ORIGINAL RESEARCH article

Front. Plant Sci., 11 January 2023

Sec. Functional and Applied Plant Genomics

Volume 13 - 2022 | https://doi.org/10.3389/fpls.2022.1094112

Identification of major QTLs for soybean seed size and seed weight traits using a RIL population in different environments

  • 1. The State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, South China Agricultural University, Guangzhou, Guangdong, China

  • 2. The Key Laboratory of Plant Molecular Breeding of Guangdong Province, College of Agriculture, South China Agricultural University, Guangzhou, Guangdong, China

  • 3. Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou, Guangdong, China

  • 4. Rice Molecular Breeding Institute, Granlux Associated Grains, Shenzhen, Guangdong, China

Abstract

Introduction:

The seed weight of soybean [Glycine max (L.) Merr.] is one of the major traits that determine soybean yield and is closely related to seed size. However, the genetic basis of the synergistic regulation of traits related to soybean yield is unclear.

Methods:

To understand the molecular genetic basis for the formation of soybean yield traits, the present study focused on QTLs mapping for seed size and weight traits in different environments and target genes mining.

Results:

A total of 85 QTLs associated with seed size and weight traits were identified using a recombinant inbred line (RIL) population developed from Guizao1×B13 (GB13). We also detected 18 environmentally stable QTLs. Of these, qSL-3-1 was a novel QTL with a stable main effect associated with seed length. It was detected in all environments, three of which explained more than 10% of phenotypic variance (PV), with a maximum of 15.91%. In addition, qSW-20-3 was a novel QTL with a stable main effect associated with seed width, which was identified in four environments. And the amount of phenotypic variance explained (PVE) varied from 9.22 to 21.93%. Five QTL clusters associated with both seed size and seed weight were summarized by QTL cluster identification. Fifteen candidate genes that may be involved in regulating soybean seed size and weight were also screened based on gene function annotation and GO enrichment analysis.

Discussion:

The results provide a biologically basic reference for understanding the formation of soybean seed size and weight traits.

1 Introduction

Soybean is one of the globally esteemed food crops with numerous nutritionalsubstances including protein, carbohydrates, lipids, minerals, vitamins, and bioactive substances such as isoflavones, saponins, sterols and phospholipids. With its vital values in agriculture and economy, soybean plays an important role in agricultural and industrial activities such as processing food and feed and producing textiles. While the demand for soybean has been increasing globally, soybean yield enhancement is now receiving significant attention for its potential for evolving productivity.

Seed size and seed weight are quantitative traits controlled by multiple genes and constrained by environmental factors. The forming of both traits is a complex biological process (). Seed size usually measure s seed length, seed width, and seed thickness (). Many studies have been done worldwide on QTL localization of seed size and weight in soybean. In contrast, studies on QTL localization for seed size were relatively less than that for seed weight. For example, on the soybean data website SoyBase (http://www.soybase.org/) as of March 2022, the number of QTL publications are 18 on seed length, 16 on seed width, and 23 on seed thickness versus the number of QTL publications on seed weight are 300.

detected a total of 19 QTLs associated with seed shape using three RIL populations in two environments. used MAJ Multi-QTL Joint Analysis (MAJ) and composite interval mapping (CIM) for QTLs mapping. A total of 121 main QTLs were detected in the F2:3, F2:4 and F2:5 populations from the direct and reciprocal crosses of Lishuizhongzihuang with Nannong493-1. used a RIL population to detect QTLs for seed size traits in four environments. Ten QTLs controlling related traits were identified, of which five QTLs distributed on chromosomes 02, 04, 06, 13 and 16 were detected in at least two environments with PVE ranging from 3.6 to 9.4%. The results of similar studies (; ; ; ; ; ; ; ; ; ) vary form different localization methods and different genetic backgrounds

The first study on QTL localization of seed weight in bean was reported by , in which he used seed colors as the markers. With the advancement of molecular marker technology, scholars had developed various molecular markers such as restriction fragment length polymorphism (RFLP), simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) with different mapping populations to identify QTLs of soybean seed weight. In 1996, detected 6 QTLs associated with seed weight in 150 F2 populations and their 150 F2:3 lines using 91 polymorphic genetic markers including RFP, RAPD and SSR. performed a genome-wide association study (GWAS) using 309 soybean germplasm resources with 31045 SNP markers and associated QTLs related to seed weight to chromosome 04 and 19. More results from previous studies (; ; ; ; ; ; ; ; ; ; ; ; ) are not identical, but these QTLs have laid a foundation for molecular marker-assisted breeding.

In summary, most researchers use different numbers of mapping populations to detect QTL in various environments. However, studies using more mapping populations had fewer experimental settings, in contrast to studies using fewer mapping populations tended to have more experimental environments. In this study, one mapping population is used to detect QTL in six environments suggesting a higher standard for the identification of stable QTL. In addition, the QTLs localization of soybean seed size and weight traits by RIL population in different environments and the mining of main effect genes can help us to understand the biological basis of soybean yield trait forming process, which has great theoretical and practical significance in guiding the molecular design breeding and in consistently enhancing soybean yield.

2 Materials and methods

2.1 Materials and planting

GB13 RIL population, comprising 248 lines, constructed with Guizao1 as the female parent and B13 as the male parent was planted on three replications in July 2018, July 2019 and July 2020 at the Teaching and Research Base of Zengcheng (23°14´N, 113°38´E), and in July 2019 and July 2020 at the Experimental Teaching Base of Guangzhou (23°10´N, 113°22´E) (designated as 18ZC, 19ZC, 20ZC, 19GZ and 20GZ, respectively). In addition, one F1 and 248 F8:11 RILs of the GB13 RIL population were developed using the single seed descent method (). The experimental materials were planted in a completely randomized zonal design with one row per strain, a row length of 2.0 m, a row spacing of 0.5 m, and a plant spacing of 0.1 m. Field management was carried out according to conventional standards, and no pest or disease outbreaks occurred during growth.

2.2 Phenotypic statistics and analysis

Seed length (SL), seed width (SW) and seed thickness (ST) of soybean seeds were measured using an electronic vernier caliper (Figure 1). Twenty seeds from each strain were randomly selected for seed size measurement, after which they were weighed on an electronic balance. After three repetitions, five times the average of the weights were used as phenotypic data for the seed weight trait (100-seed weight, HSW).

Figure 1

The mean of the phenotypic data from the GB13 RIL population in five natural environments was calculated as the phenotypic data of the sixth environment (combined environment, designated as CE). Descriptive statistics, linear regression analysis and calculation of the skewness and the kurtosis were performed on phenotypic data from six environments using GraphPad Prism software (GraphPad Software Inc. v.7.0.4, United States), and the corresponding tables or figures were generated. Analysis of variance (ANOVA) and estimation of broad-sense heritability (h2) were performed on phenotypic data from the five natural environments using Genstat 12th Edition software. The formulae (; ) were as follows:

where σ2g denotes genotype variance, σ2ge denotes genotype × environment interaction variance, and σ2e denotes variance error. “n” denotes the number of environments, and “r” denotes the number of replicates per environment.

2.3 QTL localization for seed size and weight traits and analysis

The composite interval mapping method () was used to map QTLs with a high-density bin linkage map previously constructed in the laboratory, as described, the map contained 56,561 SNPs and 3715 bin markers covering a total genome length of 3049.2 cM, with the length of the linkage cluster ranging from 120.22-211.37 cM, The average distance between markers was 0.80 cM, and the number of bin markers on each cluster varied from 147 to 259. (). The additive effect (ADD) and PVE of each QTL were analyzed by the WinQTLCart 2.5 software. The threshold of LOD for different traits was set to 2.5 at the 5% significance level, and LOD thresholds greater than 2.5 were considered as the basis for determining the presence of QTLs. QTLs located on the same chromosome with adjacent marker intervals were combined into one QTL if their confidence intervals overlapped. QTLs were named according to “q + trait + chromosome + sequence number”, with the symbol “-” in between ().

