhang et al., 2021a). Studies have shown that the combined application of organic and inorganic fertilizers improves soil nutrient content, enhances aggregate structure, and increases aggregate stability (Lu et al., 2024; Ren et al., 2025). In this study, pig manure compost combined with chemical fertilizers increased levels of total N, ammonium-N, nitrate-N, available P, K, and soil organic matter (Supplementary Figure S2), while also increasing the proportion of soil aggregates ≥0.25 mm(Figure 5), consistent with findings by Guo et al. (2022) and Zhang et al. (2016). During the overwintering stage, the TK treatment had higher initial nutrient levels due to its readily available nutrients. However, its weak retention capacity led to a decline in nutrient availability from green-up to heading, making it difficult to sustain wheat nutrient demands. In contrast, treatments with pig manure compost provided a stable nutrient supply throughout the growing season, particularly during the jointing stage when nutrient demand peaks and available nutrient levels in TK decline. Oorts et al. (2007) found a significant positive correlation between aggregate content/stability and soil fertility. Organic matter in compost improves colloidal capacity for nutrient adsorption, reducing nutrient loss risks. Moreover, compost enhances microbial secretion of binding agents and fungal hyphal networks, promoting the formation and stabilization of macroaggregates (Wang et al., 2024a; Tian et al., 2025). In contrast, sole application of chemical fertilizers can accelerate microbial mineralization of organic matter, leading to soil structure collapse and reduced aggregate stability (Zhang et al., 2021b). Long-term use of chemical fertilizers in paddy soils has also been linked to structural degradation, whereas organic amendments significantly enhance soil aggregate stability (Guo et al., 2019).
Both NH4+-N and NO3--N are plant-available nitrogen forms, but due to their mobility, they often leach into groundwater through irrigation or rainfall. Our results showed that NH4+-N and NO3--N were mainly concentrated in the 0–20 cm and 20–100 cm soil layers, respectively. Compared to chemical fertilizers alone, combined pig manure treatments significantly reduced NH4+-N and NO3--N levels in the 20–100 cm soil layer (Figure 4), aligning with Abbasi and Sepaskhah (2023) and Li et al. (2024b). Surface-applied nitrogen creates inorganic nitrogen-rich microzones that convert to NO3--N via nitrification. Precipitation events (e.g., snow and rain) during the growth period can then drive NO3--N downward. Hu et al. (2022) noted that chemical fertilizers increase nitrifying gene abundance, accelerating NH4+-N to NO3--N conversion, while compost fosters denitrification. Quan et al. (2016) reported that organic fertilizers can inhibit nitrification, as a high C: N ratio encourages NH4+-N immobilization, preventing NO3--N leaching. Furthermore, compost modifies soil surface charge, stimulating microbial nitrogen cycling processes that enhance NO3--N adsorption, immobilization, and assimilation, reducing vertical nitrogen loss (Wen et al., 2024; Asiloglu et al., 2021). In early wheat growth stage, nitrogen demand is low. Nitrogen from compost is adsorbed and retained in the upper soil layers, limiting downward migration. Since nitrogen leaching is mainly driven by vertical water movement, and the tested sandy soil is prone to nutrient loss, compost application promotes microbial synthesis of binding agents, reinforcing inter-particle adhesion and hydrophobicity. This promotes the formation of larger aggregates, optimizes the soil’s three-phase structure, increases porosity, and enhances water retention. Collectively, these effects limit NO3--N transport through the soil profile, maintain inorganic nitrogen in upper layers, and prevent groundwater contamination (Tian et al., 2022).
4.3 Soil enzyme activity and microbial community composition
Soil enzyme activity is a critical biological indicator of soil quality, fertility, and microecological function. These enzymes directly participate in biogeochemical cycling and nutrient transformation and are widely used to assess soil biochemical functionality and ecosystem health (Jabborova et al., 2021). Integrating organic and inorganic fertilizers is considered an effective strategy for enhancing enzyme activity and unlocking soil productivity (Zhang et al., 2022; He et al., 2020). This study shows that pig manure compost significantly increased soil enzyme activities (S-URE, S-ACP, S-DHA), with the TB treatment exhibiting the greatest enhancement (Table 3). This improvement is primarily attributed to the high organic carbon content in the compost, which provides a stable carbon source that promotes microbial growth and enzyme secretion. Additionally, the compost is rich in soluble organics and microbial metabolites that help create a favorable microecological environment, enhancing enzyme system stability and activity, thereby improving nutrient transformation and soil fertility—an essential foundation for sustainable crop productivity (Jabborova et al., 2021). Soil microorganisms, as key drivers of nutrient cycling, soil structure, and plant growth, profoundly influence agroecosystem stability and productivity (Kennedy and Smith, 1995). Studies have shown that organic fertilization can reshape microbial community structures and increase the abundance of beneficial taxa (Li et al., 2022b; Sun et al., 2024). In this study, TA3 and TB3 treatments increased bacterial and fungal α-diversity and OTU richness (Figures 6a-d), suggesting that compost not only maintains core microbial groups but also promotes the colonization and expansion of rare taxa by providing diverse carbon sources and energy substrates. This diversifies microbial niches, enhances functional redundancy, and stabilizes the community (Hartmann et al., 2015; Chen et al., 2020). However, the limited increase in Chao1 and Shannon indices may be due to the relatively short duration of organic input.
