ORIGINAL RESEARCH article

Front. Plant Sci., 06 February 2023

Sec. Plant Breeding

Volume 14 - 2023 | https://doi.org/10.3389/fpls.2023.1112748

SSR marker based analysis for identification and of genetic diversity of non-heading Chinese cabbage varieties

  • 1. College of Agriculture, South China Agricultural University, Guangzhou, China

  • 2. Institute for Agri-food Standards and Testing Technology, Shanghai Academy of Agricultural Sciences, Shanghai, China

  • 3. Development Center of Science and Technology, Ministry of Agriculture and Rural Affairs, Beijing, China

  • 4. State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing, China

  • 5. Research and development center, Fujian Jinpin Agricultural Technology Co., Ltd, Fuzhou, China

Article metrics

View details

30

Citations

11,8k

Views

2,5k

Downloads

Abstract

As a widely cultivated vegetable in China and Southeast Asia, the breeding of non-heading Chinese cabbage (Brassica campestris ssp. chinensis Makino) is widespread; more than 400 varieties have been granted new plant variety rights (PVRs) in China. Distinctness is one of the key requirements for the granting of PVRs, and molecular markers are widely used as a robust supplementary method for similar variety selection in the distinctness test. Although many genome-wide molecular markers have been developed, they have not all been well used in variety identification and tests of distinctness of non-heading Chinese cabbage. In this study, by using 423 non-heading Chinese cabbage varieties collected from different regions of China, 287 simple sequence repeat (SSR) markers were screened for polymorphisms, and 23 core markers were finally selected. The polymorphic information content (PIC) values of the 23 SSR markers ranged from 0.555 to 0.911, with an average of 0.693, and the average number of alleles per marker was 13.65. Using these 23 SSR markers, 418 out of 423 varieties could be distinguished, with a discrimination rate of 99.994%. Field tests indicated that those undistinguished varieties were very similar and could be further distinguished by a few morphological characteristics. According to the clustering results, the 423 varieties could be divided into three groups: pak-choi, caitai, and tacai. The similarity coefficient between the SSR markers and morphological characteristics was moderate (0.53), and the efficiency of variety identification was significantly improved by using a combination of SSR markers and morphological characteristics.

1 Introduction

Non-heading Chinese cabbage (Brassica campestris ssp. chinensis Makino) is a subspecies of Brassica in the family Brassicaceae. It is usually diploid (2n = 20, AA) and comprises five types: pak-choi (var. communis Tesn et Lee), caitai (var. tsai-tai Hort), tacai (var. rosularism Tesn et Lee), taicai (var. tai-tsai Hort), and duotoucai (var. multiceps Hort) (Hou and Song, 2012). Originating in China, it has a long history of cultivation, with its leaves being the main product (Hou et al., 2020). Given its strong adaptability, short growth cycle, and rich nutritional value, the non-heading Chinese cabbage is widely planted not only in China, but also in Southeast Asia, Europe, and America, and is gradually becoming a global vegetable. Non-heading Chinese cabbage breeding is widespread in China. As of August 2022, the number of applications for plant variety rights (PVRs) of non-heading Chinese cabbage in China had reached 436. However, owing to the lack of outstanding inbred lines and germplasm resources, the genetic background of newly developed varieties of non-heading Chinese cabbage is becoming narrower, and variety identification is becoming more and more difficult.

A distinctness, uniformity, and stability (DUS) test is the key technical support for the granting of PVRs, in which the distinctness test is the key step. To assess distinctness, the candidate variety needs to be compared with any other commonly known varieties. To ensure the effectiveness and accuracy of the distinctness assessment, the construction of the database of commonly known varieties is very urgent and necessary. The effectiveness and accuracy of any distinctness assessment relies on the existence of a comprehensive and accurate database of commonly known varieties. The currently available database is based on the morphological characterization of commonly known varieties, which, although accurate and scientifically robust, also has several limitations, being slow, expensive, resource intensive, and time-consuming (Liu et al., 2012). In addition, as morphological characteristics are easily affected by environmental factors, such as temperature, light, and fertilizer application, and data collected in different ecological places or in different seasons may be quite different, which may cause errors when screening for similar varieties using the distinctness test. DNA molecular marker technology can directly detect differences on a DNA level among varieties; this technology is not easily affected by environmental conditions, does not require field planting, and is fast and efficient. It has been widely used in variety identification and is recommended as a supplementary method to construct a variety database for variety management, especially for screening for similar varieties using the distinctness test developed by the UPOV (International Union for the Protection of New Varieties of Plants). In contrast to other molecular markers, simple sequence repeat (SSR) markers have the advantages of clear loci, simple technology, and reliable detection results, and are recommended as one of the preferred markers for plant variety identification and database construction by UPOV (Zhou et al., 2020). SSR markers have been widely used in identifying Brassicaceae Burnett vegetables, such as Chinese cabbage, Brassica juncea, broccoli, and cauliflower (Zhan et al., 2014; Yan et al., 2021; Chu et al., 2020), and are also used in the identification and genetic diversity assessment of non-heading Chinese cabbage (Wang et al., 2008; Liu et al., 2014; Yu et al., 2014; Liu et al., 2021). However, in previous studies in non-heading Chinese cabbage, the SSR markers selected were comparatively low in polymorphism and could not meet the needs of large-scale variety identification (Li, 2010; Liu et al., 2014). The varieties that could be identified were usually limited to one or a few types, and did not cover all five types of non-heading Chinese cabbage; in addition, SSR data were mainly obtained by polyacrylamide gel electrophoresis, which was not conducive to genotyping and data-sharing. Therefore, it is necessary to establish a high-throughput SSR molecular identification system with a strong discriminatory ability that covers various types of non-heading Chinese cabbage, and which may provide a robust technical support for screening similar varieties using distinctness tests, identification of variety authenticity, and protection of PVRs.