2.4 Stable QTLs and QTL clusters identification

Generally, QTLs detected in at least two environments were considered stable QTLs (), but there were six experimental environments in this study, so QTLs detected in at least three environments were considered as stable QTLs in this study to identify the stable QTLs.

All QTLs were sorted by chromosome as the primary condition and physical position as the secondary condition. QTLs with identical chromosomes in overlapping or adjacent physical position (less than 5cM) were grouped into a cluster and identified as QTL cluster if it was associated with at least two traits (; ). To mine the main effect and stable candidate genes, the identified QTL clusters contain at least one stable QTL in this study.

2.5 Candidate gene prediction

First, GO (Gene Ontology) term enrichment analysis was performed for the genes within the interval of the identified QTL clusters. This is useful for selecting candidate genes based on the sequence variation of genes between the parents. The GO annotation numbers were downloaded from the soybean data website SoyBase (https://www.soybase.org/), and then the WEGO2.0 online gene enrichment analysis mapping web page (http://wego.genomics.org.cn/) was used to create the gene enrichment cellular composition, molecular function and biological processes visualization diagrams. Next, genes that were highly or specifically expressed in soybean seeds were to be further screened. Gene expression data were obtained from the soybean data website SoyBase. Finally, the selected genes were functionally annotated by the Phytozome database (https://phytozome-next.jgi.doe.gov/), and then the candidate genes were identified based on the relevant literature and related gene functions. Meanwhile, the heat map of candidate genes expression was employed to analyze tissue-specific expression () by the online site (https://www.omicshare.com/tools/Home/Soft/heatmap), and the structures of candidate genes were mapped using the online site of the Gene Structure Display Server (http://gsds.gao-lab.org/index.php). The resequencing data of the parental lines were referred to compare the variation of candidate genes between parental lines. The whole genome of parental lines were sequenced using the Illumina HiSeq X Ten p, with an average sequencing depth of 8× (). High-quality sequencing data were assessed to predict the gene structural variations.

3 Result

3.1 Correlation analysis between seed size and seed weight

The regression linear analysis of seed size with seed weight shows that the SL, SW and ST were all highly significantly and positively correlated with HSW (p<0.01), with R-Squared (R2) of regression linear analysis ranging from 0.440 to 0.804 (Figure 2). In 18ZC, 19ZC, 19GZ, 20ZC and CE, the R2 between SW and HSW were the highest at 0.804, 0.721, 0.753, 0.552 and 0.742, respectively, while in 20GZ, the R2 between ST and HSW was the highest at 0.754. Thus, seed size is indeed closely related to seed weight. 18ZC, 19ZC and CE had the next largest R2 between SL and HSW at 0.685, 0.680 and 0.614, respectively and the smallest R2 between ST and HSW at 0.679, 0.626 and 0.588, respectively. 19GZ and 20ZC had the next largest R2 between ST and HSW at 0.713 and 0.467, and the smallest R2 between SL and HSW at 0.664 and 0.440. 20GZ had the next largest R2 between SL and HSW at 0.721, and the smallest R2 between SW and HSW at 0.717. Also, the above results suggest that the correlation between seed size and seed weight seems to be applied in field selection breeding as a reference for selecting high-yielding varieties.

Figure 2

3.2 Descriptive statistics analysis of seed size and weight traits

The phenotypic data were analyzed by descriptive statistics, and the results showed that the SL, SW, ST (Supplementary Figure 1) and HSW of the female parent Guizao1 were higher than those of the male parent B13 with significant differences (Table 1), which laid the foundation for QTL mapping. The GB13 RIL population differed remarkably insize and weight traits, both of which showed transgressive segregation. The coefficient of variation (CV) for SL ranged from 4.33 to 5.25%, for SW from 3.96 to 4.78%, for ST from 4.71 to 5.18%, and for HSW from 10.68 to 12.98%. The CV for HSW was greater than that for SL, SW and ST, but they were relatively stable, which indicated that both parents contained genes that were acting in the phenotypic variation.

Table 1

Trait#Env.aParentsbRILse
Guizao1cB13dRangefMeangSDhCV (%)iSkew.jKurt.k
SL18ZC8.34 ± 0.027.40 ± 0.016.66-9.017.770.415.250.12-0.20
19GZ7.40 ± 0.026.90 ± 0.026.08-8.447.400.385.15-0.190.66
19ZC7.40 ± 0.026.68 ± 0.026.52-8.217.270.324.330.32-0.20
20GZ7.61 ± 0.016.86 ± 0.036.48-8.467.350.375.040.200.03
20ZC7.87 ± 0.036.85 ± 0.016.29-8.177.300.354.82-0.35-0.20
CE7.72 ± 0.076.94 ± 0.056.64-8.237.420.283.800.07-0.03
SW18ZC6.65 ± 0.016.24 ± 0.015.59-7.436.460.294.44-0.170.40
19GZ5.99 ± 0.025.84 ± 0.055.35-7.186.180.304.78-0.010.22
19ZC6.02 ± 0.025.77 ± 0.025.65-7.186.200.253.960.310.46
20GZ5.97 ± 0.016.08 ± 0.025.37-6.956.180.284.55-0.12-0.23
20ZC6.10 ± 0.025.68 ± 0.035.37-6.756.050.274.50-0.01-0.27
CE6.34 ± 0.116.19 ± 0.085.66-6.856.210.213.390.14-0.21
ST18ZC5.53 ± 0.015.22 ± 0.014.65-6.115.490.264.79-0.220.07
19GZ5.17 ± 0.024.84 ± 0.044.28-5.905.240.254.83-0.230.60
19ZC5.12 ± 0.014.90 ± 0.014.75-5.905.300.244.490.01-0.47
20GZ5.11 ± 0.015.06 ± 0.014.52-5.885.230.275.18-0.14-0.39
20ZC5.22 ± 0.014.88 ± 0.024.61-5.815.120.244.710.25-0.20
CE5.16 ± 0.015.05 ± 0.054.76-5.755.270.183.39-0.10-0.06
HSW18ZC18.85 ± 0.116.32 ± 0.0612.05-26.2218.882.4512.980.140.28
19GZ15.35 ± 0.1912.90 ± 0.249.45-21.8016.091.9111.890.020.61
19ZC14.97 ± 0.0612.32 ± 0.0512.00-21.6315.771.6810.680.290.02
20GZ15.40 ± 0.0513.27 ± 0.1311.70-21.1716.082.0112.520.14-0.65
20ZC17.30 ± 0.1213.02 ± 0.0911.43-20.0314.961.7511.710.31-0.17
CE16.37 ± 0.3014.14 ± 0.5112.70-20.7016.351.418.620.15-0.34

Statistical analysis ofseed size and weight traits for the parents and the lines at different environments.

#Seed length (SL), seed width (SW), seed thickness (ST) and 100-seed weight (HSW).

a

Environment.

b

Parents of GB13 RIL population.

c

Female parent of GB13 RIL population.

d

Male parent of GB13 RIL population.

e

Recombinant inbred lines.

f

Range of seed size and 100-seed weight for GB13 RIL population.

g

Mean of seed size and 100-seed weight for GB13 RIL population.

h

Standard deviation.

i

Coefficient of variation.

j

Skewness.

k

Kurtosis.

The absolute values of the skewness and the kurtosis of SL, SW, ST and HSW of the GB13 RIL population were less than 1 (Table 1). In addition, the frequency distribution graph (Figure 3) showed that the phenotypic data of seed size and weight traits displayed continuous variation. The above results indicated that seed size and weight traits of the GB13 RIL population obeyed normal distribution, which was consistent with the characteristics of the RIL population and belonged to quantitative genetic traits.