At the phylum level, the relative abundances of Proteobacteria, Actinobacteriota, Bacteroidota, and Ascomycota were significantly higher for TA3 and TB3 than other treatments (Figures 6e-f). These groups can decompose organic matter and mineralize nutrients, enhancing enzyme activities such as S-URE, S-ACP, and S-DHA, accelerating nitrogen and phosphorus cycling (Zhou et al., 2016; Lazcano et al., 2013). Compost application provided abundant carbon sources for heterotrophic microorganisms, promoting their growth and community diversity, whereas fertilizer alone was rapidly utilized by a few fast-acting microorganisms, reducing overall diversity. RDA results further indicate that microbial community changes are primarily driven by factors such as SOM, pH, AP, and NH4+-N. These environmental factors influence microbial metabolism by regulating nutrient availability and microhabitat conditions. Consequently, microbially mediated nutrient release enhances wheat nutrient accumulation, photosynthetic activity, and yield. Among treatments, the acid-regulated compost demonstrated optimal performance. This may result from its ability to promote the enrichment of beneficial microorganisms—such as actinomycetes, nitrogen-fixing bacteria, and phosphorus-solubilizing bacteria—by regulating pH during fermentation. This process enhances enzyme activity and accelerates humus formation. Upon soil incorporation, organic acids further improve the rhizosphere environment, enhance root nutrient uptake, and stabilize nutrient supply systems, thereby increasing nutrient use efficiency and yield.
By comparing natural composting, water-regulated trough composting, acid-regulated trough composting, and conventional trough composting, significant differences in nutrient supply, soil structure, enzyme activity, and microbial communities were showed among the four fermentation methods. Owing to the lack of environmental regulation and decomposes slowly, natural composting leads to a significant nutrient loss. Conventional trough composting improves decomposition conditions through aeration, but moisture and pH fluctuations still limit nutrient retention and microbial activity. Water-regulated trough composting, by stabilizing moisture content, promotes organic matter degradation and humus formation, thereby enhancing the sustained nutrient supply and soil enzyme activity (Zhou et al., 2022). In contrast, acid-regulated trough composting exhibits the best overall performance: organic acids could regulate pH, reduce nitrogen volatilization (Pan et al., 2018; Nie et al., 2020), enrich beneficial communities (Li et al., 2022), enhance urease and acid phosphatase activity, and accelerate the mineralization and transformation of nutrients (Miao et al., 2024). Furthermore, acid regulation promotes humus production and reduces the bioavailability of heavy metals (Wu et al., 2021; Li et al., 2022), significantly enhance the compost’s water and nutrient retention and slow-release properties (Cao et al., 2019). In summary, acid-regulated trough composting could significantly improve the quality and fertilizer efficiency of compost, improve the soil environment and promote crop growth, and thus is the optimal fermentation method for treating pig manure.
5 Conclusions
Compared with chemical fertilizer alone, the application of acetic acid-regulated pig manure compost combined with chemical fertilizer effectively reconstructed soil aggregate composition by increasing the proportion of ≥0.25 mm aggregates and reducing nitrogen leaching losses. It also enhanced soil enzyme activities (S-URE, S-ACP, S-DHA), improved microbial diversity, and boosted nutrient-supplying capacity. These improvements promoted nutrient uptake and accumulation in winter wheat roots, enhanced canopy photosynthetic performance, and ultimately increased yield. Among the four fermentation methods, the acid-regulated trough compost exhibited the most balanced and superior effects, as it not only minimized nitrogen loss and enhanced enzymatic activities but also promoted beneficial microbial proliferation and humus formation. Therefore, the acetic acid-regulated trough-compost combined with chemical fertilizer at a 25:75 ratio demonstrated the best overall performance, making it a promising strategy for sustainable winter wheat cultivation on sandy fluvo-aquic soils in northern Henan.
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Author contributions
MW: Conceptualization, Methodology, Visualization, Writing – original draft, Writing – review & editing. JC: Conceptualization, Methodology, Writing – original draft, Writing – review & editing. CZ: Conceptualization, Resources, Writing – review & editing. ML: Conceptualization, Resources, Writing – review & editing. YW: Data curation, Methodology, Software, Writing – review & editing. SG: Conceptualization, Validation, Writing – review & editing. GL: Methodology, Validation, Writing – review & editing. LL: Formal analysis, Methodology, Software, Visualization, Writing – review & editing.
Funding
The author(s) declare financial support was received for the research and/or publication of this article. This research was sponsored by the National Key Research and Development Program of China (2021YFD1700900), the Young Backbone Teachers Program of Henan Province (2024GGJS027), the Program for Science & Technology Innovation Talents in Universities of Henan Province (26HASTIT019), the National College Students Innovation and Entrepreneurship Training Program of Henan Agricultural University (202410466071).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2025.1711898/full#supplementary-material
References
Abbasi, M. R. and Sepaskhah, A. R. (2023). Nitrogen leaching and groundwater N contamination risk in saffron/wheat intercropping under different irrigation and soil fertilizers regimes. Sci. Rep. 13, 6587. doi: 10.1038/s41598-023-33817-5
Asiloglu, R., Kobayashi, K., Samuel, S. O., Sevilir, B., Murase, J., Suzuki, K., et al. (2021). Top-down effects of protists are greater than bottom-up effects of fertilisers on the formation of bacterial communities in a paddy field soil. Soil Biol. Biochem. 156, 108186. doi: 10.1016/j.soilbio.2021.108186
Braun, M., Mail, M., Heyse, R., and Amelung, W. (2021). Plastic in compost: Prevalence and potential input into agricultural and horticultural soils. Sci. Total Environ. 760, 143335. doi: 10.1016/j.scitotenv.2020.143335
CAGDRS, Institute of Agricultural Resources and Regional Planning, and CAAS (2024). China agriculture green development report 2024 (Beijing: China Agriculture Press).
Cambardella, C. A. and Elliott, E. T. (1993). Methods for physical separation and characterization of soil organic matter fractions. Geoderma 56, 449–457. doi: 10.1016/B978-0-444-81490-6.50036-4
Cao, Y., Wang, X., Bai, Z., Chadwick, D., Misselbrook, T., Sommer, S. G., et al. (2019). Mitigation of ammonia, nitrous oxide and methane emissions during solid waste composting with different additives: A meta-analysis. J. Clean. Prod. 235, 626–635. doi: 10.1016/j.jclepro.2019.06.288
Cheng, J. H., Tang, X. Y., and Cui, J. F. (2022). Distinct aggregate stratification of antibiotic resistome in farmland soil with long-term manure application. Sci. Total Environ. 833, 155088. doi: 10.1016/j.scitotenv.2022.155088
Chen, Q., Li, Z. L., Qu, Z. M., Qi, Y. J., Liu, Z. G., and Zhang, M. (2020). Maize yield and root morphological characteristics affected by controlled-release diammonium phosphate and Paecilomyces variotii extracts. Field Crops Res. 255, 107862. doi: 10.1016/j.fcr.2020.107862
Dang, H. Y. and Wang, Z. H. (2025). Organic fertilizer application in wheat production of China: History, bottleneck, and strategy. J. Plant Nutr. Fertil. 31, 12–31. doi: 10.11674/zwyf.2024267
Duan, C. X., Li, J. B., Wu, S. F., and Feng, H. (2024a). Effects of combined application of organic and inorganic fertilizers on nitrogen mineralization in different soil types in Northwest China. Trans. Chin. Soc Agric. Mach. 55, 344–355. doi: 10.6041/j.issn.1000-1298.2024.05.033
Duan, Y. J., Wu, H. S., Chen, G. Y., Hu, F. Y., Li, Y. H., Li, Z. W., et al. (2024b). Influence of Chinese herbal plants on greenhouse gas emissions from pig manure composting and fermentation. Int. Biodeterior. Biodegrad. 194, 105882. doi: 10.1016/j.ibiod.2024.105882
Gade, L., Scheel, C. M., Pham, C. D., Lindsley, M. D., Iqbal, N., Cleveland, A. A., et al. (2013). Detection of fungal DNA in human body fluids and tissues during a multistate outbreak of fungal meningitis and other infections. Eukaryot. Cell 12, 677–683. doi: 10.1128/EC.00046-13
Gelaye, Y. (2023). Effect of combined application of organic manure and nitrogen fertilizer rates on yield and yield components of potato: A review. Cogent Food Agric. 9, 2217603. doi: 10.1080/23311932.2023.2217603
Gong, H. R., Li, J., Ma, J. H., Hou, R. X., Zhang, X. B., and Ouyang, Z. (2019). Effects of straw incorporation combined with inorganic-organic fertilization on soil water and nitrogen changes and microbial community structure in winter wheat. Acta Ecol. Sin. 39, 2203–2214. doi: 10.5846/stxb201803190537
Gorfie, B. N., Tuhar, A. W., Keraga, A. S., and Woldeyohannes, A. B. (2022). Effect of brewery wastewater irrigation on soil characteristics and lettuce Lactuca sativa crop in Ethiopia. Agric. Water Manage. 269, 107633. doi: 10.1016/j.agwat.2022.107633
Guo, Z. L., Zhang, L. C., Yang, W., Hua, L., and Cai, C. F. (2019). Aggregate stability under long-term fertilization practices: The case of eroded Ultisols of south-central China. Sustainability 11, 1169. doi: 10.3390/su11041169
Guo, X. H., Zou, B., Xu, L. Q., Zhang, J. N., Zheng, G. P., Wang, H. Z., et al. (2022). Changes in the physical, chemical, and bacterial community characteristics of soil in response to short-term combined organic–inorganic fertilizers in a dry direct-seeded paddy field. Agronomy 12, 2808. doi: 10.3390/agronomy12112808
Hartmann, M., Frey, B., Mayer, J., Mäder, P., and Widmer, F. (2015). Distinct soil microbial diversity under long-term organic and conventional farming. ISME J. 9, 1177–1194. doi: 10.1038/ismej.2014.210
He, H., Peng, M. W., Hou, Z. A., and Li, J. H. (2023). Unlike chemical fertilizer reduction, organic fertilizer substitution increases soil organic carbon stock and soil fertility in wheat fields. J. Sci. Food Agric. 104, 2798–2808. doi: 10.1002/jsfa.13167
He, H., Peng, M. W., Lu, W. D., Hou, Z. A., and Li, J. H. (2022). Commercial organic fertilizer substitution increases wheat yield by improving soil quality. Sci. Total Environ. 851, 158132. doi: 10.1016/j.scitotenv.2022.158132
He, M., Wang, Y. C., Wang, L. G., Li, C. Q., Wang, L. M., Li, Y. H., et al. (2020). Effects of subsoiling combined with fertilization on the fractions of soil active organic carbon and soil active nitrogen, and enzyme activities in black soil in Northeast China. Acta Pedol. Sin. 57, 446–456. doi: 10.11766/trxb201810180282
Hill, K. E., Geurin, G. R., Watling, J. R., and Hill, R. S. (2014). Temperature influences stomatal density and maximum potential water loss through stomata of Dodonaea viscosa subsp. angustissima along a latitude gradient in southern Australia. Aust. J. Bot. 62, 657–665. doi: 10.1071/BT14204
Hu, X. J., Gu, H. D., Liu, J. J., Wei, D., Zhu, P., Cui, X. A., et al. (2022). Metagenomics reveals divergent functional profiles of soil carbon and nitrogen cycling under long-term addition of chemical and organic fertilizers in the black soil region. Geoderma 418, 115846. doi: 10.1016/j.geoderma.2022.115846
Hu, Y. J., Li, D. H., Wu, Y., Liu, S. Y., Li, L., Chen, W. Q., et al. (2023). Mitigating greenhouse gas emissions by replacing inorganic fertilizer with organic fertilizer in wheat–maize rotation systems in China. J. Environ. Manage. 344, 118494. doi: 10.1016/j.jenvman.2023.118494
Jabborova, D., Sayyed, R. Z., Azimov, A., Jabbarov, Z., Matchanov, A., Enakiev, Y., et al. (2021). Impact of mineral fertilizers on mineral nutrients in the ginger rhizome and on soil enzymes activities and soil properties. Saudi J. Biol. Sci. 28, 5268–5274. doi: 10.1016/j.sjbs.2021.05.037
Jiang, M., Zhang, C., Li, Y., Huang, X. M., Huang, L. F., and Huo, Z. Y. (2024). Rice canopy temperature is affected by nitrogen fertilizer. J. Integr. Agric. 23, 824–835. doi: 10.1016/j.jia.2023.05.005
Jin, N., Jin, L., Wang, S. Y., Li, J. W., Liu, F. H., Liu, Z. C., et al. (2022). Reduced chemical fertilizer combined with bio-organic fertilizer affects the soil microbial community and yield and quality of lettuce. Front. Microbiol. 13. doi: 10.3389/fmicb.2022.863325
Kennedy, A. C. and Smith, K. L. (1995). Soil microbial diversity and the sustainability of agricultural soils. Plant Soil 170, 75–86. doi: 10.1007/BF02183056
Lazcano, C., Gómez-Brandón, M., Revilla, P., and Domínguez, J. (2013). Short-term effects of organic and inorganic fertilizers on soil microbial community structure and function. Biol. Fertil. Soils 49, 723–733. doi: 10.1007/s00374-012-0761-7
Li, S., Chen, W., Liu, D., Tao, Y., Ma, H., Feng, Z., et al. (2022). Effect of superphosphate addition on heavy metals speciation and microbial communities during composting. Bioresour. Technol. 359, 127478. doi: 10.1016/j.biortech.2022.127478
Li, X. L., Fang, J. C., Shagahaleh, H., Wang, J. F., Adam Hamad, A. A., and Hamoud, Y. A. (2023a). Impacts of partial substitution of chemical fertilizer with organic fertilizer on soil organic carbon composition, enzyme activity, and grain yield in wheat–maize rotation. Life 13, 1929. doi: 10.3390/life13091929
Li, S. Y., Gu, X. H., Li, H., Li, M. H., Liu, Z. J., Xu, Z. C., et al. (2023b). Effects of phosphorus-containing additives on carbon transformation during pig manure composting. Environ. Technol. Innov. 32, 103290. doi: 10.1016/j.eti.2023.103290
Li, X. Y., Li, B., Chen, L., Liang, J. Y., Huang, R., Tang, X. Y., et al. (2022a). Partial substitution of chemical fertilizer with organic fertilizer over seven years increases yields and restores soil bacterial community diversity in wheat–rice rotation. Eur. J. Agron. 133, 126445. doi: 10.1016/j.eja.2021.126445
Li, J., Ning, J., Wang, S. Y., Li, J. W., Meng, X., Xie, Y. D., et al. (2022b). Changes in the microbial structure of the root soil and the yield of Chinese baby cabbage by chemical fertilizer reduction with bio-organic fertilizer application. Microbiol. Spectr. 10, e01215–e01222. doi: 10.1128/spectrum.01215-22
Li, T. H., Tao, S. Y., Ma, M. J., Liu, S. W., Shen, M. C., and Zhang, H. J. (2024a). Is the application of organic fertilizers becoming an undeniable source of microplastics and resistance genes in agricultural systems? Sci. Total Environ. 912, 169571. doi: 10.1016/j.scitotenv.2023.169571
Li, Y., Wei, J. L., Ma, L., Wu, X. N., Zheng, F. L., Cui, R. Z., et al. (2024b). Enhancing wheat yield through microbial organic fertilizer substitution for partial chemical fertilization: Regulation of nitrogen conversion and utilization. J. Soil Sci. Plant Nutr. 24, 935–943. doi: 10.1007/s42729-023-01597-6
Li, P., Wu, M. C., Kang, G. D., Zhu, B. J., Li, H. X., Hu, F., et al. (2020). Soil quality response to organic amendments on dryland red soil in subtropical China. Geoderma 373, 114416. doi: 10.1016/j.geoderma.2020.114416
Liang, Q., Shi, X. J., Li, N. N., Shi, F., Tian, Y., Zhang, H. X., et al. (2022). Fertilizer reduction combined with organic liquid fertilizer improved canopy structure and function and increased cotton yield. Agronomy 12, 1759. doi: 10.3390/agronomy12081759
Lu, W. D., Hao, Z. Q., Ma, X. L., Gao, J. L., Fan, X. Q., Guo, J. F., et al. (2024). Effects of different proportions of organic fertilizer replacing chemical fertilizer on soil nutrients and fertilizer utilization in gray desert soil. Agronomy 14, 228. doi: 10.3390/agronomy14010228
Mao, L., Lu, S., Liu, L. Q., Li, Z. P., Wang, B. Q., Pei, D., et al. (2025). Determining water status of walnut orchards using the crop water stress index and canopy temperature measurements. Plant Methods 21, 47. doi: 10.1186/s13007-025-01364-x
Miao, J., Yang, Z., Xu, W., Zhan, X., Ren, X., and Zhang, Z. (2024). Elucidating carbon conversion and bacterial succession by amending Fenton-like systems during co-composting of pig manure and branch. Science of the Total Environment. 904, 170279. doi: 10.1016/j.scitotenv.2024.170279
Mooshammer, M., Wanek, W., Hämmerle, I., Fuchslueger, L., Hofhansl, F., Knoltsch, A., et al. (2014). Adjustment of microbial nitrogen use efficiency to carbon:nitrogen imbalances regulates soil nitrogen cycling. Nat. Commun. 5, 3694. doi: 10.1038/ncomms4694
National Bureau of Statistics of the People’s Republic of China (2024). China statistical yearbook no. 43 (Beijing: China Statistical Publishing House). Available online at: https://www.stats.gov.cn/sj/ndsj/2024/indexch.htm (Accessed March 15, 2024).
Nie, E., Gao, D., and Zheng, G. (2020). Effects of lactic acid on modulating the ammonia emissions in co-composts of poultry litter with slaughter sludge. Bioresour. Technol. 315, 123812. doi: 10.1016/j.biortech.2020.123812
Oorts, K., Bossuyt, H., Labreuche, J., Merckx, R., and Nicolardot, B. (2007). Carbon and nitrogen stocks in relation to organic matter fractions, aggregation and pore size distribution in no-tillage and conventional tillage in northern France. Eur. J. Soil Sci. 58, 248–259. doi: 10.1111/j.1365-2389.2006.00832.x
Pan, J., Cai, H., Zhang, Z., Liu, H., Li, R., Mao, H., et al. (2018). Comparative evaluation of the use of acidic additives on sewage sludge composting quality improvement, nitrogen conservation, and greenhouse gas reduction. Bioresour. Technol. 270, 467–475. doi: 10.1016/j.biortech.2018.09.050
Qiu, Z. P., Li, M. X., Song, L. Y., Wang, C., Yang, S., Yan, Z. Y., et al. (2020). Study on nitrogen-retaining microbial agent to reduce nitrogen loss during chicken manure composting and nitrogen transformation mechanism. J. Clean. Prod. 285, 124813. doi: 10.1016/j.jclepro.2020.124813
Quan, Z., Huang, B., Lu, C. Y., Shi, Y., Chen, X., Zhang, H. Y., et al. (2016). The fate of fertilizer nitrogen in a high nitrate accumulated agricultural soil. Sci. Rep. 6, 21539. doi: 10.1038/srep21539
Ren, F. L., Sun, N., Misselbrook, T. H., Wu, L., Xu, M. G., Zhang, F. S., et al. (2022). Responses of crop productivity and reactive nitrogen losses to the application of animal manure to China’s main crops: A meta-analysis. Sci. Total Environ. 850, 158064. doi: 10.1016/j.scitotenv.2022.158064
Ren, L. J., Yang, H., Li, J., Zhang, N., Han, Y. Y., Zou, H. T., et al. (2025). Organic fertilizer enhances soil aggregate stability by altering greenhouse soil content of iron oxide and organic carbon. J. Integr. Agric. 24, 306–321. doi: 10.1016/j.jia.2024.05.026
Ripoche, A., Crétenet, M., Corbeels, M., Affholder, F., Naudin, K., Sissoko, F., et al. (2015). Cotton as an entry point for soil fertility maintenance and food crop productivity in savannah agroecosystems – Evidence from a long-term experiment in southern Mali. Field Crops Res. 177, 37–48. doi: 10.1016/j.fcr.2015.02.013
Sun, M. J., Chao, Y., He, W., Kang, X. R., Yang, Q. G., Wang, H., et al. (2022). Changes in foxtail millet (Setaria italica L.) yield, quality, and soil microbiome after replacing chemical nitrogen fertilizers with organic fertilizers. Sustainability 14, 16412. doi: 10.3390/su142416412
Sun, Q. H., Zhang, Q., Huang, Z. J., Wei, C., Li, Y. T., and Xu, H. J. (2024). Effect of organic fertilizer application on microbial community regulation and pollutant accumulation in typical red soil in south China. Agronomy 14, 2150. doi: 10.3390/agronomy14092150
Tian, L. X., Wang, Y. W., Jin, D. D., Zhou, Y. L., Mukhamed, B., Liu, D., et al. (2025). The application of biochar and organic fertilizer substitution regulates the diversities of habitat specialist bacterial communities within soil aggregates in proso millet farmland. Biochar 7, 6. doi: 10.1007/s42773-024-00398-z
Tian, S. Y., Zhu, B. J., Yin, R., Wang, M. W., Jiang, Y. J., Zhang, C. Z., et al. (2022). Organic fertilization promotes crop productivity through changes in soil aggregation. Soil Biol. Biochem. 165, 108533. doi: 10.1016/j.soilbio.2021.108533
Tweib, S. A., Rahman, R. A., and Khalil, M. S. (2014). Determination of kinetics for co-composting of organic fraction of municipal solid waste with palm oil mill sludge (POMS). J. Solid Waste Technol. Manage. 40, 136–147. doi: 10.5276/JSWTM.2014.136
Verma, H. P., Sharma, O. P., Shivran, A. C., Yadav, L. R., Yadav, R. K., Yadav, M. R., et al. (2023). Effect of irrigation schedule and organic fertilizer on wheat yield, nutrient uptake, and soil moisture in northwest India. Sustainability 15, 10204. doi: 10.3390/su151310204
Wang, Q., Awasthi, M. K., Ren, X. N., Zhao, J. C., Li, R. H., Wang, Z., et al. (2018). Combining biochar, zeolite and wood vinegar for composting of pig manure: The effect on greenhouse gas emission and nitrogen conservation. Waste Manage. 74, 221–230. doi: 10.1016/j.wasman.2018.01.015
Wang, L. X., Pang, X. Y., Li, N., Qi, K. B., Huang, J. S., and Yin, C. Y. (2020). Effects of vegetation type, fine and coarse roots on soil microbial communities and enzyme activities in eastern Tibetan Plateau. Catena 194, 104694. doi: 10.1016/j.catena.2020.104694
Wang, J., Sha, Z. M., Qin, Q., Sun, L. J., Sun, Y. F., Yang, S. Y., et al. (2024a). Soil aggregate-associated organic nitrogen pools, enzyme activities, and microbial community fertilized with food waste-derived organic fertilizer. Appl. Soil Ecol. 202, 105580–105593. doi: 10.1016/j.apsoil.2024.105580
Wang, M. T., Zeng, C., Li, S., Cai, J. M., Chu, J. Y., Zhou, M. Y., et al. (2025). Effects of combined application of swine manure compost fermented by different methods with chemical fertilizer on soil physicochemical properties and NH3 volatilization of summer maize. Chin. J. Eco-Agric. 33 (8), 1492–1505. doi: 10.12357/cjea.20240832
Wang, M. T., Zeng, C., Yang, D. X., Li, S., Wang, Z. M., Zhou, M. Y., et al. (2024b). Effects of various fermentation methods for organic fertilizer combined with chemical fertilizer on the yield, light-temperature, and nutrient absorption and accumulation characteristics of summer maize. J. Agric. Resour. Environ. 42, 968–979. doi: 10.13254/j.jare.2024.0342
Watts, D. B., Torbert, H. A., Prior, S. A., and Huluka, G. (2010). Long-term tillage and poultry litter impacts soil carbon and nitrogen mineralization and fertility. Soil Sci. Soc Am. J. 74, 1239–1247. doi: 10.2136/sssaj2008.0415
Wei, W. L., Liu, L., and Qiu, H. H. (2020). Effects of different organic resources application combined with chemical fertilizer on yield and nitrogen use efficiency of main grain crops in China. J. Plant Nutr. Fertil. 26, 1384–1394. doi: 10.11674/zwyf.19511
Wei, S., Zhu, Z. P., Zhao, J., Chadwick, D. R., and Dong, H. M. (2021). Policies and regulations for promoting manure management for sustainable livestock production in China: A review. FASE 8, 45. doi: 10.15302/J-FASE-2020369
Wen, S. L., Cui, N. B., Wang, Y. S., Gong, D. Z., Xing, L. W., Wu, Z. J., et al. (2024). Determining effect of fertilization on reactive nitrogen losses through nitrate leaching and key influencing factors in Chinese agricultural systems. Agric. Water Manage. 303, 109055. doi: 10.1016/j.agwat.2024.109055
Wu, J., Chen, W., Zhao, Z., Zhang, K., Zhan, Y., Wu, J., et al. (2021). Give priority to abiotic factor of phosphate additives for pig manure composting to reduce heavy metal risk rather than bacterial contribution. Bioresour. Technol. 341, 125894. doi: 10.1016/j.biortech.2021.125894
Wu, X., Hu, H., Li, S. J., Zhao, J. N., Li, J., Zhang, G. L., et al. (2022). Chemical fertilizer reduction with organic material amendments alters co-occurrence network patterns of bacterium–fungus–nematode communities under the wheat–maize rotation regime. Plant Soil 473, 605–623. doi: 10.1007/s11104-022-05314-7
Xiao, Z. L., Gu, H. Z., Wu, H., Jing, W. J., Zhu, K. Y., Zhang, W. Y., et al. (2022a). Effects of planting density, levels, and forms of nitrogen application on the yield and nitrogen utilization of wheat following rice in East China. Agronomy 12, 2607. doi: 10.3390/agronomy12112607
Xiao, Z. L., Wu, H., Gu, H. Z., Zhang, W. Y., Gu, J. F., Liu, L. L., et al. (2022b). Effect of different integrated cultivation modes on yield, agronomic and photosynthetic characteristics of wheat following rice stubble. J. Triticeae Crops 42, 988–1000. doi: 10.7606/j.issn.1009-1041.2022.08.09
Xing, S. K., Zhang, G. H., Wang, C. S., Zhang, N., and Chen, S. Q. (2023). Effects of straw incorporation on soil erosion resistance along a land degradation gradient in the black soil region of China. Catena 231, 107365. doi: 10.1016/j.catena.2023.107365
Xu, M. Y., Yu, B., Chen, Y., Zhou, P., Xu, X. K., Qi, W. Z., et al. (2024). Mitigating greenhouse gas emission and enhancing fermentation by phosphorus slag addition during sewage sludge composting. J. Environ. Manage. 370, 122740. doi: 10.1016/j.jenvman.2024.122740
Yan, S. C., Wu, Y., Fan, J. L., Zhang, F. C., Zheng, J., Qiang, S. C., et al. (2020). Dynamic change and accumulation of grain macronutrient N, P and K concentrations in winter wheat under different drip fertigation regimes. Field Crops Res. 250, 107767. doi: 10.1016/j.fcr.2020.107767
Yin, Z. X., Fan, S. H., Xia, W., Zhou, Y., Zhou, X., Zhang, X., et al. (2022). Response of growth, metabolism and yield of Dendrocalamopsis oldhami to long-day photoperiod and fertilizer compensation. J. For. Res. 34, 151–166. doi: 10.1007/s11676-022-01563-5
Yin, R. X., Li, L. L., Liu, H. F., Yao, J. M., Ma, C. Y., Pu, L. L., et al. (2024). Biochar, organic fertilizer, and bio-organic fertilizer improve soil fertility and tea quality. Agronomy 14, 2339. doi: 10.3390/agronomy14102339
Yin, S., Li, P., Xu, Y., Xue, L., Hao, D. R., Liu, J., et al. (2018). Logistic model-based genetic analysis for kernel filling in a maize RIL population. Euphytica 214, 1–16. doi: 10.1007/s10681-018-2162-y
Yu, Y. T., Zhang, Q., Kang, J., Xu, N. H., Zhang, Z. Y., Deng, Y., et al. (2024). Effects of organic fertilizers on plant growth and the rhizosphere microbiome. Appl. Environ. Microbiol. 90, e01719–e01723. doi: 10.1128/aem.01719-23
Yuan, J., Li, Y., Chen, S. L., Li, D. Y., Tang, H., Chadwick, D., et al. (2018). Effects of phosphogypsum, superphosphate, and dicyandiamide on gaseous emission and compost quality during sewage sludge composting. Bioresour. Technol. 270, 368–376. doi: 10.1016/j.biortech.2018.09.023
Zhang, Y. J., Gao, W., Luan, H. A., Tang, J. W., Li, R. N., Li, M. Y., et al. (2022). Effects of a decade of organic fertilizer substitution on vegeta ble yield and soil phosphorus pools, phosphatase activities, and the microbial community in a greenhouse vegetable production system. J. Integr. Agric. 21, 2119–2133. doi: 10.1016/S2095-3119(21)63715-2
Zhang, L. L., Reaihan, E., Ali, M. M., Lin, H. J., Zhang, S., Jin, S. Q., et al. (2023a). Livestock and poultry manure management from the perspective of carbon neutrality in China. FASE 10, 341–362. doi: 10.15302/J-FASE-2023509
Zhang, M. Q., Shi, A. P., Ajmal, M., Ye, L. H., and Awais, M. (2023b). Comprehensive review on agricultural waste utilization and high-temperature fermentation and composting. Biomass Convers. Biorefin. 13, 5445–5468. doi: 10.1007/s13399-021-01438-5
Zhang, Y., Wang, Y. N., E, S. Z., Su, S. M., Bai, L. Y., Wu, C. X., et al. (2021b). Long-term manure application enhances the stability of aggregates and aggregate-associated carbon by regulating soil physicochemical characteristics. Catena 203, 105342. doi: 10.1016/j.catena.2021.105342
Zhang, H., Yang, J., Zhou, J. X., Li, G. H., and Zhang, J. F. (2021a). Effects of organic and inorganic amendments on aggregation and crop yields in sandy fluvo-aquic soil. J. Plant Nutr. Fertil. 27, 791–801. doi: 10.11674/zwyf.20576
Zhang, Z. Y., Zhang, X. K., Mahamood, M. D., Zhang, S. Q., Huang, S. M., and Liang, W. J. (2016). Effect of long-term combined application of organic and inorganic fertilizers on soil nematode communities within aggregates. Sci. Rep. 6, 31118. doi: 10.1038/srep31118
Zhao, X., Zhang, Z. H., Zhao, M. S., Song, X. Y., Liu, X. W., and Zhang, X. G. (2023). The quantified and major influencing factors on spatial distribution of soil organic matter in provincial-scale farmland – A case study of Shandong Province in Eastern China. Appl. Sci. 13, 3738. doi: 10.3390/app13063738
Zhou, J., Guan, D. W., Zhou, B. K., Zhao, B. S., Ma, M. C., Qin, J., et al. (2016). Influence of 34 years of fertilization on bacterial communities in an intensively cultivated black soil in northeast China. Appl. Soil Ecol. 105, 187–195. doi: 10.1016/j.soilbio.2015.07.005
Zhou, Z., Zhang, S., Jiang, N., Xiu, W., Zhao, J., Yang, D., et al. (2022). Effects of organic fertilizer incorporation practices on crops yield, soil quality, and soil fauna feeding activity in the wheat–maize rotation system. Front. Environ. Sci. 10. doi: 10.3389/fenvs.2022.1058071
Keywords: winter wheat, fermentation method, integrated organic-inorganic fertilization, plant growth and development, soil fertility, microbial community structure
Citation: Wang M, Cai J, Zeng C, Li M, Wang Y, Geng S, Li G and Li L (2025) Effects of combined application of pig manure composts prepared using different fermentation methods with chemical fertilizer on winter wheat yield, light-thermal physiology, and soil biological characteristics. Front. Plant Sci. 16:1711898. doi: 10.3389/fpls.2025.1711898
Received: 24 September 2025; Accepted: 20 October 2025;
Published: 31 October 2025.
Edited by:
Xue Qiang Zhao, Chinese Academy of Sciences (CAS), ChinaReviewed by:
Andong Cai, Chinese Academy of Agricultural Sciences (CAAS), ChinaKailou Liu, Jiangxi Institute of Red Soil, China
Tianfu Han, Zhengzhou University, China
Copyright © 2025 Wang, Cai, Zeng, Li, Wang, Geng, Li and Li. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Lantao Li, bGlsYW50YW9AaGVuYXUuZWR1LmNu
†These authors have contributed equally to this work
Mingteng Wang1†