In this study, by using non-heading Chinese cabbage varieties covering all the five types from all the main production areas in China, we tried to select a core set of SSR markers with high levels of polymorphism and strong discriminatory ability suitable for both polyacrylamide gel electrophoresis and capillary electrophoresis platforms. Based on the core SSR markers, an SSR fingerprint database could be constructed to provide a powerful support for similar variety screening of distinctness tests and variety identification of non-heading Chinese cabbage varieties.

2 Materials and methods

2.1 Plant materials and DNA extraction

Non-heading Chinese cabbage has rich morphological diversity and exhibits significant differences among variety types (Figure 1). A total of 423 non-heading Chinese cabbage varieties covering five subspecies, pak-choi, caitai, tacai, taicai, and duotoucai (Table S1), were collected in this study, among which two varieties were from northeast China, 40 were from north and central China, 36 were from south China, 335 were from east China, and 10 from Japan. In addition, 21 varieties with diverse morphological characteristics were used for first-round SSR marker screening (Table S2). The young leaves from 30 individual plants were collected for total genomic DNA extraction, using the cetyltrimethylammonium bromide (CTAB) method, as previously described (Tang et al., 2007).

Figure 1

2.2 SSR-PCR reaction

A total of 287 markers were selected from previous studies (Lowe et al., 2002; Wang et al., 2008; Ban, 2009; Cheng et al., 2009; Li, 2010; Liu et al., 2014; Song et al., 2015; Chen et al., 2017; Liu, 2017; Li et al., 2018; He et al., 2021) (Table S3). The selected SSR markers were labelled with 6-FAM (6-carboxyfluorescein), HEX (hexachlorofluorescein), ROX (6-carboxyl-X-rhodamine; passive reference dye), and TAMRA (5-carboxytetramethylrhodamine) fluorescent dyes at the 5′ end of the forward primer. The total volume of the polymerase chain reaction (PCR) was 20 µL, with a dNTP concentration of 0.20 mmol/L, and concentrations of forward and reverse primers of 0.25 µmol/L, 0.05 U/µL of Taq total genomic DNA polymerase, 1 × PCR buffer (containing Mg2+, 2.5 mmol/l), and 50 ng/µL of DNA, and with the addition of double-distilled H2O up to a total of 20 µL. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 45 seconds, for a total of 35 cycles; followed by extension at 72°C for 10 minutes; and then storage of the PCR reaction at 4°C.

2.3 Detection of PCR amplification products

During the first round of primer screening, primers were selected and detected by 6% polyacrylamide gel electrophoresis (PAGE) (Bao, 2015), with a constant power of 80 W; 2 µL of PCR product was added to each sample hole, and silver staining was performed after electrophoresis for 1–1.5 hours. Then the primers screened during the first round were labeled with different fluorescent dyes and were further screened and detected by a DNA analyzer (ABI3730).

2.4 Morphological evaluation

From December 2021 to March 2022, 423 non-heading Chinese cabbage varieties were planted at the Shanghai DUS testing base. In accordance with non-heading Chinese cabbage DUS test guidelines (http://www.nybkjfzzx.cn), 30 morphological characteristics were investigated (Table 1): four qualitative characteristics, 11 pseudo-qualitative characteristics, and 15 quantitative characteristics. The Shannon–Wiener diversity index of morphological characteristics was calculated as H′ = –∑(Pi) (lnPi), where Pi is the proportion of individuals to total individuals of this species. The 'Pi' is an explanation of the formula, and the specific number of individuals depends on the expression state of the characteristics. were assigned a code from 1 to 9. For each characteristic of a variety, the expressed state was coded as 1 and the non-expressed state was coded as 0. The programming language R was used for 0 or 1 data format conversion, to build a 0/1 data matrix.

Table 1

NoCharacteristicsTypeExpression State (code)H'NoCharacteristicsTypeCharacteristic expression (code)H'
1TillerQLabsent(1); present(9)0.0416Plant habitQNerect(1); erect to semi-erect(2);semi-erect(3);
semi-erect to collapse(4); collapse(5)
0.98
2Leaf hairinessQLabsent(1)017GirdlingQNabsent(1); weak(2); medium(3); strong(4)1.20
3Leaf vein clarityQLweak(1); strong(2)0.2218Plant heightQNvery low(1); very low to low(2); low(3); low to medium(4); medium(5); medium to high(6);high(7); high to very high(8); very high(9)1.90
4Inflorescence stem wax powdersQLabsent(1); present(9)0.4319Plumpness of cabbageQNloose(1); medium(2); hard(3)0.94
5Seed coat colorPQyellow(1); brown(2); dark brown(3)0.6320Leaf lengthQNvery short(1); very short to short(2); short(3); short to medium(4); medium(5);
medium to long(6); long(7); long to very long(8); very long(9)
1.90
6Cotyledon colorPQlight green(2); medium green(3); dark green(4); purple(5)0.8521Leaf widthQNvery narrow(1); very narrow to narrow(2); narrow(3); narrow to medium(4); medium(5); medium to broad(6); broad(7); broad to very broad(8); very broad(9)1.98
7Leaf typePQplaty(1); divided leaf(2)0.0622Leaf undulation of marginQNabsent(1); 2(very weak)1.39
8Leaf shapePQlanceolate (1); oval (2); elliptic(4); round oval(5); near round(6)1.5123Leaf degree of
blistering
QNabsent(1); very weak(2); weak(3); weak to medium(4); medium(5); medium to strong(6); strong(7); strong to very strong(8); very strong(9)1.37
9Leaf apexPQblunt tip(1); circle(3); broad circle(4)0.7324Leaf glossinessQNabsent(1); weak(2); strong(3)0.68
10Leaf colorPQyellow green(1); light green(2); medium green(3); dark green(4); deep green(5); purple-red(6); purple(7)1.3425Leaf numberQNvery less to less(2); less(3); less to medium(4); medium(5); medium to more(6); more(7); more to very more(8); very more(9)1.77
11Leaf margin featuresPQinward(1); flat(2); outward(3)0.4226Petiole thicknessQNvery thin(1); very thin to thin(2); thin(3); thin to medium(4); medium(5); medium to thick(6); thick(7); thick to very thick(8); very thick(9)1.97
12Petiole shape in horizontal sectionPQsubcircular(1); crescent(2); flat(3)0.1127Petiole lengthQNvery short to short(2); short(3); short to medium(4); medium(5); medium to long(6); long(7); long to very long(8); very long(9)1.55
13Petiole colorPQwhite(1); green white(2); light green(3); medium green(4); dark green(5); purple(6)1.2828Petiole widthQNvery narrow(1); very narrow to narrow(2); narrow(3); narrow to medium(4); medium(5); medium to broad(6); broad(7); broad to very broad(8); very broad(9)1.79
14Inflorescence stem colorPQgreen(2); light green(3)0.1329Bolting periodQNvery early to early(2); early(3); early to medium(4); medium(5); medium to late(6); late(7); late to very late(8); very late(9)1.40
15Flower colorPQwhite(1); light yellow(2); yellow(3); orange red(4)0.3830Axillary bud generation abilityQNabsent or very weak(1); very weak to weak(2); weak(3); weak to medium(4); medium(5); medium to strong(6); strong(7); strong to very strong(8); very strong(9)2.01

Details of morphological characteristics investigated in 423 non-heading Chinese cabbage varieties.

QL, qualitative characteristic; QN, quantitative characteristic; PQ, pseudo-qualitative characteristic; H′, Shannon–Wiener diversity index. Calculating by H′ = –∑(Pi) (lnPi), where Pi is the proportion of individuals to total individuals of this species.

2.5 Data analysis

Raw electrophoresis data were read by SSR Analyzer V1.2.6 software (Wang et al., 2018). The genetic distance between different varieties was calculated by PowerMarker V3.25 software (Liu and Muse, 2005), and the unweighted pair group method with arithmetic means (UPGMA) clustering map based on Nei’s genetic distance was constructed using MEGA5.0 software (Kumar et al., 2004). Genetic diversity parameters, including minor allele frequency (MAF), observed number of alleles (Na), observed heterozygosity (Ho), expected heterozygosity (He), polymorphic information content (PIC), and fixation index (Fst), were calculated using GenAlEx 6.51 software (Peakall and Smouse, 2012), which was also used for principal component analysis (PCA) and analysis of molecular variance (AMOVA). Combining morphological and molecular data, NTSYS2.11 software was used for genetic similarity analysis (James, 1987). Using qualitative data in the similarity module, the original 0/1 matrix generated by the morphological characteristic code and genotype data was adopted to calculate the genetic similarity (GS). The Mantel test was used to confirm the correlation between the similarity coefficient matrix generated from the morphological data and the SSR genotype data. Structure 2.34 software was used to analyze the population genetic structure from different regions of China (Falush et al., 2007). Assuming that the population number K was 1–10 and was tested one by one, each K-value was estimated to be repeated 20 times: 5,000 iterations were not counted and the MCMC (Markov chain Monte Carlo) value was 50,000. The average value of lnP (D) was used for population estimation, the optimal population number was determined by the maximum likelihood method, and the corresponding K-value was calculated. Finally, we used NTSYS2.11 software to test the similarity of the phenotypic data of 14 varieties (five candidate varieties, with their corresponding similar varieties provided by applicants, and those screened by the SSR fingerprint database in this study).

3 Results

3.1 Establishment of variety identification system for non-heading Chinese cabbage

3.1.1 Core primer screening and polymorphism analysis

During the first round of primer screening, 21 representative varieties were used for PCR amplification, and 6% PAGE was used for electrophoresis (Figure 2A). As a result, 57 pairs of primers with high levels of polymorphism were screened. During the second round of primer screening, fluorescent dyes were labelled at the 5′ end of each of the 57 pairs of primers, and the fluorescent markers were used to amplify 96 varieties by capillary electrophoresis (Figures 2B–E). Based on the criteria of stable and simple fluorescence peak, low missing rate, high levels of polymorphism, and even distribution on chromosomes, 23 pairs of primers were finally selected as core primers, with the size of alleles ranging from 99 bp (SSR221) to 355 bp (SSR227). Detailed information on those primers is provided in Table 2.

Figure 2

Table 2

No.Primer numberSequence (5′→3′)Chromosomal positionAllelic variation range (bp)
1SSR101F: TGGAGTGTTTGTTGTAAGCTCAA
R: TTCGGGATGAGAGTTCCAAG
5188–227
2SSR125F: TGCTCTTTGACACGTGCTATC
R: AGAGGAGAGAAGGGGAGAGG
1110–139
3SSR136F: TGATCACTGGGGTCCATTTA
R: CTGCGTCGAAGTTAGAGACG
2153–203
4SSR138F: TGCGTGCGGATTATCATCTA
R: GGACGTAAACTTAGCACGATTC
2160–174
5SSR192F: TAATCGCGATCTGGATTCAC
R: ATCAGAACAGCGACGAGGTC
5114–162
6SSR198F: GGTCAGGTGCTACTCAGACTCC
R: TTGAAGAGGATCCACCAAAAG
3276–314
7SSR206F: TGTCAGTGTGTCCACTTCGC
R: AAGAGAAACCCAATAAAGTAGAACC
8124–207
8SSR207F: TCAGCCTACCAACGAGTCATAA
R: AAGGTCTCATACGATGGGAGTG
6144–213
9SSR22F: ATGCACAGAGGAAGAAACCG
R: GGGGATGAAGAAGAAGCAGA
1155–191
10SSR221F: GTTCTCAAAGGGAAACCGAAAAACA
R: GAGTTGGCCAGAGATTTACATGCGT
499–178
11SSR222F: CAAGAGCAAGTTTGAAACAAACGAT
R: CATCAGTTCTTGATATGCTAGGTGA
6175–280
12SSR227F: TTCCACCTCTCTGCTCCAAC
R: ATGCGTGAGCGAGGATAACT
2271–355
13SSR228F: GGAGTCCACTTCATGGAGGA
R: CTCTTGCTCGTAGGTTTCCG
8233–274
14SSR229F: TCAGTCACAAAAAGTCAACTCAAA
R: ACGGAGTAGGAGTTGGGAGG
9114–148
15SSR238F: TTTGACATCGTGCAATGCTA
R: TTGGGCTGGTCCTGAAGATA
3278–325
16SSR247F: GGTCCATTCCTTTTTGCATCTG
R: CATGGCAAGGGGTAACAAACAT
7128–154
17SSR256F: GGAGCCAGGAGAGAAGAAGG
R: CCCAAAACTTCCAAGAAAAGC
3168–206
18SSR266F: TCGGATTTGCATGTTCCTGA
R: CCGATACACAACCAGCCAACT
7187–305
19SSR283F: CCAACACCAAATCGCATAATC
R: GGAGCTCCCACCTACAGTTTC
10163–182
20SSR45F: GATTTGGGCCATTTGGATTA
R: TTGAGCATTGTTCCCAGACA
4206–230
21SSR56F: GTTAAGTTCGAACGCGAAGG
R: GATCGGGGAAAATTAGGGAA
9241–272
22SSR66F: ATTCAAAGACAAAGGAATGCCTGAG
R: GTTTCTTTGATCCTGTCGAATGGCATTAATAAA
6123–144
23SSR90F: TGCCTTTGTGTTCAGCTCAC
R: CCCAAACGCTTTTGACACAT
10202–211

Chromosome distribution and allelic variation range of the 23 primer sequences studied.

bp, base pair; F, forward; R, reverse.

Using 23 pairs of primers, 423 non-heading Chinese cabbage varieties were detected and a total of 314 alleles were obtained, with an average of 13.65 alleles per marker (Table 3). The variation range of MAF was 0.209 (SSR222) to 0.611 (SSR101), with an average of 0.419; the Ho amplitude ranged from 0.322 (SSR101) to 0.732 (SSR256), with an average of 0.530; the He amplitude was between 0.590 (SSR125) and 0.916 (SSR222); the PIC value ranged from 0.555 (SSR56) to 0.911 (SSR222), greater than 0.5, indicating high levels of polymorphism of all 23 markers; and the Fst of each molecular marker ranged from 0.045 (SSR221) to 0.547 (SSR266), with an average of 0.270. The above parameters showed that the 23 markers selected were high in polymorphism and could be used for genetic diversity detection among non-heading Chinese cabbage varieties, variety identification, and similar variety screening for the distinctness test.

Table 3

MarkerMAFNaHoHePICFst
SSR1010.611100.3220.5960.5720.460
SSR1250.610140.3860.5900.5610.346
SSR1360.38070.5310.7500.7120.292
SSR1380.33580.7230.7940.7670.089
SSR1920.454200.6170.7530.7350.181
SSR1980.599120.4900.6160.5980.204
SSR2060.365260.6770.8260.8140.181
SSR2070.52760.3360.6180.5570.455
SSR220.429100.5600.7320.6960.235
SSR2210.490160.6930.7250.7080.045
SSR2220.209400.6010.9160.9110.344
SSR2270.233230.4610.8500.8340.458
SSR2280.498130.5010.6860.6510.269
SSR2290.47490.5460.6540.5960.164
SSR2380.413120.4670.7600.7330.386
SSR2470.34670.5790.7010.6440.174
SSR2560.177160.7320.8640.8490.153
SSR2660.415300.3560.7870.7710.547
SSR2830.38860.5560.7250.6780.234
SSR450.45670.4140.6710.6140.383
SSR560.49570.5130.6240.5550.177
SSR660.283100.5510.7800.7440.293
SSR900.45250.5860.6900.6400.151
Mean0.41913.60.5300.7260.6930.270

Genetic parameters of the 23 SSR markers.

MAF, minor allele frequency; Na, observed number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; PIC, polymorphic information content; Fst, fixation index.

3.1.2 Allelic sites calibration and database construction

According to the original capillary electrophoresis data, different allelic sites were named, and each allele’s corresponding reference varieties were selected to calibrate systematic errors among different experimental batches or detection platforms. The size of allelic sites corresponding to each primer and the corresponding reference varieties are listed in Table S4.

Based on the allelic sites data detected on the 423 non-heading Chinese cabbage varieties, the DNA molecular database was successfully constructed using SSR Analyzer V1.2.6 software. To improve the efficiency of database construction, 23 pairs of fluorescent primers were further divided into five groups (Table 4) according to the fluorescent color and amplified fragment size. Primers in each group could be mixed for multiple fluorescent capillary electrophoresis.

Table 4

Group
Label
12345
6-FAMSSR125(110–139)SSR138(150–174)SSR256(164–206)SSR221(99–178)SSR136(153–203)
SSR283(163–182)SSR45(206–228)SSR56(241–270)SSR198(278–314)
SSR228(233–274)SSR227(271–355)
ROXSSR66(123–148)SSR101(197–225)SSR247(128–149)SSR90(174–211)SSR192(116–158)
SSR266(188–305)SSR238(278–325)SSR222(175–227)
TAMRASSR229(114–148)SSR22(155–194)SSR206(124–207)
HEXSSR207(144–214)

Grouping of 23 core primers according to different fluorescent-labelled colors.

The selected SSR markers were labelled with 6-FAM, (6-carboxyfluorescein); HEX, (hexachlorofluorescein); ROX, (6-carboxyl-X-rhodamine; passive reference dye); or TAMRA, (5-carboxytetramethylrhodamine) fluorescent dyes at the 5′ end of the forward primer.

3.1.3 Discrimination power of core primers

To assess the accuracy and efficiency of core primers in distinguishing varieties, the 423 non-heading Chinese cabbage varieties were clustered based on the Nei’s distance of 23 SSR markers (Figure 3). The clustering results showed that 418 out of the 423 varieties combinations could be distinguished by the 23 core primers, and that five groups could not be distinguished,because the genetic distance between varieties in each group was close to zero. By using the formula [(423 * 422)/2 – 5]/(423 * 422)/2, the distinguishing rate for the 23 core SSR markers in 423 varieties was calculated to be 99.994%. By clustering, the 423 varieties could be divided into three main groups. In Pop1(n=226), besides duotoucais, the other varieties were pak-chois; Pop2(n=83) contained 52 pak-chois, 13 tacais, 17 caitais, and one taicai; and Pop3(n=93) comprised 19 pak-chois and 74 caitais. In addition, some local varieties were clustered separately, such as Shangwudong (412), Paopaoqing (286), and Xiangqingcai (308). Similarly, we conducted PCA to verify the clustering results, and principal coordinates 1 and 2 accounted for 19.39% and 7.13%, respectively, of the variation in the site information data (Figure 4). The AMOVA results showed that 66% of the variation came from within individuals. The genetic variation among individuals was greater than that among populations (Table S5). The fixation index (Fst) value was 0.134 (p < 0.001), indicating a high level of genetic differentiation among populations.

Figure 3

Figure 4

3.2 Population structure analysis of the tested varieties

To explore the population distribution characteristics of non-heading Chinese cabbage, the population structure of 423 varieties was analyzed using the genotype data. The results showed that, for K = 1–10, the value of lnP (D) increased with the increase in K-value (Figure 5A). A population structure distribution map based on Δk was constructed (Figure 5B), and the 423 varieties could be divided into three subgroups (Figure 5C). There were 84 varieties in subgroup I, from east China (n = 70), south China (n = 6), north China (n = 1), central China (n = 4), and Japan (n = 3); 138 varieties in subgroup II, from east China (n = 113), south China (n = 10), north China (n = 7), central China (n = 5), and Japan (n = 3); and 201 varieties in subgroup III, from east China (n = 152), south China (n = 20), north China (n = 14), central China (n = 9), northeast China (n = 2), and Japan (n = 4) (Figure 5C).

Figure 5

The population structure analysis showed that most genetic differences among non-heading Chinese cabbage varieties could be attributed to the geographical origins of the varieties. Varieties in subgroup I were mainly from east China, and varieties from east China also accounted for a large proportion of the other two subgroups; the caitai varieties were mainly from south China and clustered in subgroup II; and varieties from north China and northeast China were mainly clustered in subgroup III.

3.3 Correlation analysis between SSR markers and morphological characteristics

Descriptive statistics were based on 30 phenotypic characteristics of 423 non-heading Chinese cabbage varieties. The Shannon–Wiener diversity index of 30 characteristics ranged from 0 to 2.01, with an average of 1.03. In order to understand the relationship between SSR markers and morphological characteristics, the data from 30 morphological characteristics (markers) and those from the 23 core primers were converted into the 0/1 format, and the similarity coefficient of the two markers was calculated. The results showed that the similarity coefficient of the morphological markers and the SSR markers was moderate (r = 0.53) (Figure 6). Therefore, combining morphological and SSR markers would be more helpful for identifying non-heading Chinese cabbage.

Figure 6

Five groups not distinguished by the 23 core markers, ‘Yanchun’ and ‘Yanlv’, ‘Guanmei No. 2’ and ‘Jinpin No. 3’, ‘Jingguan No. 1’ and ‘Huaxin’, ‘Jingguan No. 1’ and ‘Xinxiaqing No. 2’, and ‘Huaxin’ and ‘Xinxiaqing No. 2’, were further compared through a field growing test. The plants in each group were very similar (Figure 7), although in each group slight differences were found in some visually observed characteristics such as seed coat color, plumpness of cabbage, leaf margin undulation, or bubble degree (Table S6). The variance analysis of six quantitative characteristics also revealed the existence of some differences in leaf length, leaf width, petiole length, and petiole thickness in four group varieties, but not in the group comprising ‘Guanmei No. 2’ and ‘Jinpin No. 3’ (Figure 7). These results indicated a certain degree of consistency in the identification of varieties between SSR markers and morphological characteristics. The identification results based on morphological characteristics were more accurate and reliable than those based on SSR markers and, when used together with the molecular markers, could obviously improve identification efficiency.

Figure 7

3.4 Application of the SSR fingerprint database

In order to evaluate the application of the SSR fingerprint database in screening for similar varieties using the distinctness test, we selected five candidate varieties for which PVRs had been applied, and compared the similar varieties provided by the applicants (five varieties) with those screened by the SSR fingerprint database (five varieties) through the field planting test. (One of the varieties screened by the molecular fingerprint database was the same as the breeder provided, so there were 14 varieties.) The morphological characteristics comparison showed that four candidate varieties were similar to varieties screened by the SSR fingerprint database in this study (Figure 8). The morphological similarity between ‘Huiwu No. 17’ and ‘Tadiwu No. 1’ was 0.73, that between ‘Huaerziqingfei’ and ‘Dongfangqinggeng’ was 0.53, that between ‘Heihuanghou’ and ‘Heimeigui’ was 0.48, and that between ‘Rehuo No. 16’ and ‘Jinpinxinxia’ was 0.67.

Figure 8

As for candidate variety ‘CT9970’, it was more similar to the similar variety ‘Biangubaicai’ selected by the SSR fingerprint database than to the variety ‘Lingxia 55’ provided by its applicant. Breeding process analysis showed that ‘CT9970’ originated from ‘Biangubaicai’ and retained most of its morphological characteristics, whereas ‘Lingxia 55’ was the F1 generation of ‘CT9970’ and ‘CL45’ (caitai variety), and resulted in low levels of similarity with ‘CT9970’.

Thus, through morphological verification, the SSR fingerprint database can be used not only to screen similar varieties in the distinctness test, but also to preliminarily assess their genetic relationship.

4 Discussion

With the completion of whole-genome sequencing of non-heading Chinese cabbage, more SSR markers have been developed and utilized (Li et al., 2020). Because of the advantages of codominance and high levels of polymorphism, SSR markers provide an effective tool for studying the genetic diversity of non-heading Chinese cabbage (Li et al., 2021). In recent years, SSR markers have been widely used in predicting the genetic diversity and germplasm identification of non-heading Chinese cabbage germplasm resources (Han et al., 2008; Ma, 2015; Li et al., 2017; Li et al., 2018). In this study, by using 423 non-heading Chinese cabbage varieties with rich and diverse phenotypes, 23 pairs of SSR primers (out of 287 analyzed) with better performance than those used in previous studies (Xue et al., 2014; Yang et al., 2020) were identified (average PIC value of 0.693). This may be attributed to the large number of varieties collected, their rich genetic diversity, and the highly accurate capillary electrophoresis detection method used in this study.

Clustering results in this study showed that most of the 423 non-heading Chinese cabbage varieties fell into one of three main groups, pak-choi, caitai, and tacai, which was in line with the actual status of breeding and production. In the study of Ma et al. (2015), Pak-choi varieties are clustered with Caitai, and Tacai in different degrees, which was similar to the research results of this study. In addition, PCA in this study also showed that there was obvious interspecific crossing and extensive gene exchange between the pak-choi and caitai genetic backgrounds (Figure 4), but this phenomenon has been seldom mentioned in previous studies.

According to a previous study, purple is not completely dominant over green in the inheritance of non-heading Chinese cabbage, and the purple color largely depends on anthocyanin content (Zhu, 2017). However, we observed that the hybrid progeny of crosses between a green and a purple non-heading Chinese cabbage variety showed a distribution that was largely skewed towards the phenotype of purple parent, suggesting that all varieties of purple non-heading Chinese cabbage are likely to have the same genetic background.

The genetic diversity of non-heading Chinese cabbage was related to geographical origin (Wang et al., 2008; Liu et al., 2014). Population structure analysis in this study showed that, in east China, germplasm resources were more abundant and genetic diversity was greater, and the three provinces of Jiangsu, Zhejiang, and Fujian in east China had relatively independent genetic structures, which confirmed that non-heading Chinese cabbage in China might originate from the Jianghuai area (Cao et al., 1997).

Recent studies have shown that different varieties can be effectively distinguished and analyzed through complementary differences in morphological markers and molecular markers (Lee and Park, 2017). This complementary method is usually used in germplasm identification (Delfini et al., 2007; Haliloglu et al., 2022) and genetic diversity analysis (Guo et al., 2020; Chikh-Rouhou et al., 2021). Theoretically, one morphological characteristic would be usually regulated by multiple genes. In this study, only five groups could not be distinguished by the 23 core markers, and the field growing comparison test showed that varieties in each of the five groups were very similar but were still distinguishable by some visually observed or measured characteristic. Molecular markers correlated to a medium extent (r = 0.53) with morphological characteristics, which was higher than that in a previous study on peanuts (0.347) (Hong et al., 2021), but no functional molecular markers associated with morphological characteristics in non-heading Chinese cabbage were found in this study. Therefore, without enough functional markers, molecular markers cannot completely replace morphological markers, but a combination of both types of markers would be more accurate and efficient in variety identification and in similar variety screening for the distinctness test.

5 Conclusion

In this study, 23 out of 287 SSR markers were selected as the core markers, with an average PIC value of 0.693 and an average number of alleles of 13.65. Based on the 23 core markers, the SSR fingerprint database comprising 423 non-heading Chinese cabbage varieties was constructed, in which 418 out of the 423 varieties could be distinguished with a discrimination rate of 99.994%. The SSR fingerprint database constructed in this study could be used not only in the identification of varieties but also for similar varieties screening of distinctness test.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding authors.

Author contributions

ZX and RH designed and supervised this project. JY and HZ performed most of the experiments. XW, YM, and JZ carried out part of the experiments. JY, HZ, and XW participated in data analysis. JY, HZ, XW, RH, and ZX wrote the manuscript. YL, GS, and HC revised the manuscript. RH and ZX supervised the study and revised the manuscript. All authors contributed to the article and approved the submitted version.

Funding

The study was co-financed by the National Species Resources Protection Project (h20210472) and the Construction of Agricultural Products Quality and Safety Standards System (2130109).

Conflict of interest

Author GS is employed by Fujian Jinpin Agricultural Technology Co., Ltd.

The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fpls.2023.1112748/full#supplementary-material

References

  • 1

    BanQ. Y. (2009). Construction of a genetic linkage map and mapping QTL of bolting character using F2 population in non-heading Chinese cabbage (China (Nanjing: Nanjing Agricultural University).

  • 2

    BaoS. Y. (2015). Improvement of DNA denaturing polyacrylamide gel electrophoresis in experiment teaching. Exp. Sci. Technol.13, 122–124. doi: 10.3969/j.issn.1672-4550.2015.02.040

  • 3

    CaoJ. S.CaoS. C.MiuY.LuG. (1997). Cladistic operational analysis and study on the evolution of Chinese cabbage groups (Brassica campestris l.). Acta Hortic. Sinica24, 35–42. doi: 10.3321/j.issn:0513-353X.1997.01.007

  • 4

    ChengY.GengJ. F.ZhangJ. Y.WangQ.BanQ. Y.HouX. L. (2009). The construction of a genetic linkage map of non-heading Chinese cabbage (Brassica campestris ssp. Chinensis Makino) J. Genet. Genomics36, 501–508. doi: 10.1016/s1673-8527(08)60140-x

  • 5

    ChenJ. F.LiR. H.XiaY. S.BaiG. H.GuoP. G.WangZ. L.et al. (2017). Development of EST-SSR markers in flowering Chinese cabbage (Brassica campestris l.ssp.chinensis var. utilis tsen et Lee) based on de novo transcriptomic assemblies. PloS One12, e0184736. doi: 10.1371/journal.pone.0184736

  • 6

    Chikh-RouhouH.MezghaniN.MnasriS.MezghaniN.Garcés-ClaverA. (2021). Assessing the genetic diversity and population structure of a tunisian melon (Cucumis melo l.) collection using phenotypic traits and SSR molecular markers. Agronomy11, 1121. doi: 10.3390/agronomy11061121

  • 7

    ChuY. X.DengS.LiS. G.LiuD.ChenH. R.RenL.et al. (2020). Screening and application of SSR molecular markers in varieties identification of flower vegetables. Mol. Plant Breeding20, 163–175. doi: 10.13271/j.mpb.020.000163

  • 8

    DelfiniJ.Moda-CirinoV.RuasC. F.NetoJ. D. S.RuasP. M.BurattoJ. S.et al. (2007). Inference of population structure using multilocus genotype data: Dominant markers and null alleles. Mol. Ecol. Notes7, 574–578. doi: 10.1111/j.1471-8286.2007.01758.x

  • 9

    FalushD.StephensM.PritchardJ. K. (2007). Inference of population structure using multilocus genotype data: dominant markers and null alleles. Mol. Ecol. Notes7, 574–578. doi: 10.1111/j.1471-8286.2007.01758.x

  • 10

    GuoX.ChengF.ZhongY. (2020). Genetic diversity of paeonia rockii (flare tree peony) germplasm accessions revealed by phenotypic traits, EST-SSR markers and chloroplast DNA sequences. Forests11, 672. doi: 10.3390/f11060672

  • 11

    HalilogluK.TurkogluA.TanM.PoczaiP. (2022). SSR-based molecular identification and population structure analysis for forage pea (Pisum sativum var. arvense l.) landraces. Genes13, 1086. doi: 10.3390/genes13061086

  • 12

    HanJ. M.HouX. L.XuH. M.ShiG. J.WangJ. J. (2008). RAPD analysis of genetic diversity of non-heading Chinese cabbage (Brassica campestris ssp.chinensis makino)germplasm. J. Nanjing Agric. University31, 31–36. doi: 10.7685/j.issn.1000-2030.2008.03.006

  • 13

    HeX. L.YangD. Q.DuZ. J.ShangC. Y.ZhongF. L. (2021). Association analysis of morphological traits and SSR genetic diversity in non-heading Chinese cabbage. Mol. Plant Breeding19, 1919–1927. doi: 10.13271/j.mpb.019.001919

  • 14

    HongY. B.PandeyM. K.LuQ.LiuH.GangurdeS. S.LiS. X.et al. (2021). Genetic diversity and distinctness based on morphological and SSR markers in peanut. Agron. J.6, 113. doi: 10.1002/agj2.20671

  • 15

    HouX. L.LiY.HuangY. F. (2020). New advances in molecular biology of main characters and breeding technology in non-heading Chinese cabbage(Brassica campestris ssp. chinensis). Acta Hortic. Sinica47, 1663–1677. doi: 10.16420/j.issn.0513-353x.2020-0534

  • 16

    HouX. L.SongX. M. (2012). Research and utilization of brassica campestris ssp. chinensis makino(non-heading Chinese cabbage) germplasm resources. J. Nanjing Agric. University35, 35–42. doi: 10.7685/j.issn.1000-2030.2012.05.005

  • 17

    JamesR. F. (1987). NTSYS-pc: microcomputer programs for numerical taxonomy and multivariate analysis. Am. Statistician41, 330. doi: 10.2307/2684761

  • 18

    KumarS.TamuraK.NeiM. (2004). MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings Bioinf.5, 150–163. doi: 10.1093/bib/5.2.150

  • 19

    LeeO. N.ParkH. Y. (2017). Assessment of genetic diversity in cultivated radishes (Raphanus sativus) by agronomic traits and SSR markers. Scientia Horticulturae223, 19–30. doi: 10.1016/j.scienta.2017.05.025

  • 20

    LiX. (2010). Analysis of population structure and construction of genetic linkage map in non-heading Chinese cabbage (China (Hebei: Agricultural University of Hebei).

  • 21

    LiG. H.ChenH. C.ZhanY.LiT. Y. (2017). Genetic diversity and phylogenetic relationships analysis of Chinese cabbage germplasm resources by SRAP and SSR. Guangdong Agric. Sci.44, 37–45. doi: 10.16768/j.issn.1004-874X.2017.05.007

  • 22

    LiY.LiuG. F.MaL. M.LiuT. K.ZhangC. W.XiaoD.et al. (2020). A chromosome-level reference genome of non-heading Chinese cabbage [Brassica campestris (syn. brassica rapa) ssp. chinensis. Hortic. Res.7 (1), 212. doi: 10.1038/s41438-020-00449-z

  • 23

    LiP. R.SuT. B.ZhaoY. Y.WangW. H.ZhangD. S.YuY. J.et al. (2021). Assembly of the non-heading pak choi genome and comparison with the genomes of heading Chinese cabbage and the oilseed yellow sarson. Plant Biotechnol. J.19, 966–976. doi: 10.1111/pbi.13522

  • 24

    LiuK. Y. (2017). Construction of genetic linkage map of non-heading Chinese cabbage and identification of plant type phenotypic traits (China (NanJing: Nanjing agricultural university).

  • 25

    LiuL. J.LiuZ. C.ChenH. R.ZhouL. G. (2012). SRAP markers and morphological traits could be used in test of distinctiveness, uniformity, and stability(DUS) of lettuce (Lactuca sativa) varieties. J. Agric. Sci.4, 227. doi: 10.5539/jas.v4n3p227

  • 26

    LiuK.MuseS. V. (2005). PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics21, 2128–2129. doi: 10.1093/bioinformatics/bti282

  • 27

    LiuT. K.Nanjing agricultural university (2021). A molecular marker method for identification of non-heading chinese cabbage suzhouqing, aijiaohuang and wutacai, China patent CN 108165647B. Nanjing, State Intellectual Property Office of the People 's Republic of China.

  • 28

    LiuD. Y.WangX. H.LiuY.ZhangJ.ChenH. Y. (2014). Analysis of genetic diversity and relationship of pakchoi accessions based on SSR markers. Mol. Plant Breeding12, 499–508. doi: 10.13271/j.mpb.012.000499

  • 29

    LiG. G.ZhangH.ZhengY. S.LiR. H. (2018). The genetic diversity analysis of Chinese flowering cabbage resources based on SSR marker. Genomics Appl. Biol.37, 1257–1264. doi: 10.13417/j.gab.037.001257

  • 30

    LoweA. J.JonesA. E.RaybouldA. F.TrickM.MouleC. L.EdwardsK. J. (2002). Transferability and genome specificity of a new set of microsatellite primers among brassica species of the U triangle. Mol. Ecol. Notes2, 7–11. doi: 10.1046/j.1471-8286.2002.00126.x

  • 31

    MaJ. J. (2015). Genetic diversity analysis of non-heading chinese cabbage using SSR markers and agronomic traits (China (Yangling: Northwest A&F University).

  • 32

    PeakallR.SmouseP. E. (2012). GenAlEx 6.5: Genetic analysis in excel. population genetic software for teaching and research–an update. Bioinformatics28, 2537–2539. doi: 10.1093/bioinformatics/bts460

  • 33

    SongX. M.GeT. T.LiY.HouX. L. (2015). Genome-wide identification of SSR and SNP markers from the non-heading Chinese cabbage for comparative genomic analyses. BMC Genomics16, 328. doi: 10.1186/s12864-015-1534-0

  • 34

    TangW. K.TanX.ZhangH.HuangG. Q.XuW. L.LiX. B. (2007). A rapid and simple method of DNA extraction from plant samples. J. Huazhong Normal University3, 441–449. doi: 10.3321/j.issn:1000-1190.2007.03.030

  • 35

    WangF. G.LiX.YangY.YiH. M.JiangB.ZhangX. C.et al. (2018). SSR analyser: A special software suitable for SSR fingerprinting of plant varieties. Scientia Agricultura Sinica51, 2248–2262. doi: 10.3864/j.issn.0578-1752.2018.12.003

  • 36

    WangX. Y.YuS. C.ZhangF. L.YuY. J.ZhaoY. Y.ZhangD. S. (2008). SSR fingerprinting and genetic distinctness of pak-choi (Brassica rapa l.ssp.chinensis Makino).ACAT. Agric. Boreali-Sinica5, 97–103. doi: 10.7668/hbnxb.2008.05.021

  • 37

    XueS. X.LiX.GuA. X.ZhaoJ. J.WangY. H.ShenS. X. (2014). Cluster analysis of non-heading chinese cabbage cultivars based on SSR marker. Northern Horicult.3, 83–87.

  • 38

    YangD. Q.HeX. L.DuZ. J.WangS. B.SunL. W.ZhangL. Y.et al. (2020). Development and polymorphism analysis of EST-SSR markers based on transcriptome of non-heading Chinese cabbage (Brassica rapa ssp.chinensis). J. Agric. Biotechnol.28, 13–21. doi: 10.3969/j.issn.1674-7968.2020.01.002

  • 39

    YanX. L.GuanZ. R.WenW.ZhangZ. F.WangC. Y.ShenJ. J.et al. (2021). Establishment and application of mustard variety identification system based on SSR markers(Brassica juncea l.). J. Plant Genet. Resourc.22, 758–770. doi: 10.13430/j.cnki.jpgr.20201014002

  • 40

    YuS. C.Beijing Academy of Agriculture and Forestry Sciences (2014). A set of SSR primer combinations suitable for constructing nucleic acid fingerprinting database of non-heading chinese cabbage and its application, China patent CN 104073561B. Beijing, State Intellectual Property Office of the People 's Republic of China.

  • 41

    ZhanH.WangD. J.SunJ. M.ZhengY. S.YaoF. X.XuJ. F.et al. (2014). Development and application of a high-throughput Chinese cabbage DNA profiling system based on SSR markers. J. Plant Genet. Resourc.15, 815–823. doi: 10.13430/j.cnki.jpgr.2014.04.020

  • 42

    ZhouY.CaoH. H.WangY.HuangX. C.GuS. G.FuL. J. (2020). Application prospect of molecular markers in DUS testing. Anhui Agric. Sci. Bull.26, 15–18. doi: 10.3969/j.issn.1007-7731.2020.17.006

  • 43

    ZhuH. F. (2017). Study of purple inheritance, response to light and temperature and new germplasm creatation in brassica campestris.ssp.chinensis makino (China (Shanghai: Shanghai Jiao Tong Universit).

Summary

Keywords

non-heading Chinese cabbage, SSR, variety identification, DUS test, genetic diversity

Citation

Yin J, Zhao H, Wu X, Ma Y, Zhang J, Li Y, Shao G, Chen H, Han R and Xu Z (2023) SSR marker based analysis for identification and of genetic diversity of non-heading Chinese cabbage varieties. Front. Plant Sci. 14:1112748. doi: 10.3389/fpls.2023.1112748

Received

30 November 2022

Accepted

16 January 2023

Published

06 February 2023

Volume

14 - 2023

Edited by

Yuri Shavrukov, Flinders University, Australia

Reviewed by

Reetika Mahajan, Sher-e-Kashmir University of Agricultural Sciences and Technology, India; Shahbaz Khan, National Agricultural Research Center, Pakistan

Updates

Copyright

*Correspondence: Ruixi Han, ; Zhenjiang Xu,

†These authors have contributed equally to this work and share first authorship

This article was submitted to Plant Breeding, a section of the journal Frontiers in Plant Science

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics