In the published article, there was an error in Table 2 Primer sequences and amplification profile of markers for ms3 and msw genes in peppers as published. The sequence (forward and reverse primer) of marker SPGMS1DCAPS was incorrectly published. The corrected Table 2 Primer sequences and amplification profile of markers for ms3 and msw genes in peppers appears below.
Table 2
| Name & Marker type | Chromosome; position | Forward primer | Reverse primer | Enzyme | Annealing temperature | Amplified allele size (bp) | ||
|---|---|---|---|---|---|---|---|---|
| Homozygous dominant | Heterozygous | Homozygous recessive | ||||||
| Markers for ms3 gene | ||||||||
| HPGMS2CAPs | 1:96273123 | GGTACTTTGACCCTCATAATTGG | TTGTTTGTGGTGTACGTGCT | Hpy188I | 63.0°C | 140bp | 140bp, 93bp, 47bp | 93bp, 47bp |
| HPGMS3dCAPs | 1:71574503 | GGGATGTTCAGTCTCATGT | GACTTTTTCCCGATCTCGG | Fok1 | 46.3°C | 93bp, 35bp | 128bp, 93bp, 35bp | 128bp |
| Marker for msw gene | ||||||||
| SPGMS1dCAPs | 5:32890811 | GTAGTGATTGGTATGTCCA | CGTAAGTAGAAGCTTATGA | HinfI | 50°C | – | 132bp,111bp, 21bp | 111bp, 21bp |
Primer sequences and amplification profile of markers for ms3 and msw genes in peppers.
The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Statements
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Summary
Keywords
genic male sterility, genotyping by sequencing, hot pepper, hybrid seed production, SNP, sweet pepper
Citation
Naresh P, Lin S-w, Lin C-y, Wang Y-w, Schafleitner R, Kilian A and Kumar S (2023) Corrigendum: Molecular markers associated to two non-allelic genic male sterility genes in peppers (Capsicum annuum L.). Front. Plant Sci. 14:1288072. doi: 10.3389/fpls.2023.1288072
Received
03 September 2023
Accepted
29 September 2023
Published
12 October 2023
Volume
14 - 2023
Edited and reviewed by
Jianjun Chen, University of Florida, United States
Updates
Copyright
© 2023 Naresh, Lin, Lin, Wang, Schafleitner, Kilian and Kumar.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Sanjeet Kumar, sanjeet.kumar@worldveg.org
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.