Figure 3

3.3 Analysis of variance and estimates of broad-sense heritability

The results of ANOVA for SL, SW, ST and HSW of the GB13 RIL population in five natural environments (Table 2) show that the genotype, environment and interaction between genotype and environment had significant effects on seed size and weight traits of the GB13 RIL population (p<0.0001). The h2 for seed size and weight traits of the GB13 RIL population were relatively high ranging from 0.74 to 0.83 (Table 2). The traits are suitable for further QTL localization analysis.

Table 2

Trait#SourcesaDfbSScMSdP valueeVCfPV (%)gh² (%)h
SLRepeat20.740.37<0.00010.83
Genotype247294.111.19<0.00010.0746.49
Environment4123.4230.86<0.00010.0419.51
Interaction988200.950.20<0.00010.0731.77
Error247813.380.01
Total variation3719632.59
SWRepeat21.090.54<0.00010.82
Genotype247164.870.67<0.00010.0445.42
Environment466.0516.51<0.00010.0218.19
Interaction988119.220.12<0.00010.0432.84
Error247811.800.01
Total variation3719363.04
STRepeat21.090.54<0.00010.74
Genotype247118.510.48<0.00010.0238.23
Environment454.3413.58<0.00010.0217.53
Interaction988124.300.13<0.00010.0440.1
Error247811.720.01
Total variation3719309.96
HSWRepeat245.0022.50<0.00010.75
Genotype2477210.1729.19<0.00011.4633.32
Environment46645.421661.36<0.00012.2230.71
Interaction9887256.287.34<0.00012.3833.54
Error2478479.530.19
Total variation371921636.40

Analysis of variance and broad-sense heritability for GB13 RIL population at five natural environments.

# Seed length (SL), seed width (SW), seed thickness (ST) and 100-seed weight (HSW).

a

Sources of variation.

b

Degree of freedom.

c

Sum of deviation squares.

d

mean square.

e

The P value of the F-test (joint hypotheses test).

f

Variance components for different sources of variation.

g

Proportion of variation.

h

Broad-sense heritability.

In terms of the proportion of total variation accounted for variation of different sources (Table 2), the largest source of variation in SL and SW was genotype, while the largest source of variation in ST and HSW was genotype × environment interactions. The most influenced by the environment was HSW, accounted for 30.71% of the total variation. It was followed by SL, SW and ST, which accounting for 19.51%, 18.19% and 17.53% of the total variation, respectively. The above results indicated that the seed weight trait was more influenced by the environment compared to the seed size trait.

3.4 Identification of stable QTL for seed size and weight traits

A total of 85 QTL were detected for seed size and weight in six environments with PVE in the range of 3.14% - 21.93%, of which 19 QTLs were identified for SL, 23 for SW, 18 for ST, and 25 for HSW (Supplementary Tables 14). By collation and analysis, a total of 18 stable QTLs were identified (Table 3), including 3 for SL, 6 for SW, 4 for ST, and 5 for HSW (Figure 4). One QTL, qSL-3-1, associated with SL was detected in all environments, and it explained more than 10% of PV in three environments in the range of 11.93% - 15.91%. Three QTLs (qHSW-11-3, qHSW-20-3 and qSW-20-3) were detected in four environments. Among them, qSW-20-3 explained 9.22%, 10.79%, 20.89% and 21.93% of PV in four environments, respectively. Another 14 QTLs distributed on chromosomes 03, 04, 05, 07, 11, 12, 13, 18 and 20 were detected in three environments. In summary, integrating the PVE for QTL, the number of detections in various environments, and the relevant references, qSL-3-1 and qSW-20-3 can be considered as novel stable QTL with the main effects. Meanwhile, these stable QTLs above were important references for the excavation of genes controlling seed size and weight traits.

Table 3

QTL#ChraIntervalPosition
(cM)
PVE (%)hLODiADDj
E1bE2cE3dE4eE5fE6gE1E2E3E4E5E6E1E2E3E4E5E6
qSL-3-13bin32-bin4343.113.576.0311.934.386.6115.919.374.037.493.154.6111.450.150.090.110.080.090.11
qSL-3-23bin51-bin5549.412.159.0714.567.636.4210.380.110.110.11
qHSW-3-23bin53-bin5550.15.124.416.813.683.205.430.380.370.37
qHSW-4-24bin75-bin7857.55.344.685.283.753.254.180.590.370.33
qST-4-34bin77-bin8365.24.868.616.103.185.444.700.060.080.04
qST-5-25bin155-bin158135.14.674.523.693.063.132.89-0.06-0.06-0.04
qST-7-17bin159-bin161139.93.855.756.992.694.065.370.050.060.05
qSW-11-111bin95-bin1001013.897.486.342.905.235.14-0.06-0.08-0.05
qHSW-11-311bin131-bin134133.14.908.263.334.412.995.762.563.410.420.590.320.31
qSW-12-212bin103-bin109111.15.793.695.394.372.834.360.060.050.05
qHSW-13-113bin115-bin11690.04.345.197.212.913.795.690.390.400.38
qSL-13-113bin115-bin117903.474.124.472.553.033.540.080.070.06
qST-13-313bin143-bin149104.65.095.524.563.273.743.500.060.060.04
qSW-18-118bin237-bin239152.45.624.913.914.033.723.240.070.050.04
qSW-20-220bin46-bin4949.17.4611.808.645.308.296.24-0.08-0.10-0.07
qSW-20-320bin64-bin6855.39.2210.7921.9320.896.637.8915.0415.24-0.09-0.10-0.08-0.14-0.10
qHSW-20-320bin68-bin7355.96.123.314.687.214.062.523.425.70-0.47-0.31-0.38-0.38
qSW-20-420bin84-bin8664.23.807.305.812.654.563.86-0.05-0.09-0.05

Stable QTLs associated withseed size and weight traits for GB13 RIL population across different environments.

#The name of each QTL. aChromosome. bat Zengcheng in 2018. cat Guangzhou in 2019. dat Zengcheng in 2019. eat Guangzhou in 2020. fat Zengcheng in 2020. gCombined environment. hPhenotypic variation explained. iLog of odd value. jAdditive effect.

Figure 4

3.5 Identification of QTL clusters

According to the classification criteria of QTL clusters, we obtained five QTL clusters (Table 4) from the QTL mapping results (Supplementary Tables 14). These five QTL clusters were distributed on chromosomes 03, 04, 13 and 20. All of them were associated with HSW, which verified that the seed size was closely related to HSW from another aspect. The four QTL clusters related to SL were qLH3-1, qLH3-2, qLWTH4 and qLH13; the two QTL clusters related to SW were qLWTP4 and qWTH20; the two QTL clusters related to ST were qLWTP4 and qWTP20. In terms of the number of traits controlled, one QTL cluster for four traits was qLWTP4, one QTL cluster for three traits was qWTH20, and three QTL clusters for two traits were qLH3-1, qLH3-2, and qLH13. Among them, qLP3-1 and qLP3-2 containing major and stable QTL(s) were located on the forearm of chromosome 03 at the physical positions between 4387438 and 6456915 bp and between 8784766 and 17199876 bp, respectively. Similarly, qWTH20 also contained major and stable QTLs and was located at the physical position of chromosome 20 between 12056958 and 33222868 bp.

Table 4

ClustersChraIntervalPosition(bp)QTLsbADDcPVE(%)dEnv.e
qLH3-13bin32-bin434387438-6456915qSL-3-10.1513.5718ZC
0.096.0319GZ
0.1111.9319ZC
0.084.3820GZ
0.096.6120ZC
0.1115.91CE
qHSW-3-10.333.7719ZC
0.356.07CE
qLH3-23bin51-bin558784766-17199876qSL-3-20.1112.1519ZC
0.119.0720ZC
0.1114.56CE
qHSW-3-20.385.1219ZC
0.374.4120ZC
0.376.81CE
qLWTH44bin74-bin839040807-12316836qSL-4-20.064.36CE
qSW-4-20.063.7818ZC
0.043.70CE
qST-4-30.064.8618ZC
0.088.6119GZ
0.046.10CE
qHSW-4-20.595.3418ZC
0.374.6819ZC
0.335.28CE
qLH1313bin115-bin11727473391-27671175qSL-13-10.083.4718ZC
0.074.1220ZC
0.064.47CE
qHSW-13-10.394.3419GZ
0.405.1920ZC
0.387.21CE
qWTH2020bin64-bin7327890104-33222868qSW-20-3-0.099.2218ZC
-0.0810.7919ZC
-0.1421.9320ZC
-0.1020.89CE
qST-20-2-0.057.55CE
qHSW-20-3-0.476.1219GZ
-0.313.3119ZC
-0.384.6820ZC
-0.387.21CE

QTL clusters associated with at least two traits.

aChromosome. bIndivadual QTLs of cluster. cAdditive effect. dPhenotypic variation explained. eEnvironment.

In summary, qLP3-1, qLP3-2 and qWTH20 may be QTL clusters containing major effect genes that regulate soybean seed size and weight traits; qLWTP4 and qLP13 may be QTL clusters containing micro-effector genes that harmonize the control of soybean seed size and weight traits. Therefore, these five QTL clusters can provide a reference for mining the target genes controlling seed size and weight traits, and were used as the target intervals for gene GO enrichment analysis.

3.6 Gene GO enrichment analysis

By Gene GO enrichment analysis, we found that most of the genes within these five QTL cluster intervals were involved in cellular processes and metabolic processes (Figure 5). Most of the genes in the qLP3-1 were involved in intracellular metabolic processes, bioregulation and reaction to stimuli, and were mostly involved in binding and catalytic activities in terms of molecular functions. While most of the genes in the qLP3-2 were similar in function to those in the qLP3-1. In comparison, most of the genes in the qLWTP4 were also involved in intracellular metabolic processes, but a small number of genes were involved in regulating growth and cell proliferation. The qLP13 contained only 11 annotated genes, most of which were involved in growth and cellular processes. Similarly, most of the genes in the qWTP20-2 were involved in intracellular metabolic processes.

Figure 5

3.7 Candidate genes in QTL clusters

Through the above gene GO enrichment analysis, followed by gene expression screening, gene function annotation, and sequence variation analysis, we obtained a total of 15 candidate genes (Table 5) that might be participating in the regulation of seed size and weight traits. Among them, six genes were located on chromosome 03, three on chromosome 04, two on chromosome 13, and four on chromosome 20. Among the 15 genes screened, Glyma.03g040400 was the gene with the same function as the gene (LOC_Os07g19000) associated with seed size in rice; Glyma.03g045400 and Glyma.20g084000 were related to DNA methylation; Glyma.04g100400, Glyma.20g081600 and Glyma.20g087000 were hormone-related and might be involved in the regulation of seed size and weight traits by hormone signaling pathway; Glyma.04g100100, Glyma.04g107100, Glyma.13g159500 and Glyma.20g084500 might negatively regulate seed size and weight through the ubiquitin-proteasome pathway. Glyma.03g036600 and Glyma.03g065700 were associated with transcription factor regulation and might be involved in the regulation of seed size and weight traits through the transcription factor regulation pathway; Glyma.03g044200, Glyma.03g065900 and Glyma.13g160400 might be related to the metabolic synthesis of protein and oil, and indirectly regulated the seed size and weight traits.

Table 5

GenePosition (bp)Gene functional annotation
Glyma.03g0366004432910-4435002Negative regulation of transcription; organ development; lipid transport calmodulin binding
Glyma.03g0404005050463-5052307Protease inhibitors (LTP family); Seed storage
Glyma.03g0442005586338-5589780Transporter protein activity; integral to membrane
Glyma.03g0454005760642-5763461Metabolic process; methyltransferase activity
Glyma.03g06570011896538-11909845Regulation of transcription; sequence-specific DNA binding transcription factor activity; DNA-dependent
Glyma.03g06590012064850-12067709Metabolic process; hydrolase activity; catalytic activity
Glyma.04g1001009177207-9180239Negative regulation of gene expression; response to abscisic acid stimulus; ubiquitin-protein ligase activity
Glyma.04g1004009219564-9221412Sterol biosynthetic process; response to oleuropein lactone stimulus
Glyma.04g10710011239281-11250948Regulation of meristem growth; Ubiquitin ligases are involved in synaptic protein degradation
Glyma.13g15950027476780-27479031Ubiquitin system components suggestive of protein; cell growth; cell morphogenesis
Glyma.13g16040027606020-27608359Lipid transport; lipid binding; Hydrophobic protein
Glyma.20g08160030778586-30779164Regulation of gene expression; response to auxin stimulus; protein binding
Glyma.20g08400031536334-31538924RNA methylation; RNA processing
Glyma.20g08450031666190-31674959Ubiquitin-protein ligase activity; protein ubiquitination; CUL4-RING ubiquitin ligase complex
Glyma.20g08700032527435-32530216Negative regulation of ethylene mediated signaling pathway; regulation of transcription; ethylene binding

Candidate genes identified within the five QTL clusters that were highly expressed or specific expression in soybean seed.

The expression heat map (Figure 6A) of these 15 candidate genes showed that two genes each were highly expressed in young leaf and nodule of soybean; three genes were specifically expressed at the pod shell development stage in soybean; eight genes including Glyma.03g036600, Glyma.03g040400, Glyma.03g045400, Glyma.03g065700, Glyma.03g065900, Glyma.04g100400, Glyma.04g107100 and Glyma.20g087000 were specifically and progressively expressed at the seed maturity stage in soybean. Meanwhile, the structural maps for most of the candidate genes (Figure 6B) were matched with their sequence in the parental lines, but ten candidate genes varied in the sequence of the parental lines, with the variant region on introns, 3’UTR (untranslated region) and 5’UTR (Table 6). They are Glyma.03g036600, Glyma.03g040400, Glyma.03g044200, Glyma.03g045400, Glyma.03g065700, Glyma.04g100100, Glyma.04g107100, Glyma.13g160400, Glyma.20g084000 and Glyma.20g084500, and deserve to be investigated in depth.

Figure 6

Table 6

GeneChraLoci(bp)bGuizao1cB13dRegione
Glyma.03g03660034433324TTAUTR3
Glyma.03g04040035051148AACGintronic
35051173AATCACCintronic
35051386TTCintronic
35052301GGATUTR3
Glyma.03g04420035588615TCATintronic
35588681AAACAintronic
35588699AACAintronic
Glyma.03g04540035760781TTTCUTR3
35760989TGTUTR3
35761009AAAAAACAAGAGUTR3
35761114AACTCTCAUTR3
35763119TTATGUTR5
Glyma.03g065700311907032GGAUTR3
Glyma.03g0659003NANANANA
Glyma.04g10010049179539GGAAAACAAAACUTR5
Glyma.04g1004004NANANANA
Glyma.04g107100411246102GAGintronic
Glyma.13g15950013NANANANA
Glyma.13g1604001327607021TATUTR3
Glyma.20g08160020NANANANA
Glyma.20g0840002031536882AAAAAACCCTACATCTTCATintronic
2031537182ATTAintronic
2031537333TTATintronic
2031537718AAGAATCAATGTCATTintronic
2031538735TTATUTR3
Glyma.20g0845002031666328GTCAGUTR3
2031669438AAACintronic
2031673766TCGTintronic
2031674346TTAAintronic
2031674567TTAintronic
Glyma.20g08700020NANANANA

Sequence variations between the parental lines of candidate genes.

a

Chromosome.

b

Positions with variation in genes between parental lines.

c

Female parent of GB13 RIL population.

d

Male parent of GB13 RIL population.

e

Region of variation in genes.

4 Discussion

Based on the results of the correlation analysis between seed size and seed weight in this study, the R2 between seed width and seed weight was the largest in most environments, so we suggest that varieties with wide seeds can be selected for varietal improvement for soybean seed weight trait. However, from the results of the QTLs localized for soybean seed size and weight traits, most of the QTLs for HSW overlapped or were close to the QTL interval for SL. It suggests that most of the genes with multi-effects may be genes that coordinate the control on both SL and HSW. Nevertheless, the specific regulatory mechanism is still unclear () and needs to be further investigated.

In this study, a total of 60 QTLs related to seed size trait and 25 QTLs related to seed weight trait were identified in the GB13 RIL population in five natural environments and their combined environment. Nineteen QTLs for SL included 4 stable QTLs and 15 sensitive QTLs (Supplementary Table 1); 23 QTLs for seed width included 6 stable QTLs and 17 sensitive QTLs (Supplementary Table 2); 18 QTLs for ST included 5 stable QTLs and 13 sensitive QTLs (Supplementary Table 3). The 25 QTLs associated with HSW included 5 stable QTLs and 20 sensitive QTLs (Supplementary Table 4). By comparing the results with those of previous studies, ten sensitive QTLs for SL (qSL-2-1, qSL-3-3, qSL-4-1, qSL-4-2, qSL-4-3, qSL-6-2, qSL-11-1, qSL-11-2, qSL-18-2 and qSL-20-1) overlapped with the intervals of previous localization results or were within their subsets (; ; ; ; ; ; ). Eight sensitive QTLs for SW (qSW-2-1, qSW-2-2, qSW-4-1, qSW-9-1, qSW-10-1, qSW-15-1, qSW-20-1, and qSW-20-5) overlap with or were within a subset of the previous localization result intervals (; ; ; ). Five sensitive QTLs for ST (qST-4-4, qST-5-2, qST-6-1, qST-13-1 and qST-20-3) overlapped with or included the intervals of previous localization results (; ; ). Five sensitive QTLs for HSW (qHSW-4-3, qHSW-13-2, qHSW-17-2, qHSW-20-1, and qHSW-20-5) were found to have regions of overlap with the localization results of previous studies (; ; ; ). Overall, the results of the present study correlated well with those of previous studies.

Besides, comparing the localization results of seed size traits in this study with the results of other related trait localization studies, eight QTLs (qSL-4-1, qSL-17-1, qSL-20-1, qSW-12-2, qSW-15-2, qSW-17-1, qST-13-3, qST-20-1) were found to overlap or interval overlap with QTLs related to yield traits from previous studies (; ; ; ; ; ). Fifteen QTLs (qSL-6-2, qSL-13-1, qSL-17-1, qSL-18-1, qSL-20-1, qSW-11-1, qSW-12-1, qSW-12-2, qSW-20-2, qSW-20-3, qST-5-2, qST-13-1, qST-13-3, qST20-1, qST-20-2) overlapped QTLs associated with traits related to protein, oil and fatty acids (; ; ; ; ; ; ; ; ; ; ; ). Five QTLs (qSW-15-1, qSW-15-3, qSW-18-2, qST-4-1 and qSW-5-2) had overlapping intervals with QTLs related to seed-set of pod number and soybean maturity (; ). Two QTLs (qSL-5-1 and qST-5-2) had interval overlapping with isoflavonoid-related QTLs (; ). The qSW-4-1 overlapped with the QTLs associated with the long juvenility (). Researchers sometimes studied the seed weight of soybean for QTLs mapping in collaboration with protein and oil content (; ; ; ; ; ). In this study, qHSW-13-1, qHSW-15-1, qHSW-17-2, qHSW-20-2 and the stable QTL qHSW-20-3 had overlap intervals with QTLs related to protein or oil content studied previously (; ; ; ; ). Besides, qHSW-15-1 and qHSW-17-1 also had overlap intervals with yield-related QTL studied previously (; ). In summary, many QTLs with stable main effects related to seed size and weight traits in this study were consistent with previous studies results and correlated with QTLs related to other traits including protein, oil content, pod number, yield, maturity, and long juvenile stage. Thus, we suggest that genes regulating soybean seed size and weight traits may be correlated with genes regulating other traits, especially protein and oil content, so genes regulating the synthesis or metabolism of protein and oil content were also used as the basis for candidate gene speculation in this study.

In addition, compared with soybean, rice (Oryza sativa L.) has been studied much more intensively than soybean in terms of its seed size and weight. Currently, genes associated with seed size and weight, such as GW2 (), OsGRF4 (), GS3 (), qSW5 (), GW5 (), qGL3 (), LGY3 (), GS5 (), GS6 (), GLW7 (), etc., have been cloned. Furthermore, the regulatory pathways of the genes mainly include the ubiquitin-proteasome pathway, G protein signaling pathway, Mitogen-activated protein kinases (MAPK) signaling pathway, hormone signaling pathway and transcription factor regulatory pathway, etc. (). Among them, in the ubiquitin-proteasome pathway, E3 ubiquitin ligase plays a major role and negatively regulates seed width and seed weight (). In the hormone signaling pathway, Brassinolide (BR) and Auxin (IAA) can promote cell growth and expansion (), it mainly regulates glume development to positively regulate seed size in rice (). Therefore, in this study, candidate genes were selected and predicted by screening genes within five clusters based on their specific expression in soybean, combined with homologous or identical functions of genes related to grain size and weight traits in rice.

The major and stable QTL, qSW-20-3, which was detected in four environments with PVE varied from 9.22 to 21.93%, was contained in the qWTP20-2 cluster. By the analysis of sequence variation, we found that among the candidate genes within this QTL interval, only Glyma.20g084000 and Glyma.20g084500 were different in the sequence of the parental lines. They were not specifically expressed at the seed maturation stage in soybean, moreover, they have a negative additive effect, but they were associated with RNA methylation and protein ubiquitination, respectively. Therefore, we speculate that the genes within this cluster may indirectly regulate seed size and weight by regulating other traits. While another major and stable QTL, qSL-3-1, which was detected in six environments with PVE varied from 4.38 to 15.91%, was contained in the qLP3-1 cluster. Comparing the sequence variation between parental lines for candidate genes within this cluster, we found that five genes underwent natural variation between parental lines, and all of them were specifically and highly expressed at the seed maturation stage in soybean. Moreover, they have a positive additive effect. Therefore, we speculate that the five candidate genes within the qLP3-1 cluster regulate seed size and weight positively through certain pathways based on their gene annotation. However, the exact signaling pathway remains to be further investigated.

It is important to study the molecular regulatory network of yield-related traits in soybean. And the loci and candidate genes in this study provide an important theoretical basis and genetic resources for solving the bottleneck problem of soybean yield, which deserves to be further investigated at the molecular level.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding authors.

Author contributions

YC and SL designed the project. SL performed the experiments and drafted the manuscript. RL, ZG, BC, and FL helped the experiment to obtain part of the data. JJ and RW revised the manuscript. SL and QX analyzed the data. HN and ZC validated the manuscripts.

Funding

This work was supported by the Key-Areas Research and Development Program of Guangdong Province (2020B020220008), the China Agricultural Research System (CARS-04-PS09), the Guangdong Agricultural Research System (2022KJ136), and the Research Project of the State Key Laboratory of Agricultural and Biological Resources Protection and Utilization in Subtropics.

Acknowledgments

We thank Prof. Liangfa Ge (South China Agricultural University, Guangzhou, China) for critical reading and comments on the manuscript and Long Xiao (Perkins&Will, Vancouver, BC) for constructive suggestions on the language of the manuscript.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2022.1094112/full#supplementary-material

References

  • 1

    BachlavaE.DeweyR. E.BurtonJ. W.CardinalA. J. (2009). Mapping and comparison of quantitative trait loci for oleic acid seed content in two segregating soybean populations. Crop Sci.49 (2), 433442. doi: 10.2135/cropsci2008.06.0324

  • 2

    CaiZ.ChengY.MaZ.LiuX.MaQ.XiaQ.et al. (2018). Fine-mapping of QTLs for individual and total isoflavone content in soybean (Glycine max l.) using a high-density genetic map. Theor. Appl. Genet.131 (3), 555568. doi: 10.1007/s00122-017-3018-x

  • 3

    ChapmanA.PantaloneV. R.UstunA.AllenF. L.Landau-EllisD.TrigianoR. N.et al. (2003). Quantitative trait loci for agronomic and seed quality traits in an F2 and F4:6 soybean population. Euphytica.129 (3), 387393. doi: 10.1023/A:1022282726117

  • 4

    CsanadiG.VollmannJ.StiftG.LelleyT. (2001). Seed quality QTLs identified in a molecular map of early maturing soybean. Theor. Appl. Genet.103 (6-7), 912919. doi: 10.1007/s001220100621

  • 5

    CuiB.ChenL.YangY.LiaoH. (2020). Genetic analysis and map-based delimitation of a major locusqSS3 for seed size in soybean. Plant Breeding.139 (6), 11451157. doi: 10.1111/pbr.12853

  • 6

    DuW.WangM.FuS.YuD. (2009). Mapping QTLs for seed yield and drought susceptibility index in soybean (Glycine max l.) across different environments. J. Genet. Genomics36 (12), 721731. doi: 10.1016/S1673-8527(08)60165-4

  • 7

    ElattarM. A.KarikariB.LiS.SongS.CaoY.AslamM.et al. (2021). Identification and validation of major QTLs, epistatic interactions, and candidate genes for soybean seed shape and weight using two related RIL populations. Front. Genet.12. doi: 10.3389/fgene.2021.666440

  • 8

    EskandariM.CoberE. R.RajcanI. (2013). Genetic control of soybean seed oil: I. QTL and genes associated with seed oil concentration in RIL populations derived from crossing moderately high-oil parents. Theor. Appl. Genet.126 (2), 483495. doi: 10.1007/s00122-012-1995-3

  • 9

    FanS.LiB.YuF.HanF.YanS.WangL.et al. (2015). Analysis of additive and epistatic quantitative trait loci underlying fatty acid concentrations in soybean seeds across multiple environments. Euphytica.206 (3), 689700. doi: 10.1007/s10681-015-1491-3

  • 10

    FanC.XingY.MaoH.LuT.HanB.XuC.et al. (2006). GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor. Appl. Genet.112 (6), 11641171. doi: 10.1007/s00122-006-0218-1

  • 11

    FasoulaV. A.HarrisD. K.BoermaH. R. (2004). Validation and designation of quantitative trait loci for seed protein, seed oil, and seed weight from two soybean populations. Crop Sci.44 (4), 12181225. doi: 10.2135/cropsci2004.1218

  • 12

    FliegeC. E.WardR. A.VogelP.NguyenH.QuachT.GuoM.et al. (2022). Fine mapping and cloning of the major seed protein quantitative trait loci on soybean chromosome 20. Plant J.110 (1), 114128. doi: 10.1111/tpj.15658

  • 13

    GaoH. H.GuY.JiangH. W.LiY. Y.XinD. W.LiuC. Y.et al. (2019). Mapping and analysis of QTLs related to seed length and seed width in Glycine max. Plant Breeding.138 (6), 733740. doi: 10.1111/pbr.12745

  • 14

    HanY.TengW.WangY.ZhaoX.WuL.LiD.et al. (2015). Unconditional and conditional QTL underlying the genetic interrelationships between soybean seed isoflavone, and protein or oil contents. Plant Breeding.134 (3), 300309. doi: 10.1111/pbr.12259

  • 15

    HanY.XieD.TengW.SunJ.LiW. (2012). QTL underlying developmental behaviour of 100-seed weight of soybean. Plant Breeding.131 (5), 600606. doi: 10.1111/j.1439-0523.2012.01987.x

  • 16

    HeQ.XiangS.YangH.WangW.ShuY.LiZ.et al. (2021). A genome-wide association study of seed size, protein content, and oil content using a natural population of sichuan and chongqing soybean. Euphytica.217 (11), 198. doi: 10.1007/s10681-021-02931-8

  • 17

    HinaA.CaoY.SongS.LiS.SharminR. A.ElattarM. A.et al. (2020). High-resolution mapping in two RIL populations refines major QTL “hotspot” regions for seed size and shape in soybean (Glycine max l.). Int. J. Mol. Sci.21 (3), 1040. doi: 10.3390/ijms21031040

  • 18

    HuZ.ZhangH.KanG.MaD.ZhangD.ShiG.et al. (2013). Determination of the genetic architecture of seed size and shape via linkage and association analysis in soybean (Glycine max l. merr.). Genetica.141 (4-6), 247254. doi: 10.1007/s10709-013-9723-8

  • 19

    HytenD. L.PantaloneV. R.SamsC. E.SaxtonA. M.Landau-EllisD.StefaniakT. R.et al. (2004). Seed quality QTL in a prominent soybean population. Theor. Appl. Genet.109 (3), 552561. doi: 10.1007/s00122-004-1661-5

  • 20

    JiangB. Z.LiM.ChengY. B.CaiZ. D.MaQ. B.JiangZ.et al. (2019). Genetic mapping of powdery mildew resistance genes in soybean by high-throughput genome-wide sequencing. Theor. Appl. Genet.132 (6), 18331845. doi: 10.1007/s00122-019-03319-y

  • 21

    JiaJ.WangH.CaiZ.WeiR.HuangJ.XiaQ.et al. (2022). Identification and validation of stable and novel quantitative trait loci for pod shattering in soybean [Glycine max (L.) merr.]. J. Integr. Agr.21 (11), 31693184. doi: 10.1016/j.jia.2022.08.082

  • 22

    KabelkaE. A.DiersB. W.FehrW. R.LeRoyA. R.BaianuI. C.YouT.et al. (2004). Putative alleles for increased yield from soybean plant introductions. Crop Sci.44 (3), 784. doi: 10.2135/cropsci2004.0784

  • 23

    KatoS.SayamaT.FujiiK.YumotoS.KonoY.HwangT.et al. (2014). A major and stable QTL associated with seed weight in soybean across multiple environments and genetic backgrounds. Theor. Appl. Genet.127 (6), 13651374. doi: 10.1007/s00122-014-2304-0

  • 24

    KulkarniK. P.AsekovaS.LeeD.BilyeuK.SongJ. T.LeeJ. (2017). Mapping QTLs for 100-seed weight in an interspecific soybean cross of williams 82 (Glycine max) and PI 366121 (Glycine soja). Crop Pasture Sci.68 (2), 148155. doi: 10.1071/CP16246

  • 25

    KumawatG.XuD. (2021). A major and stable quantitative trait locus qSS2 for seed size and shape traits in a soybean RIL population. Front. Genet.12. doi: 10.3389/fgene.2021.646102

  • 26

    LeeS. H.ParkK. Y.LeeH. S.ParkE. H.BoermaH. R. (2001). Genetic mapping of QTLs conditioning soybean sprout yield and quality. Theor. Appl. Genet.103 (5), 702709. doi: 10.1007/s001220100595

  • 27

    LeiteD. C.PinheiroJ. B.CamposJ. B.Di MauroA. O.Unêda-TrevisoliS. H. (2016). QTL mapping of soybean oil content for marker-assisted selection in plant breeding program. Genet. Mol. Res.15 (1), grm7685. doi: 10.4238/gmr.15017685

  • 28

    LiY.FanC.XingY.JiangY.LuoL.SunL.et al. (2011). Natural variation in GS5 plays an important role in regulating grain size and yield in rice. Nat. Genet.43 (12), 12661269. doi: 10.1038/ng.977

  • 29

    LiS.GaoF.XieK.ZengX.CaoY.ZengJ.et al. (2016). The OsmiR396c-OsGRF4-OsGIF1 regulatory module determines grain size and yield in rice. Plant Biotechnol. J.14 (11), 21342146. doi: 10.1111/pbi.12569

  • 30

    LiN.LiY. (2016). Signaling pathways of seed size control in plants. Curr. Opin. Plant Biol.33, 2332. doi: 10.1016/j.pbi.2016.05.008

  • 31

    LiM.LiuY.WangC.YangX.LiD.ZhangX.et al. (2020). Identification of traits contributing to high and stable yields in different soybean varieties across three chinese latitudes. Front. Plant Sci.10, 1642. doi: 10.3389/fpls.2019.01642

  • 32

    LiuQ.HanR.WuK.ZhangJ.YeY.WangS.et al. (2018). G-Protein βγ subunits determine grain size through interaction with MADS-domain transcription factors in rice. Nat. Commun.9 (1), 852. doi: 10.1038/s41467-018-03047-9

  • 33

    LiuW.KimM. Y.VanK.LeeY.LiH.LiuX.et al. (2011). QTL identification of yield-related traits and their association with flowering and maturity in soybean. J. Crop Sci. Biotechnol.14 (1), 6570. doi: 10.1007/s12892-010-0115-7

  • 34

    LiuN.LiM.HuX.MaQ.MuY.TanZ.et al. (2017). Construction of high-density genetic map and QTL mapping of yield-related and two quality traits in soybean RILs population by RAD-sequencing. BMC Genomics18 (1), 466. doi: 10.1186/s12864-017-3854-8

  • 35

    LiuD.YanY.FujitaY.XuD. (2018). Identification and validation of QTLs for 100-seed weight using chromosome segment substitution lines in soybean. Breed. Sci.68 (4), 442448. doi: 10.1270/jsbbs.17127

  • 36

    LiN.XuR.LiY. (2019). Molecular networks of seed size control in plants. Annu. Rev. Plant Biol.70 (1), 435463. doi: 10.1146/annurev-arplant-050718-095851

  • 37

    LiW.ZhengD.VanK.LeeS. (2008). QTL mapping for major agronomic traits across two years in soybean (Glycine max l. merr.). J. Crop Sci. Biotechnol.11 (3), 171176.

  • 38

    MansurL. M.LarkK. G.KrossH.OliveiraA. (1993). Interval mapping of quantitative trait loci for reproductive, morphological, and seed traits of soybean (Glycine max l.). Theor. Appl. Genet.86 (8), 907913. doi: 10.1007/BF00211040

  • 39

    MaoT.JiangZ.HanY.TengW.ZhaoX.LiW. (2013). Identification of quantitative trait loci underlying seed protein and oil contents of soybean across multi-genetic backgrounds and environments. Plant Breeding.132 (6), 630641. doi: 10.1111/pbr.12091

  • 40

    MaughanP. J.MaroofM. A.BussG. R. (1996). Molecular-marker analysis of seed-weight: Genomic locations, gene action, and evidence for orthologous evolution among three legume species. Theor. Appl. Genet.93 (4), 574579. doi: 10.1007/BF00417950

  • 41

    MccouchS.ChoY.YanoM.PaulE.BlinstrubM.MorishimaH.et al. (1997). Report on QTL nomenclature. Rice Genet. Newsl.14, 1113.

  • 42

    MianM. A.BaileyM. A.TamulonisJ. P.ShipeE. R.CarterT. E. J.ParrottW. A.et al. (1996). Molecular markers associated with seed weight in two soybean populations. Theor. Appl. Genet.93 (7), 10111016. doi: 10.1007/BF00230118

  • 43

    NingH.YuanJ.DongQ.LiW.XueH.WangY.et al. (2018). Identification of QTLs related to the vertical distribution and seed-set of pod number in soybean [Glycine max (L.) merri]. PLoS One13 (4), e195830. doi: 10.1371/journal.pone.0195830

  • 44

    NiuY.XuY.LiuX.YangS.WeiS.XieF.et al. (2013). Association mapping for seed size and shape traits in soybean cultivars. Mol. Breeding.31 (4), 785794. doi: 10.1007/s11032-012-9833-5

  • 45

    NyquistW. E.BakerR. J. (1991). Estimation of heritability and prediction of selection response in plant populations. Crit. Rev. Plant Sci.10 (3), 235322. doi: 10.1080/07352689109382313

  • 46

    PalomequeL.Li-JunL.LiW.HedgesB.CoberE. R.RajcanI. (2009). QTL in mega-environments: II. agronomic trait QTL co-localized with seed yield QTL detected in a population derived from a cross of high-yielding adapted × high-yielding exotic soybean lines. Theor. Appl. Genet.119 (3), 429436. doi: 10.1007/s00122-009-1048-8

  • 47

    PantheeD. R.PantaloneV. R.WestD. R.SaxtonA. M.SamsC. E. (2005). Quantitative trait loci for seed protein and oil concentration, and seed size in soybean. Crop Sci.45 (5), 20152022. doi: 10.2135/cropsci2004.0720

  • 48

    PathanS. M.VuongT.ClarkK.LeeJ.ShannonJ. G.RobertsC. A.et al. (2013). Genetic mapping and confirmation of quantitative trait loci for seed protein and oil contents and seed weight in soybean. Crop Sci.53 (3), 765774. doi: 10.2135/cropsci2012.03.0153

  • 49

    QiZ.WuQ.HanX.SunY.DuX.LiuC.et al. (2011). Soybean oil content QTL mapping and integrating with meta-analysis method for mining genes. Euphytica.179 (3), 499514. doi: 10.1007/s10681-011-0386-1

  • 50

    QiZ. M.ZhangX. Y.QiH. D.XinD. W.HanX.JiangH. W.et al. (2017). Identification and validation of major QTLs and epistatic interactions for seed oil content in soybeans under multiple environments based on a high-density map. Euphytica.213 (8), 162. doi: 10.1007/s10681-017-1952-y

  • 51

    SalasP.Oyarzo-LlaipenJ. C.WangD.ChaseK.MansurL. (2006). Genetic mapping of seed shape in three populations of recombinant inbred lines of soybean (Glycine max l. merr.). Theor. Appl. Genet.113 (8), 14591466. doi: 10.1007/s00122-006-0392-1

  • 52

    SaxK. (1923). The association of size differences with seed-coat pattern and pigmentation in PHASEOLUS VULGARIS. Genetics.8 (6), 552560. doi: 10.1093/genetics/8.6.552

  • 53

    SeboltA. M.ShoemakerR. C.DiersB. W. (2000). Analysis of a quantitative trait locus allele from wild soybean that increases seed protein concentration in soybean. Crop Sci.40 (5), 14381444. doi: 10.2135/cropsci2000.4051438x

  • 54

    ShomuraA.IzawaT.EbanaK.EbitaniT.KanegaeH.KonishiS.et al. (2008). Deletion in a gene associated with grain size increased yields during rice domestication. Nat. Genet.40 (8), 10231028. doi: 10.1038/ng.169

  • 55

    SongX.HuangW.ShiM.ZhuM.LinH. (2007). A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet.39 (5), 623630. doi: 10.1038/ng2014

  • 56

    SunL.LiX.FuY.ZhuZ.TanL.LiuF.et al. (2013). GS6, a member of the GRAS gene family, negatively regulates grain size in rice. J. Integr. Plant Biol.55 (10), 938949. doi: 10.1111/jipb.12062

  • 57

    SunY. Q.TianR.ShaoZ. Q.ChenS. L.ZhangH.JinY.et al. (2021). Mining of quantitative trait loci and candidate genes for seed size and shape across multiple environments in soybean (Glycine max). Plant Breeding.140 (6), 10581069. doi: 10.1111/pbr.12968

  • 58

    TajuddinT. C. F. T.WatanabeS.YamanakaN.HaradaK. (2003). Analysis of quantitative trait loci for protein and lipid contents in soybean seeds using recombinant inbred lines. Breed. Sci.53 (2), 133140. doi: 10.1270/jsbbs.53.133

  • 59

    TengW.HanY.DuY.SunD.ZhangZ.QiuL.et al. (2009). QTL analyses of seed weight during the development of soybean (Glycine max l. merr.). Heredity.102 (4), 372380. doi: 10.1038/hdy.2008.108

  • 60

    TengW. L.SuiM. N.LiW.WuD. P.ZhaoX.LiH. Y.et al. (2018). Identification of quantitative trait loci underlying seed shape in soybean across multiple environments. J. Agric. Science.156 (1), 312. doi: 10.1017/S002185961700082X

  • 61

    WangH.JiaJ.CaiZ.DuanM.JiangZ.XiaQ.et al. (2022). Identification of quantitative trait loci (QTLs) and candidate genes of seed iron and zinc content in soybean [Glycine max (L.) merr.]. BMC Genomics23 (1), 146. doi: 10.1186/s12864-022-08313-1

  • 62

    WangX.JiangG.GreenM.ScottR. A.SongQ.HytenD. L.et al. (2014). Identification and validation of quantitative trait loci for seed yield, oil and protein contents in two recombinant inbred line populations of soybean. Mol. Genet. Genomics289 (5), 935949. doi: 10.1007/s00438-014-0865-x

  • 63

    WangS.LiS.LiuQ.WuK.ZhangJ.WangS.et al. (2015). The OsSPL16-GW7 regulatory module determines grain shape and simultaneously improves rice yield and grain quality. Nat. Genet.47 (8), 949954. doi: 10.1038/ng.3352

  • 64

    WangJ.LiuL.GuoY.WangY.ZhangL.JinL.et al. (2014). A dominant locus, qBSC-1, controls β subunit content of seed storage protein in soybean (Glycine max (L.) merri.). J. Integr. Agr.13 (9), 18541864. doi: 10.1016/S2095-3119(13)60579-1

  • 65

    WarringtonC. V.Abdel-HaleemH.HytenD. L.CreganP. B.OrfJ. H.KillamA. S.et al. (2015). QTL for seed protein and amino acids in the benning × danbaekkong soybean population. Theor. Appl. Genet.128 (5), 839850. doi: 10.1007/s00122-015-2474-4

  • 66

    WengJ.GuS.WanX.GaoH.GuoT.SuN.et al. (2008). Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Res.18 (12), 11991209. doi: 10.1038/cr.2008.307

  • 67

    WhitingR. M.TorabiS.LukensL.EskandariM. (2020). Genomic regions associated with important seed quality traits in food-grade soybeans. BMC Plant Biol.20 (1), 485. doi: 10.1186/s12870-020-02681-0

  • 68

    XianP.CaiZ.JiangB.XiaQ.ChengY.YangY.et al. (2022). GmRmd1 encodes a TIR-NBS-BSP protein and confers resistance to powdery mildew in soybean. Plant Commun.3 (6), 100418. doi: 10.1016/j.xplc.2022.100418

  • 69

    XuY.LiH.LiG.WangX.ChengL.ZhangY. (2011). Mapping quantitative trait loci for seed size traits in soybean (Glycine max l. merr.). Theor. Appl. Genet.122 (3), 581594. doi: 10.1007/s00122-010-1471-x

  • 70

    YangK.MoonJ.JeongN.ChunH.KangS.BackK.et al. (2011). Novel major quantitative trait loci regulating the content of isoflavone in soybean seeds. Genes Genom.33 (6), 685692. doi: 10.1007/s13258-011-0043-z

  • 71

    YangH.WangW.HeQ.XiangS.TianD.ZhaoT.et al. (2017). Chromosome segment detection for seed size and shape traits using an improved population of wild soybean chromosome segment substitution lines. Physiol. Mol. Biol. Plants.23 (4), 877889. doi: 10.1007/s12298-017-0468-1

  • 72

    YanL.LiY.YangC.RenS.ChangR.ZhangM.et al. (2014). Identification and validation of an over-dominant QTL controlling soybean seed weight using populations derived from Glycine max × Glycine soja. Plant Breeding.133 (5), 632637. doi: 10.1111/pbr.12197

  • 73

    YaoD.LiuZ. Z.ZhangJ.LiuS. Y.QuJ.GuanS. Y.et al. (2015). Analysis of quantitative trait loci for main plant traits in soybean. Genet. Mol. Res.14 (2), 61016109. doi: 10.4238/2015.June.8.8

  • 74

    YesudasC. R.BashirR.GeislerM. B.LightfootD. A. (2013). Identification of germplasm with stacked QTL underlying seed traits in an inbred soybean population from cultivars Essex and forrest. Mol. Breeding.31 (3), 693703. doi: 10.1007/s11032-012-9827-3

  • 75

    YueY.LiuN.JiangB.LiM.WangH.JiangZ.et al. (2017). A single nucleotide deletion in j encoding GmELF3 confers long juvenility and is associated with adaption of tropic soybean. Mol. Plant10 (4), 656658. doi: 10.1016/j.molp.2016.12.004

  • 76

    ZengZ. B. (1994). Precision mapping of quantitative trait loci. Genet. (Austin).136 (4), 14571468. doi: 10.1093/genetics/136.4.1457

  • 77

    ZhangJ.SongQ.CreganP. B.JiangG. (2016). Genome-wide association study, genomic prediction and marker-assisted selection for seed weight in soybean (Glycine max). Theor. Appl. Genet.129 (1), 117130. doi: 10.1007/s00122-015-2614-x

  • 78

    ZhangX.WangJ.HuangJ.LanH.WangC.YinC.et al. (2012). Rare allele of OsPPKL1 associated with grain length causes extra-large grain and a significant yield increase in rice. Proc. Natl. Acad. Sci.109 (52), 2153421539. doi: 10.1073/pnas.1219776110

Summary

Keywords

soybean, seed size, seed weight, stable QTLs, QTL clusters

Citation

Luo S, Jia J, Liu R, Wei R, Guo Z, Cai Z, Chen B, Liang F, Xia Q, Nian H and Cheng Y (2023) Identification of major QTLs for soybean seed size and seed weight traits using a RIL population in different environments. Front. Plant Sci. 13:1094112. doi: 10.3389/fpls.2022.1094112

Received

09 November 2022

Accepted

15 December 2022

Published

11 January 2023

Volume

13 - 2022

Edited by

Jianghua Chua, Key Laboratory of Tropical Plant Resource and Sustainable Use (CAS), China

Reviewed by

Zhaoming Qi, Northeast Agricultural University, China; Hengyou Zhang, Northeast Institute of Geography and Agroecology (CAS), China

Updates

Copyright

*Correspondence: Yanbo Cheng, ; Hai Nian,

†These authors share first authorship

This article was submitted to Functional and Applied Plant Genomics, a section of the journal Frontiers in Plant Science

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics